Efficient CRISPR/Cas9-mediated Targeted Mutagenesis in Populus in the First Generation

Abstract

Recently, RNA-guided genome editing using the type II clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein (Cas) system has been applied to edit the plant genome in several herbaceous plant species. However, it remains unknown whether this system can be used for genome editing in woody plants. In this study, we describe the genome editing and targeted gene mutation in a woody species, Populus tomentosa Carr. via the CRISPR/Cas9 system. Four guide RNAs (gRNAs) were designed to target with distinct poplar genomic sites of the phytoene desaturase gene 8 (PtoPDS) which are followed by the protospacer-adjacent motif (PAM). After Agrobacterium-mediated transformation, obvious albino phenotype was observed in transgenic poplar plants. By analyzing the RNA-guided genome-editing events, 30 out of 59 PCR clones were homozygous mutants, 2 out of 59 were heterozygous mutants and the mutation efficiency at these target sites was estimated to be 51.7%. Our data demonstrate that the Cas9/sgRNA system can be exploited to precisely edit genomic sequence and effectively create knockout mutations in woody plants.

Introduction

The CRISPR/Cas9 system is highly efficient at generating targeted mutations in stable transgenic poplar plants and homozygous mutations at the desired sites can be created in the first generation.In recent years, genome editing technologies using engineered nucleases have been developed as effective genetic engineering methods to target and digest DNA at specific locations in the genome. To date, there are three main types of engineered nucleases for genome editing: zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) and CRISPR (clustered regularly interspaced short palindromic repeats)/Cas1. Among these genome editing approaches, due to its simplicity, design flexibility and high efficiency, the CRISPR/Cas9 system has now been utilized widely for editing the genome of various organisms, including bacteria, yeast and animals2. Most recently, it has also been reported to successfully and specifically edit the genome in plants3,4.

Since the first reports of CRISPR/Cas9 directed genome editing in two model plant species, Arabidopsis thaliana5,6 and Nicotiana benthamiana6,7, this system has been shown to effectively work in at least five crop species, including monocots: rice5,8, wheat9,10, sorghum11, maize12 and dicots: tomato13. The transient expression of Cas9 and sgRNA successfully directs genome modifications in leaf cells or protoplast of Arabidopsis5 and tobacco7,11 and in protoplast of wheat10. The stable transformation process is also applied to create genetically 1 edited lines carrying a mutation in the gene of interest in all these plant species using CRISPR/Cas94. Moreover, in the stable transgenic lines of Arabidopsis, rice and tomato, the sequence changes in first generation of transformants were persist in the next generation14,15. Although CRISPR/Cas9 is rapidly becoming a primary choice for gene editing in plants, there is no report on the efficacy of CRISPR/Cas9 in woody species yet. Therefore, more extensive investigation is still needed to determine whether the efficacy of this system will be universal.

As a most widely planted fast-growing tree, poplars have tremendous economic and ecological value. Since the whole-genome sequence of Populus trichocarpa was released in 200616, extensive genomic resources are now available for functional genomics studies in this species, which has been used as a model in forest genetics and woody plant studies. Thus, understanding of the molecular mechanisms of gene function and transcriptional regulation in Populus is crucial for genetic engineering in trees and sustainable forest management. Compared to Arabidopsis, rice and other annual model plants, however, functional genomics researches in woody plants are more difficult due to long vegetative periods, low efficiency of genetic transformation and a limited number of mutants17. Despite some promising approaches to create knockout mutants in poplar18, large-scale gene mutant resources are still lacking so far.

Here we report an improved approach to delivery Cas9 coding gene and multiple sgRNAs into plant cells by a single plasmid. Based on this system, an poplar endogenous phytoene desaturase gene (PtoPDS) was disrupted site-specifically in the first generation of transgenic plants. The mutagenesis mediated by Cas9/sgRNA in poplar was highly efficient and both homoallelic and heteroallelic pds mutant were detected by DNA sequencing. Taken together, our data suggest that the CRISPR/Cas9 system is a highly efficient and powerful tool for genome modifications in woody plants.

