Table 2 Primer sequences and PCR efficiencies in RT-qPCR reactions

From: Relating significance and relations of differentially expressed genes in response to Aspergillus flavus infection in maize

Primer Forward Reverse PCR Efficiency (r-squared values)*
ACIN1 GTACGCCCATTTACCCTGAA ATTCGGCGACCAACTTATTG 0.9837
CBC GGACGAAGTGGTGGACAAGT CTCATAGGGAGGTGGTGCAT 0.9857
CRM1 GCTTCAGGATTCCAAAACCA TAGACCATCAACCGCACAAA 0.9814
eEF1A AGGCTGACTGTGCTGTCCTT ACGTGCCTTGGAGTATTTGG 0.9536
eIF1 GAAAGAACGAGGCTGACGAC TCCACACCTTCTTGTGCATC 0.9454
eIF2 CGAGGCCTTCAAGCTCATAG CTTGAGAGGCTGTGGTGTCA 0.9231
EIF4A3 GAGGACCTTGCGAACAAGAG GGTTCCGTCATGAACTTGCT 0.7357
eIF4E GGTCGATTTTGGGAGGATTT CATCACAGCCTGATGGTCTG 0.9849
eIF5 GGACCACTCAACCTCTCCAA CTCCTCAGTGGACAGCATCA 0.8817
eIF5B TTGGGTGTTGATGTCCTTGA GAAGCTCCTCTGCTGCTCAT 0.9992
Gemin2 GGGTTCTCCGGTGAGTATGA AGATCCCCATTTCTGTGTGC 0.9014
IPOB TCTATGCGATGCCTATGCTG ATAATATGCGGAGCGAATGG 0.9557
MAGOH CAGGAGGATCATCCAGGAGT GTCCTTGCTGGACTGGACAT 0.9774
NMD3 CACCACCTGGAGGAGAAAAA TCTTCCCGAAATCTGACACC 0.9706
Nup53 GCGAACTGGGTGCATATCTT TCCCCTGGTAGTTCTCGTTG 0.9937
Nup62 TGAAACACAAACAGGCTTGG TCATGCTCCACAACTTCTGC 0.9770
Nup85 CCTGATCATGCAGAATGGTG CCAAGCAGCCCTTAAACTTG 0.9788
Nup88 CTCTGTGCATCCTGTCCTCA CTTCCAACCCTTCATCTCCA 0.9855
Nup96 ACGGCAGCATCAAATTTTTC AGTCACCTCTGCAGCCTTGT 0.9811
Nup98 ACGGCAGCATCAAATTTTTC AGTCACCTCTGCAGCCTTGT 0.9774
Nup133 GGATGCTGTGGTGTATGACG TTCCTTGCCCCTAATCACTG 0.9776
Nup160 GTGCCACTTCTGCCTTCTTC CAGCAACAATGACTGGCAAC 0.9693
PABP TGCTATGATACCCCCTCAGC TCCAGCTCCACGCCTAATAC 0.9301
pIcln CTCTACACCTTCGCCGACAT TCCTGGTGGTGAGGTAAAGG 0.9282
Pinin CCCGAATTTGGTGAGAAGAA TCTGCAATTTGCTCACGTTC 0.9966
PRMT5 TTGGGAAAGCCTGGTTACTG GAAATCCCATCAGGCTTCAA 0.9819
PYM ACAACCGGAATCATCTGCTC GCTCCTTAAGCCATCCATCA 0.9711
Rae1 ATTCAAATGCCACAGGGAAG TACTGCAAGGAATGGGAAGG 0.9829
Ran AGAGAAGTTTGGTGGCCTCA ATTACCGCAGAGGACAATGG 0.9519
RanGAP AAGCTGACCTTGGCTGAAAA TTCAGCTGCACAAAATCTGG 0.9782
Ref/Aly CAGAAGTTGGGGAGCTCAAG TGGTTCGACATTGTTTCCAA 0.9829
SAP18 AAGAGGTTGCTCTTCCAGCA CATGATTGCAACGCTCAAGT 0.9763
Sec13 GCTTGTCTCAGGAGGGTTTG ATGACAACCTTCCCGTCTTG 0.9965
SPN1 GCAAACGATGTTTGGTTGTG AAATGCAATCGAGGATGGAG 0.9660
SUMO GATGGCAACGAGGTGTTCTT TCCTCCATCTCCAGCTCATC 0.9480
TEX1 GACCTGGTGTCGAGGGAATA CTGTGTGGCCTTTCAGTTCA 0.9654
TGS1 CTATGGAGCAAACGCACTCA TGCCAGCAGAGTAGATGGTG 0.9461
THOC5 GATGTCTCTGCACCTCGTCA CCCGGATACTTCGTCTGAAA 0.9160
THOC7 AACTGATTTGAAGGCGGAGA TCCCTTCTTCCATGCTCATC 0.9504
UAP56 CTACGTCGGGATCCACAGTT GTTTTCCCCATCCCAGATTT 0.9750
UBC9 GTTCCCTCAGGGTTTCTTCC AGGTGATAGCCATCCGTTTG 0.9221
Urn CATGGGTGGAGTAAGGCTGT TTCGCGTCCCAGAATTTTAC 0.9521
GAPDH CGACTTACTTGGTGACAGCAG CGCCATCCACATTTATTCTCG 0.9713
AI065864 AGAATCGATCCGCCAAGTTA AGGTTGCAACGCTATTGGTC 0.9942
AI065909 TACCACAGCAGAGCAACCAC ATCTCCGGCTGAAGAAGACA 0.9858
AI664980 CTGACACAAAGCGACCTTCA ATCCTGTTCGCTACCGTGTT 0.9989
BE050050 CCGTGGAAATGTGGTAATCC ATCCACGTCAACCATCTTCC 0.9589
BG266083 CTTTGCATCACAAAGCTCCA GGTGAGGAAGAGCAAATGGT 0.9984
BM078796 TTTTCTCCACCTCGGTCTTG AGCGTGAGCTCCTACGACAT 0.9958
BM379345 TTCACACACACCACACAATACC CTGCAACTGTTGATCCCATC 0.996
BM498943 CTCTGTATTGGCCCACGACT AATTGTCGAGGTCGGAGATG 0.9957
CA399536 GGCTGATGCAATAAGGTGGT TTGTTGCCATTCTACCCACA 0.9893
CD443591 ATAGCAGCCATCCTCCATTG GGGAAGAACATCCCCTTGAT 0.993
TC207503 AAACGCCATTGCACATTACA TCTTGAAGGATCGTGTGCTG 0.98
TC223736 AACGGTCAGAATTGGAGTGC GACGACGCAACAGATCTCAA 0.9873
TC231674 GGGCTTCTTGTTGTGCTCTC TTAAAGCGCTGCCTTATTCC 0.9469
TC237311 TGAGGATCATGGAGGAGGAC CCACATTCACGGGCTTATCT 0.9932
TC238832 AGACATGGGATACCGAGACG AGCTCCATCAGCTCCTTGAA 0.9995
TC247683 ATGATGGGAGGCTGACTTTG TCTCAGCGAAATTCATCGTG 0.9765
  1. *To calculate RT-qPCR efficiency (E), use formula E = (1 + rsquared value).