Table 1: List of primers used for reverse transcription and amplification of representative gene transcripts in real-time quantitative RT-PCR (qPCR) analyses.

From: A gene expression atlas of adult Schistosoma mansoni and their gonads

Gene symbol Smp number Forward primer (5′→3′) Reverse primer (5′→3′) Target length (bp)
psm Smp_073410 GGTCTGGTGGTTTCTCGTTC GTACCTTCTGTTGCCCGTG 160
rad50 Smp_181450 TACCCAAAGATCTGGATGCAGA TGAGTGGTCTAACGCATACGG 152
melk Smp_166150 TCTCCAAGGGCTGTACCTGT ATCAGACCCGAGCTTCCTCT 133
hmgcs Smp_198690 GATCCTGGACTCATGTTCGC GTACATAGCTGCTGCCATTCC 159
meg13 Smp_127990 CAAATGGATATAACTTATAGTTGGTG TCGTTTGTGCTTGTGGAAGTAC 155
vwa Smp_127480 TCATTATCGCTTCCATCTACCC CAGCTGGATTATTGGTGACAGT 118
twik Smp_147550 GGATTTGGTGATATTGTACCAGG TTTGTGACACCTATACGACGTC 179
sox Smp_076600 CCTTATACCACAGTTGTTGGTTC TGTACGTTAGGTGCATCGGG 137
syt14 Smp_150350 CTGGTGGACCTTCAGCTTATC CGACGATACGACAAATAAGCGT 168
cpeb1 Smp_070360 AGGTGGTGTTCCAATGCGTG CTGCATAACAATAGCGTCCATC 152
dia Smp_146810 CCGAAGACTTGAAATACGTGAG TGAAGATGGTGATGGCTCGC 157
EIF4G Smp_008900 GCAGGATTGAGTGACAGACG AATCGTAAGCTTGGGACGAGA 158
letem1 Smp_065110 GAAGGTGATCAAGCTCCATTGT TTGTACTGCATGGATAGGTGGT 162
lin9 Smp_133660 CCCAAGTTCTGTGAATGGCTG ACGTGGTCTCCCTATGATCC 177
rgs7 Smp_210800 CAAGTACGTCAAGAGCAAATGAG CGATGTGAAGGCAACAGTGG 119
elav Smp_194950 GCCATCATCACCATCGAGTC TGCTTCCAACTGATGTATCACTG 149
cdc25 Smp_152200 TACGAATCTCCTAGATCAAGGC ACGGAGGAAGGGAACTGTG 137