Materials and Methods

Growth and transformation of P. tomentosa Carr. plants

Populus tomentosa Carr. (clone 741) is grown in the greenhouse at 25 °C under a 14-/10-h light/dark cycle with supplemental light (4500 lx). Leaf discs from P. tomentosa Carr. were transformed as described previously by Jia et al.19. Leaves of Chinese white poplar (P. tomentosa Carr.) were excised from in vitro plantlets, cut into disks and dipped in the diluted Agrobacterium culture for 8–10 min. After excess liquid on the surface was absorbed by sterilized paper, the leaf disks were transferred to woody plant medium (WPM) (2 mg/L zeatin, 1 mg/L 1-naphthalene acetic acid [NAA]). The infected disks were co-cultivated in dark for 2 days and then transferred to callus-inducing medium containing 2 mg/L zeatin, 1 mg/L NAA, 400 mg/L cefotaxime, 9 mg/L hygromycin and 0.8% (w/v) agar. After 2–3 weeks of culture without light, these leaf disks with induced calli were subcultured on screening medium (2.0 mg/L zeatin, 0.1 mg/L NAA , 400 mg/L cefotaxime, 9 mg/L hygromycin and 0.8% [w/v] agar) to induce adventitious buds. Regenerated shoots were transferred to rooting medium, containing 0.1 mg/L NAA, 400 mg/L cefotaxime and 9 mg/L hygromycin. Transgenic plants were selected with 9 mg/L hygromycin.

Cloning of PtoPDS gene

The genomic DNA fragment of PtoPDS was amplified with gene-specific primers (PtoPDS-F: 5´-GTTGAATTTGGTTTTGGAGAAATG-3´; PtoPDS-R: 5´- CATTTAATGGTGCAGGGAGAAC-3´) designed based on its homologous gene (Potri.014G148700) sequence in the P. trichocarpa by PCR. The PCR reaction was carried out with pfu DNA polymerase (Takara, China) in a total volume of 50 μL at 94 °C for 3 min; 32 cycles of 94 °C for 45 s, 56 °C for 45 s and 72 °C for 90 s, followed by a final extension of 72 °C for 10 min. The PCR product was cloned and sequenced. The sequence result was supplemented in online materials.

CRISPR/Cas9 target sites selecting

The sequence of PtoPDS was input in the online tool ZiFiT Targeter Version 4.2 (http://zifit.partners.org/ZiFiT/Introduction.aspx)20, which could find the CRISPR/Cas9 target sites within an input sequence. Four of output target sites were selected for designing the sgRNA sequences based on their location in gene and their GC content.

Assemble Cas9/sgRNA construct

The binary pYLCRIPSR/Cas9 multiplex genome targeting vector system carrying CAS9 coding gene and four plasmids with sgRNA cassettes driven by AtU3b, AtU3d, AtU6-1 and AtU6-29, respectively and the multiple sgRNA assembly instruction based on Golden Gate Cloning21,22, were provided by Yao-Guang Liu of South China Agricultural University23. A CRIPSR/Cas9 construct carrying four sgRNA cassettes was generated.

Genomic DNA extraction

For analysis the mutation of PDS gene in transgenic T0 poplars, the genomic DNA was extracted from stable transgenic and wild-type plants following a typical CTAB method. About 0.1 g tissues of poplars were ground in liquid nitrogen and 400 μL of pre-heated CTAB buffer was added for each sample. After incubated at 65 °C for 30 min, 200 μL of chloroform was added and the resulting mixtures stay in room temperature for 10 min. After centrifugation at 16,000 g for 5 min, the supernatant was transferred to a new tube, mixed with 300 μL of isopropanol and incubation in 4 °C for 30 min. Then, genomic DNA was precipitated by 16,000 g centrifuge for 10 min and the DNA pellet was washed with 0.5 mL of 70% ethanol. Pellet of genomic DNA was dissolved in 100 μL of H2O and concentration was determined using spectrophotometer.

Detection of mutation

The genomic DNA extracted from poplars was then used as template to amplify the endogenous PDS fragment by PCR. PCR was performed using specific primers for each targets: the pair of PtoPDS-F1: 5´- GTTGAATTTGGTTTTGGAGAAATG -3´ and PtoPDS-R1: 5´- GCGGAGAAGAACGAAAGG -3´ cover the region of target site 1, 2 and 3; the pair of PtoPDS-F2: 5´- TAGAGGCAGTGAATCAATGGG -3´ and PtoPDS-R2:5´- CCTAAAACATCTCTTGCTTCAAGC -3´ cover the region of target site 2, 3 and 4. The PCR product was separated on an ethidium bromide-stained agarose gel (1.5%) and bands were recovered and cloned into the pMD19-T Simple vector (Takara, China). The mutantions were identified through Sanger sequencing of individual clones. All sequence results were compared with the reference sequence of PtoPDS gene by alignment in DNAMAN (version 7.0). The mutation rate in transgenic plants was calculated according to the ratio of mutated clonal amplicons versus total sequenced clonal amplicons.

