Table 9 The sequence of the gene-specific primers used for the PCR amplification of 104.1 gene of AcMNPV.

From: Transcriptome-wide analysis of a baculovirus using nanopore sequencing

Primer 5′ -> 3′
fw AACGTGCTGTTGAATTATGTGG
rev AAACTGTTATCAATTAGTTTCGTTT