Results

Strategy for detection the CRISPR/Cas9-mediated mutagenesis of poplar endogenous gene

In order to test whether the CRSPR/Cas9 system could effectively direct gene-specific editing in Populus, we selected the poplar phytoene desaturase gene (PtoPDS) , which is required for chlorophyll biosynthesis and its mutant shows an albino phenotype in other plant species9,24, as the target of Cas9 endonuclease. Four 20-bp sequences with tandem guanosine nucleotides (PAM) on their 3´-regions in PtoPDS locus were elected as sgRNA complementary sites, including one in 5´ of first exon and three in the second exon (Supplementary Figure S1 and Fig. 1A). By a two-step assemble strategy, the four targeting sequences aiming to PtoPDS were first inserted in the sgRNA expression cassettes (Fig. 1B) and then their cassettes were combined with the Cas9 endonuclease coding sequence in a single plant binary vector, pYLCRIPSR/Cas9P35S-H (Fig. 1C). Using this system and Agrobacterium-mediated transformation, Cas9 and four sgRNAs could simultaneously express in transgenic poplar.

Figure 1
figure1

Schematic diagram of assembling Cas9/sgRNA construct and selecting target sites in the PtoPDS gene.

(A) Schematic illustrating the four sgRNAs (red lines) targeting the PtoPDS coding sequence. Blue boxes indicate exons; orange lines indicate introns; target sites 2 and 3 are titllingly arranged. F1, F2, R1, R2 indicate binding sites of the primers using for PCR amplification. (B) Schematic view of the method for constructing the expression cassettes of sgRNAs. Left, the backbone of sgRNA that any specific targeting sequence can be inserted between the promoter and the unchanged part of guide-RNA using BsaI. Right, the four promters from Arabidopsis, AtU3b, AtU3d, AtU6-1, AtU6-29 were used to drive the four PtoPDS targeted sgRNAs, respectively. (C) Schematic diagram of the assembling of sgRNAs and Cas9 expression cassettes in a single binary vector for plant stable transformation mediated by Agrobacterium. By the design tails after cutting with BsaI, four sgRNA expression cassettes were ligated into the binary vector sequentially.

CRIPSR/Cas9-mediated mutagenesis of PtoPDS in transgenic poplar

We found that, most (89%) of leaf discs transformed with the pYLCRIPSR/Cas9+sgRNA generated at least one albino shoots, which lost green color in the whole plants (Fig. 2). Because the PDS gene is a necessary member in chlorophyll biosynthesis, albino phenotype in these transgenic plants indicates the loss of PtoPDS function. The ratio of albino phenotype occurred in T0 transgenic poplar is more than 50% (30 out of 59), much higher than that previous reported in other species such as Arabidopsis, rice, wheat, sorghum and tomato4,6,8,9,13,14, while no albino phenotype was observed in the control transformed with an empty vector (Table 1).

Table 1 Determination of mutation types in transgenic T0 poplar plants.
Figure 2
figure2

Albinism phenotype of transgenic poplars.

(A,B) Albino phenotype of the regenerated poplar shoots generated on the CRISPR/Cas9-PtoPDS transformed leaf discs. (C) Representative CRISPR/Cas9 directed PtoPDS plants (T0). WT, Nontransgenic wild-type poplar; Ho, biallelic homozygous mutant; Hz, biallelic heterozygous mutant. Both Ho and Hz plants show an albino phenotype.

The poplar PDS gene was mutated at desired targets

To further verify whether loss of green in the transgenic poplar was caused by generation of mutations in the PtoPDS gene by the CRISPR/Cas9 system, more than 100 clones from 8 independent transgenic T0 plants were randomly selected for sequencing (Table S1). The results confirmed that all of these transgenic plants with albino phenotype contained mutant alleles in the PDS gene. Most of the PDS mutant alleles were small insertions or deletions (indels, less than 15 bp) 1 at the desired target sites, as the consequence of repairing through non-homologous end joining (NHEJ) following sgRNA-directed Cas9 cleavages (Fig. 3A). However, some alleles with a sequence inversion (Fig. 3B) between two sgRNAs targeting sites or a big fragment deletion (Fig. 3C–E) were also detected in our experiments. As a result of sequence rearrangement in the exons, the translation of the endogenous PDS gene was frame-shifted or prematurely terminated in the Cas9+PtoPDS sgRNAs transgenic T0 poplars. Interestingly, we also found that the contributions of the four selected sgRNAs to directing Cas9 and mutating target gene were not equal and the highest efficiency (89.3%) of mutagenesis appeared in the sites T2&T3 of the target gene, middle in the site T1 (56.9%) and no mutation was detected in the site T4 (Fig. 3A and Table S1), indicating that the appropriate selection of sgRNA pairs is important to effectively generate indels.

Figure 3
figure3

CRISPR/Cas9-mediated gene editing in transgenic poplar plants.

(A) A range of insertion and deletions (indels) were found in the other T0 plants. Red number in right side means the no. of detected clones with such mutant allele and in which plant such mutant allele is found. (B) A big fragment inversion mutant of PtoPDS. The sequence between the target site1 and target site 2 (296 bp) of PtoPDS were cut down by Cas9 and ligated back to the genome reversely, with 1 and 3 bp of nucleotides around the up- and downstream cut sites were lost. (C) DNA samples from independent transgenic poplar were analyzed for mutations by PCR assays. In the top row, F1 and R1 were used; in the bottom row, F2 and R2 were used. T0-1 represents a heterozygous mutant of PDS, in which two amplification bands with different length were obtained in this assay: “a” indicates the full-length fragment of the PDS gene, “b” indicates a shorter fragment of the PDS gene with mutation. (D) The PCR products from T0-1 plant were separated by their size and cloned and sequenced to validate the deletion directed by CRISPR/Cas9 in the PDS gene. (E) A big fragment deletion mutant of PtoPDS. The 116 bp sequence upstream of target site 2 was lost in the DNA repairing after Cas9 mediated double strain break. In B and E, Red and blue quadrangles indicate the target site 1 and 2 in PtoPDS locus respectively; the red number in the right side means the no. of detected clones with such mutant allele.

In addition, at least two copies of the PDS gene in Chinese white poplar genome were amplified by the gene-specific primers we used and they could be distinguished based on the nucleotide polymorphism in their sequences flanking the target regions (Figure S2). The Cas9 could direct mutation on both of the two PtoPDS copies in a single transgenic plant (Figure S2). This suggests the ability of this multiple sgRNA-Cas9 system to knock-out two or multiple loci in the poplar genome at once.

The Cas9/sgRNA system generated both biallelic homozygous and heterozygous mutants in transgenic poplar

Sequencing analysis of randomly selected clones from individual transgenic T0 plants revealed that, among the 65 clones that could cover target site 1, 2 and 3, most (61) of them were mutated in at least one of these three target sites (Fig. 3A). Actually, 7 (Plant ID 2–8) out of 8 transgenic T0 plants analyzed, contained only mutated alleles of the PtoPDS gene, suggesting that these transgenic lines should be biallelic homozygous pds mutants (Table S1). In contrast, for another transgenic T0 plant (Plant ID 1) which exhibited the half-white phenotype in their 1 organs (Fig. 2B,C), two bands were observed (Fig. 3C) when amplified with the gene-specific primers for the poplar PDS gene. Sequencing analysis confirmed the presence of the innate allele and the mutated allele with 116 bp deletion (Fig. 3D,E), indicating that this transgenic line could be a heterozygous pds mutant. Using our approach, most (28 out of 30, 93.3%) of the pds mutant plants were homozygotes, only 2 transgenic lines (6.7%) were considered as heterozygotes (Table 1). These results implies that the generation of DNA double stranded breaks (DSB) by Cas9 may occurred in an early stage in the regeneration T0 poplars from transgenic calli.

Discussion

In a most recent report, the CRISPR/Cas9 system was delivered into sweet orange (Citrus sinensis) by transient infiltration of A. rhizogenes25, but stable transformation remains a preferred method for delivering nuclease constructs into wood species. To our knowledge, we first successfully applied a CRISPR/Cas9 approach for obtaining stable transgenic woody plants and demonstrated that this system can efficiently and site-specifically mutate endogenous genes. Our data suggest that, by means of the CRISPR/Cas9 technology, locus-specific gene editing has become a routine practice not only in model plants and crops, but also in trees.

The multiple sites editing by the simultaneous expression of two or more sgRNAs has been reported in Arabidopsis6,26, rice15 and tomato13. But the pervious ways to delivery sgRNAs into plants are based on co-transformation of more than one plasmid and relatively low efficiency, which restrict the application of multiple genes editing by CRISPR/Cas9 in plant genome. The pYLCRIPSR/Cas9 multiplex genome targeting vector system is designed to introduce to introduce multiple sgRNA expression cassettes by single vector transformation23. In this study, we used this vector system to successfully target multiple sites of the PtoPDS gene in poplar. Thus, one can foresee an application of the CRISPR/Cas9 system for knocking-out of whole gene family, as shown in rice23.

Besides, it is possible that the insertion or deletion mediated by single sgRNA guided Cas9 did not create a frameshift of target gene, consequently no defect in phenotype. Actually, the indels such as −3 bp or +1/−1  bp, which theoretically not lead to frameshift, were detected in the target 2 region (Fig. 3A). Because there are 4 sgRNAs for one locus being used in our experiment, the possibility that the changes in 3–4 target regions consequently escaped from frameshift is extremely low. Based on our data, we did not find that a transgenic plant with indels in the PtoPDS gene was still green. Therefore, the rate of modifications on multiple target sites affecting the reading frame was much lower in our results.

Our approach can also generate homozygous knockout mutation in predicted loci in T0 generation of transgenic poplar (Fig. 3), which is very important for genetic modification of trees with a long life span. With the advantages of both high efficiency in editing target gene sequence and synchronous mutation in two homologous chromosomes, poplar knockout mutants of interested genes could be generated in a very short time (approximately two months) and with a high ratio using the CRISPR/Cas9 method. Thus, our study proves that, using the CRISPR/Cas9 system, it is not only possible to investigate the function and mechanism of genes in woody trees, but also raises the possibility to construct a mutant library for poplar using the CRISPR/Cas9 system, instead of the T-DNA method used in Arabidopsis.

Additional Information

How to cite this article: Fan, D. et al. Efficient CRISPR/Cas9-mediated Targeted Mutagenesis in Populus in the First Generation. Sci. Rep. 5, 12217; doi: 10.1038/srep12217 (2015).

References

  1. Doudna, J. A. & Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096 (2014).

    Article  Google Scholar 

  2. Wei, C. et al. TALEN or Cas9 - rapid, efficient and specific choices for genome modifications. J Genet Genomics 40, 281–289 (2013).

    CAS  Article  Google Scholar 

  3. Baltes, N. J. & Voytas, D. F. Enabling plant synthetic biology through genome engineering. Trends Biotechnol. 10.1016/j.tibtech.2014.11.008 (2014).

  4. Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Patron, N. J. & Nekrasov, V. Editing plant genomes with CRISPR/Cas9. Curr Opin Biotechnol 32C, 76–84 (2014).

    Google Scholar 

  5. Feng, Z. et al. Efficient genome editing in plants using a CRISPR/Cas system. Cell Res 23, 1229–1232 (2013).

    CAS  Article  Google Scholar 

  6. Li, J. F. et al. Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol 31, 688–691 (2013).

    CAS  Article  Google Scholar 

  7. Nekrasov, V., Staskawicz, B., Weigel, D., Jones, J. D. & Kamoun, S. Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol 31, 691–693 (2013).

    CAS  Article  Google Scholar 

  8. Miao, J. et al. Targeted mutagenesis in rice using CRISPR-Cas system. Cell Res 23, 1233–1236 (2013).

    CAS  Article  Google Scholar 

  9. Shan, Q. et al. Targeted genome modification of crop plants using a CRISPR-Cas system. Nat Biotechnol 31, 686–688 (2013).

    CAS  Article  Google Scholar 

  10. Wang, Y. et al. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat Biotechnol 32, 947–951 (2014).

    CAS  Article  Google Scholar 

  11. Jiang, W. et al. Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res 41, e188 (2013).

    CAS  Article  Google Scholar 

  12. Liang, Z., Zhang, K., Chen, K. & Gao, C. Targeted mutagenesis in Zea mays using TALENs and the CRISPR/Cas system. J Genet Genomics 41, 63–68 (2014).

    CAS  Article  Google Scholar 

  13. Brooks, C., Nekrasov, V., Lippman, Z. B. & Van Eck, J. Efficient gene editing in tomato in the first generation using the clustered regularly interspaced short palindromic repeats/CRISPR-associated9 system. Plant Physiol 166, 1292–1297 (2014).

    Article  Google Scholar 

  14. Feng, Z. et al. Multigeneration analysis reveals the inheritance, specificity and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc Natl Acad Sci U S A 111, 4632–4637 (2014).

    CAS  ADS  Article  Google Scholar 

  15. Zhang, H. et al. The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J 12, 797–807 (2014).

    CAS  Article  Google Scholar 

  16. Tuskan, G. A. et al. The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313, 1596–1604 (2006).

    CAS  ADS  Article  Google Scholar 

  17. Polle, A., Janz, D., Teichmann, T. & Lipka, V. Poplar genetic engineering: promoting desirable wood characteristics and pest resistance. Appl Microbiol Biotechnol 97, 5669–5679 (2013).

    CAS  Article  Google Scholar 

  18. Fladung, M. & Polak, O. Ac/Ds-transposon activation tagging in poplar: a powerful tool for gene discovery. BMC Genomics 13, 61 (2012).

    CAS  Article  Google Scholar 

  19. Jia, Z., Sun, Y., Yuan, L., Tian, Q. & Luo, K. The chitinase gene (Bbchit1) from Beauveria bassiana enhances resistance to Cytospora chrysosperma in Populus tomentosa Carr. Biotechnol Lett 32, 1325–1332 (2010).

    CAS  Article  Google Scholar 

  20. Sander, J. D. et al. ZiFiT (Zinc Finger Targeter): an updated zinc finger engineering tool. Nucleic Acids Res 38, W462–468 (2010).

    CAS  ADS  Article  Google Scholar 

  21. Engler, C., Gruetzner, R., Kandzia, R. & Marillonnet, S. Golden gate shuffling: a one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4, e5553 (2009).

    ADS  Article  Google Scholar 

  22. Zhu, Q. L., Yang, Z. F., Zhang, Q. Y., Chen, L. T. & Liu, Y. G. Robust multi-type plasmid modifications based on isothermal in vitro recombination. Gene 548, 39–42 (2014).

    CAS  Article  Google Scholar 

  23. Ma, X. L. et al. A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 24, pii: S1674-2052 (15) 00204-X (2015).

  24. Qin, G. et al. Disruption of phytoene desaturase gene results in albino and dwarf phenotypes in Arabidopsis by impairing chlorophyll, carotenoid and gibberellin biosynthesis. Cell Res 17, 471–482 (2007).

    CAS  Article  Google Scholar 

  25. Jia, H. & Wang, N. Targeted genome editing of sweet orange using Cas9/sgRNA. PLoS One 9, e93806 (2014).

    ADS  Article  Google Scholar 

  26. Mao, Y. et al. Application of the CRISPR-Cas system for efficient genome engineering in plants. Mol Plant 6, 2008–2011 (2013).

    CAS  Article  Google Scholar 

Download references

Acknowledgements

The authors thank Prof. Yao-Guang Liu (South China Agriculture University, Guangzhou 510642, China) for providing the plant binary vector pYLCRISPR/Cas9 and the sgRNA plasmids. This work was supported by the National Natural Science Foundation of China (31300990, 31370672, 31171620), the program for New Century Excellent Talents in University (NCET-11-0700), the Fundamental Research Funds for the Central Universities (XDJK2014a005) and the “One Hundred Talents Program” of the Chinese Academy of Sciences.

Author information

Affiliations

Authors

Contributions

D.F. and K.M.L. designed the research. D.F., T.T.L., B.J. and C.F.L. performed gene cloning, vector construction, transgenic plants generation and drafted the manuscript. D.F. and S.L. performed phenotype analysis and qRT-PCR analysis. D.F. and K.M.L. modified the manuscript. All authors reviewed the manuscript.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Electronic supplementary material

Rights and permissions

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Fan, D., Liu, T., Li, C. et al. Efficient CRISPR/Cas9-mediated Targeted Mutagenesis in Populus in the First Generation. Sci Rep 5, 12217 (2015). https://doi.org/10.1038/srep12217

Download citation

Further reading

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing