Platelet glycoprotein V spatio-temporally controls fibrin formation

Beck, Sarah; Öftering, Patricia; Li, Renhao; Hemmen, Katherina; Nagy, Magdolna; Wang, Yingchun; Zarpellon, Alessandro; Schuhmann, Michael K.; Stoll, Guido; Ruggeri, Zaverio M.; Heinze, Katrin G.; Heemskerk, Johan W. M.; Ruf, Wolfram; Stegner, David; Nieswandt, Bernhard

doi:10.1038/s44161-023-00254-6

Download PDF

Article
Open access
Published: 23 March 2023

Platelet glycoprotein V spatio-temporally controls fibrin formation

Nature Cardiovascular Research volume 2, pages 368–382 (2023)Cite this article

5275 Accesses
8 Citations
155 Altmetric
Metrics details

Subjects

Abstract

The activation of platelets and coagulation at vascular injury sites is crucial for hemostasis but can promote thrombosis and inflammation in vascular pathologies. Here, we delineate an unexpected spatio-temporal control mechanism of thrombin activity that is platelet orchestrated and locally limits excessive fibrin formation after initial hemostatic platelet deposition. During platelet activation, the abundant platelet glycoprotein (GP)V is cleaved by thrombin. We demonstrate, with genetic and pharmacological approaches, that thrombin-mediated shedding of GPV does not primarily regulate platelet activation in thrombus formation but rather has a distinct function after platelet deposition and specifically limits thrombin-dependent generation of fibrin, a crucial mediator of vascular thrombo-inflammation. Genetic or pharmacologic defects in hemostatic platelet function are unexpectedly attenuated by specific blockade of GPV shedding, indicating that the spatio-temporal control of thrombin-dependent fibrin generation also represents a potential therapeutic target to improve hemostasis.

Microfluidic high-throughput 3D cell culture

Article 04 April 2024

Jihoon Ko, Dohyun Park, … Noo Li Jeon

Fibroblast and myofibroblast activation in normal tissue repair and fibrosis

Article 08 April 2024

Fereshteh Sadat Younesi, Andrew E. Miller, … Boris Hinz

Pre-eclampsia

Article 16 February 2023

Evdokia Dimitriadis, Daniel L. Rolnik, … Ellen Menkhorst

Main

Hemostasis is the physiological mechanism that limits bleeding after blood vessel injury through intertwined activation of circulating platelets and the plasmatic coagulation cascade¹. The adhesion of platelets to extracellular matrix proteins and von Willebrand factor (VWF) initiates the hemostatic response that is supported by exposure of subendothelial tissue factor (TF), which triggers coagulation and local thrombin generation². This results in a fibrin network encasing platelets in a stable thrombus³. Thrombin generation requires feed-forward reactions that involve platelet activation by thrombin-mediated cleavage and activation of G protein-coupled protease-activated receptors (PARs)⁴ and amplification of coagulation reactions on the surface of activated platelets⁵. Generated thrombin forms fibrin and thereby stabilizes thrombi through platelet receptor GPIIb/GPIIIa engagement and activates factor XIII (FXIII) to cross-link fibrin fibers⁶. These processes are regulated with high fidelity⁷ to ensure efficient hemostasis while preventing thrombosis and thrombo-inflammatory diseases^8,9. In addition, thrombin activity in the circulation is limited by specific plasmatic coagulation inhibitors and by thrombomodulin on endothelial cells, which captures thrombin to initiate the coagulation-regulatory and vascular-protective protein C pathway¹⁰.

The GPIb–GPIX complex mediates platelet binding to VWF and is crucial for hemostasis. Mutations in GP1BA, GP1BB or GP9 cause Bernard–Soulier syndrome, a rare bleeding disorder characterized by giant platelets^11,12. GPV is associated with the GPIb–GPIX complex but is not required for GPIb expression or functional interactions¹³. GPV is an abundant 88-kDa platelet- and megakaryocyte-specific leucine-rich repeat transmembrane protein¹⁴ that interacts with collagen¹⁵ and has minor importance for platelet function^16,17. GPV is proteolytically cleaved by thrombin during thrombus formation^18,19, but the physiological roles of the shed 69-kDa extracellular fragment in hemostasis and thrombosis has remained elusive.

Results

Thrombus formation is accelerated in Gp5-mutant mice

We studied the role of GPV in thrombus formation by comparing wild-type (WT) and Gp5^−/− mice in FeCl₃-induced thrombosis of mesenteric arterioles in vivo. In line with previous observations²⁰, Gp5^−/− mice displayed faster onset of thrombus formation and shortened occlusion times without increased embolization, indicating a prothrombotic phenotype in the absence of GPV (Fig. 1a,b). Platelet hyper-reactivity to thrombin is the presumed but unproven mechanism for enhanced thrombosis in Gp5^−/− mice and is thought to be related to thrombin-mediated cleavage of GPV. To directly study the relevance of thrombin-mediated GPV cleavage, we generated a mouse carrying a point mutation in the thrombin cleavage site of GPV (Gp5^dThr; Extended Data Fig. 1a). Platelets of these mice showed unaltered surface expression levels of GPV compared to those of WT mice, and GPV was completely resistant to cleavage by thrombin (Extended Data Fig. 1b,c and Extended Data Table 1). By contrast, cleavage of the mutant GPV by endogenous a disintegrin and metalloproteinase (ADAM)17 (ref. ²¹) was not affected (Extended Data Fig. 1b–e), demonstrating the thrombin specificity of the Gp5^dThr mutation. Unexpectedly, Gp5^dThr mice displayed accelerated thrombus formation in the FeCl₃ arteriolar injury model and, in this respect, resembled Gp5^−/− mice (Fig. 1c,d).

**Fig. 1: Platelet thrombin hyper-responsiveness and accelerated thrombus formation in *Gp5*-mutant mice.**

In a series of experiments, we addressed the possibility that excessive platelet activation also caused the prothrombotic phenotype of Gp5^dThr mice. Loss of surface GPV led to hyper-reactivity of Gp5^−/− platelets specifically at lower thrombin concentrations but not with other agonists (Fig. 1e,g,h and Extended Data Fig. 1f–h), as previously shown^{15,20,22,23,24}. In sharp contrast to Gp5^−/− platelets, measurements of P-selectin exposure (Fig. 1f) and α_IIbβ₃ integrin activation and platelet aggregation (Fig. 1g,h and Extended Data Fig. 1i) showed that Gp5^dThr platelets were not hyper-reactive at the threshold thrombin concentration. Of note, both Gp5^−/− and Gp5^dThr platelet-rich plasma (PRP) showed unaltered clot retraction (Extended Data Fig. 1j).

We next tested the hypothesis that membrane-bound GPV might act as a regulator of thrombin-mediated PAR activation²⁵, supported by the high-affinity binding of thrombin for GPIbα^26,27. Blockade of the GPIbα–thrombin interaction on mouse platelets with Fab fragments of the anti-GPIbα antibody p0p/B^28,29 (Extended Data Fig. 2a) indeed diminished platelet activation, particularly at low thrombin concentrations (Extended Data Fig. 2c). Although human and mouse platelets are activated by thrombin through different PARs, these antibody inhibition data indicated that mouse platelets are similar to human platelets²⁵ in requiring GPIbα for thrombin-induced activation at threshold agonist concentrations. Remarkably, the anti-GPIbα antibody completely abolished the enhanced activation of Gp5^−/− platelets relative to WT platelets (Extended Data Fig. 2c), implying that loss of GPV sensitized to GPIbα-dependent thrombin signaling. By contrast, activation of Gp5^dThr platelets at threshold concentrations of thrombin was indistinguishable from that of WT platelets with or without anti-GPIbα p0p/B (Extended Data Fig. 2b,c). Thus, surface GPV regulates platelet responsiveness to thrombin primarily by interference with GPIbα-dependent PAR signaling in mouse platelets (Extended Data Fig. 2d,e).

The delineated pathway of enhanced in vitro thrombin signaling in Gp5^−/− platelets could not explain the similar prothrombotic phenotype of Gp5^−/− and Gp5^dThr mice in vivo, suggesting that shed GPV regulates thrombus formation by a mechanism unrelated to the regulation of platelet activation following vascular injury. We therefore next asked whether platelet procoagulant function might be regulated by GPV. Measurements of TF-initiated thrombin generation in PRP did not, however, uncover differences between Gp5^−/−, Gp5^dThr and WT platelets (Extended Data Fig. 2f–k), in line with previous results from GPV-deficient platelets¹², excluding alterations in platelet membrane procoagulant activity.

We next evaluated whether the known collagen interaction of GPV might contribute to thrombus growth modulation by GPV. Platelet activation is triggered through two major signaling pathways. Specifically, soluble agonists, including thrombin and secondary mediators ADP and thromboxane A2, act through G protein-coupled receptors, whereas immobilized and/or multimeric ligands signal through immunoreceptor tyrosine-based activation motif (ITAM)-coupled receptors, C-type lectin-like receptor 2 (CLEC-2) and GPVI. Platelet GPVI is the major activating collagen receptor, and GPVI deficiency and antagonism protect from arterial thrombosis with more moderate effects on hemostasis³⁰. We analyzed thrombus formation in the absence or presence of platelet GPVI to uncover potential collagen-binding functions of GPV. GPVI was immunodepleted from platelets by injection of the anti-GPVI antibody JAQ1 (ref. ³¹) 5 d before inducing FeCl₃ mesenteric arteriole injury (Extended Data Fig. 3a,b). As reported previously³¹, GPVI depletion markedly attenuated occlusive thrombus formation in WT mice in vivo. Surprisingly, loss of GPVI was without effect in the absence of GPV, and the shortened occlusion times of Gp5^−/− mice persisted even after GPVI depletion in two distinct vascular beds (Extended Data Fig. 3c–e).

In addition, GPV deficiency prevented the prolongation of the bleeding time associated with GPVI depletion in WT animals (Extended Data Fig. 3f). These data essentially excluded the possibility that GPV regulated GPVI–collagen interaction or contributed to collagen-dependent platelet activation under these experimental conditions. Rather, GPV deficiency over-ruled the hemostatic and thrombotic defects caused by the absence of GPVI and restored thrombus formation in vivo. It has previously been shown that functional defects related to GPVI–ITAM-mediated platelet activation can be attenuated by increased local thrombin generation in different vascular beds³², and mouse GPVI does not interact with mouse fibrinogen³³. Thus, the demonstrated reversal of GPVI inhibition in Gp5^−/− mice suggested that soluble GPV (sGPV) regulated thrombin activity during thrombus formation.

sGPV binds to thrombin and localizes to fibrin

We therefore evaluated the role of GPV in thrombin-mediated fibrin formation on collagen–TF spots in recalcified whole blood under flow in vitro³⁴. Time to fibrin formation was shortened and the overall amount of fibrin generated was increased in Gp5^−/− mice (Fig. 2a–c) and, importantly, also in Gp5^dThr mice (Fig. 2d–f) compared to WT controls. Quantitative imaging of formed thrombi and generated fibrin³⁵ showed increased thrombus height, based on multilayer and contraction scores, as well as fibrin formation, based on fibrin surface coverage and fibrin score, in the blood of both mutant mouse lines (Fig. 2g). Of note, this ex vivo experimental setup produced results entirely in line with the in vivo findings that Gp5^−/− and Gp5^dThr mice concordantly displayed accelerated thrombus formation.

**Fig. 2: GPV alters fibrin formation and localizes to fibrin fibers outside the thrombus after thrombin cleavage.**

These data indicate that cleavage of GPV is a critical step in an autoregulatory limitation of fibrin generation. Thrombin binds to de novo generated fibrin via the regulatory thrombin exosites I and II and thereby becomes protected from coagulation inhibitors in the blood³⁶. We hypothesized that sGPV directly or indirectly affected thrombin–fibrin interactions. We first evaluated the direct interaction of sGPV and thrombin. We stimulated platelets with biotinylated thrombin and showed that sGPV coprecipitated in the thrombin pulldown using streptavidin-coated beads (Fig. 2h), consistent with direct interaction of thrombin with sGPV.

Because GPV release was required to attenuate fibrin formation of recalcified whole blood perfused over collagen–TF spots (Fig. 2a–f), we next quantified the colocalization of GPV with fibrin in this setting. Using confocal microscopy with super-resolution mode, we excluded in the image analysis platelet-rich areas based on GPIX staining and subsequently quantified the colocalization of GPV with fibrin (Fig. 2i,j and Supplementary Fig. 1). Quantification of GPV intensities showed that GPV accumulated with fibrin in platelet-free areas of thrombi (Fig. 2j).

Based on these data, we reasoned that, upon initiation of a hemostatic platelet response, thrombin-mediated cleavage of GPV formed sGPV–thrombin complexes, which limited thrombin diffusion and activity in the forming fibrin clot. To test this concept, we recombinantly expressed the ectodomain of human GPV using a construct that included the thrombin cleavage site (rhGPV) (Fig. 3a). Aggregation of rhGPV at high concentrations prevented us from performing experiments with full dose–response curves. However, thrombin-mediated platelet activation was only marginally inhibited by 290 nM (20 µg ml⁻¹) rhGPV at threshold thrombin concentrations (Extended Data Fig. 4a,b), in line with the conclusion that platelet activation by thrombin is primarily regulated by membrane-bound GPV. In sharp contrast, rhGPV at the same concentration impaired fibrin formation in a static polymerization assay (Fig. 3b and Extended Data Fig. 4c,d) triggered specifically by thrombin, whereas fibrin polymerization induced by another protease, batroxobin, was unaltered in the presence of rhGPV (Fig. 3b and Extended Data Fig. 4c,d). Importantly, sGPV localized to fibrin polymers independent of the clot-inducing enzyme, indicating direct interactions of GPV with fibrin independent of thrombin–GPV complex formation.

**Fig. 3: rhGPV reduces fibrin formation and thereby protects from occlusive thrombosis and ischemic stroke.**

These data also indicate that sGPV in the developing clot directly inhibits thrombin’s activity to form fibrin. We therefore studied the interaction of rhGPV with thrombin in the absence of fibrinogen. Incubation of equimolar concentrations of thrombin with rhGPV containing the thrombin cleavage site resulted in time-dependent rhGPV proteolysis, demonstrating that GPV is a thrombin substrate independent of anchoring to the platelet surface (Extended Data Fig. 4e–g). However, formation of sGPV stopped after 5–10 min, when approximately 50% of the substrate was consumed. Measurements of thrombin activity toward a chromogenic substrate were unchanged during the reaction time, excluding instability of the enzyme (Extended Data Fig. 4g). Of note, at the end of the incubation time, sGPV still inhibited thrombin’s activity to form fibrin (Extended Data Fig. 4h–j). To distinguish between substrate depletion and product inhibition, we performed the same reaction with a tenfold higher substrate concentration. This reaction yielded essentially the same amount of product, implying that the generated sGPV caused product inhibition and interacted with thrombin independent of fibrin binding. Attempts to chemically cross-link sGPV and thrombin under these conditions were unsuccessful, suggesting that the required amino groups were not in close enough proximity.

rhGPV reduces fibrin formation and protects from thrombosis

In addition, rhGPV impaired fibrin formation in human (Extended Data Fig. 5a–c) and mouse blood (Extended Data Fig. 5d–g) in the collagen–TF-induced thrombus-formation assay under flow, supporting a role for sGPV in limiting thrombin activity toward fibrin. Analysis of the formed fibrin fibrils by confocal microscopy revealed a fine, dense and branched network consisting of thin, clearly distinguishable fibers in control samples, whereas fibers were generally thicker but less frequent and structurally less defined in the presence of rhGPV (Extended Data Fig. 5f), confirming that rhGPV impedes fibrin formation. Of note, a His-tagged fusion protein did not reduce fibrin formation, demonstrating specificity of the recombinant GPV.

We next measured thrombin activity in the outflow of the flow chamber and found that less thrombin activity was recovered in rhGPV-treated samples compared to controls (Extended Data Fig. 5h). Conversely, we found more thrombin in the outflow of the chambers perfused with Gp5^−/− and Gp5^dThr versus WT blood (Extended Data Fig. 8a), further supporting the conclusion that sGPV controls thrombin activity specifically in fibrin clots. We next imaged thrombin activity in flow chambers cleared of blood by perfusion with Tyrode’s buffer and the thrombin substrate Z-GGR-AMC. We found reduced thrombin activity in clots formed in the presence of rhGPV (Extended Data Fig. 5i,j). In sum, these data support a role for GPV in retaining thrombin in fibrin clots and limiting thrombin’s activity in fibrin formation.

We next tested whether rhGPV could modulate thrombus formation in vivo. Indeed, a single intravenous dose of 20 μg rhGPV before thrombosis induction reduced arterial thrombus formation in two different experimental models. In a model of mechanical injury to the abdominal aorta in which blood flow and occlusive thrombus formation were monitored by an ultrasonic flow probe (Fig. 3c and Extended Data Fig. 5k), 14 of 15 mice did not form stable thrombi after rhGPV administration within the observation period of 30 min, whereas 18 of 18 arteries occluded in the control group. In FeCl₃-induced mesenteric arteriole injury, time to occlusion was markedly prolonged in mice treated with rhGPV (Fig. 3d,e).

In addition, rhGPV treatment provided protection from thrombo-inflammatory neurological damage and improved neurological outcome in the transient middle cerebral artery (MCA) occlusion (tMCAO) model of ischemic stroke (Fig. 3f–h) in which the concerted action of platelets, the coagulation system and immune cells is known to drive post-ischemic cerebral infarct growth³⁷. Of note, infarct volumes of Gp5^−/− and Gp5^dThr mice after tMCAO were comparable to those of WT mice (Fig. 3f–g), suggesting that thrombin activity in WT mice is already above threshold values needed to fully promote infarct progression under these experimental conditions. Importantly, no large intracranial hemorrhages were observed in Gp5^−/− or Gp5^dThr and rhGPV-treated WT mice (Fig. 3g). Of note, MCA vessel diameters were similar in Gp5^−/− and WT mice (Extended Data Fig. 6). In addition, hemostatic function evaluated by the tail-bleeding time assay was also comparable between mice injected with rhGPV and vehicle-treated controls (Fig. 3i), indicating that this pathway might be targeted safely. Together, these data showed that sGPV specifically limited fibrin formation and pathological intravascular thrombus growth without impairing the initial platelet activation required for hemostasis.

Blocking GPV cleavage offsets defects in hemostatic platelet function

To further study thrombin interaction with GPV, we generated a panel of anti-GPV monoclonal antibodies (termed DOM monoclonal antibodies; Extended Data Fig. 7) and first evaluated their ability to inhibit thrombin-mediated GPV cleavage (Fig. 4a). Cleavage of substrates by thrombin involves binding and allosteric regulation by thrombin exosites I and II that flank the active site³⁸. Blockage of exosite I with the thrombin-binding aptamer HD1 (ref. ³⁹) was more efficient than blocking exosite II with HD22 (ref. ⁴⁰), whereas a non-blocking aptamer HD23 had no effect on thrombin-mediated release of GPV from platelets (Extended Data Fig. 7g). Thus, thrombin interaction with fibrin and GPV occurred through overlapping sites³⁶. With this screening assay, we identified the monoclonal antibody DOM/B that markedly reduced thrombin-mediated GPV cleavage and synergized with thrombin exosite-directed aptamers (Fig. 4a and Extended Data Fig. 7g), whereas the monoclonal antibody DOM3 was non-inhibitory (Fig. 4a,f and Extended Data Fig. 7b). In PRP, we tested inhibitory activities of DOM/B in a thrombin-induced clotting assay, in which fibrin is formed independent of platelet activation. Whereas thrombin exosite II blockade with HD22 prolonged clotting times, clotting was unaffected by DOM/B treatment and was also indistinguishable between WT, Gp5^−/− and Gp5^dThr samples (Extended Data Fig. 7h). Thus, thrombin regulation by GPV specifically occurs under conditions of platelet activation under flow.

**Fig. 4: The anti-mGPV antibody DOM/B interferes with thrombin-mediated cleavage of GPV and reproduces the *Gp5*^−/− phenotype.**

In addition, DOM/B had no effect on thrombin-induced platelet activation (Extended Data Fig. 7d–f), indicating that this monoclonal antibody did not sterically hinder the interaction of GPV with the GPIb–GPIX complex involved in GPIbα–thrombin–PAR platelet signaling. Remarkably, however, DOM/B significantly shortened time to fibrin formation and increased the amount of generated fibrin under flow conditions (Fig. 4b,c) as well as thrombin activity in the outflow of the flow chamber (Extended Data Fig. 8a), thereby reproducing the phenotypes seen with Gp5^−/− and Gp5^dThr mice. In line with reduced proteolytic release of GPV in the presence of DOM/B, we found less GPV colocalizing with fibrin than in controls (Extended Data Fig. 8b). The panel of anti-GPV monoclonal antibodies was also evaluated for interference with collagen-dependent platelet activation. Whereas DOM/B and DOM3 were non-inhibitory (Extended Data Fig. 7b,c), inhibition of platelet activation in this assay by DOM/C indicated that this monoclonal antibody was directed against the collagen-binding site of GPV (Extended Data Fig. 7a). DOM/C did not interfere with thrombin-mediated GPV cleavage (Fig. 4a) and did not enhance fibrin formation under flow, consistent with the crucial and specific role of sGPV release in this context (Fig. 4d,e). These data suggested that the collagen-binding activity of (s)GPV is functionally not required for its ability to modulate fibrin formation under flow in vitro and in vivo.

We next evaluated the effect of blocking GPV–thrombin interaction with DOM/B on fibrin and thrombus formation in vivo. Of note, injection of DOM/B did not cause platelet depletion and the monoclonal antibody remained detectable on the surface of circulating platelets for up to 6 d (Extended Data Fig. 8c,d). In line with the observed increased fibrin formation under flow in vitro, DOM/B treatment caused accelerated thrombus formation in FeCl₃-injured mesenteric arterioles in vivo, whereas neither blockade of the collagen-binding site on GPV with DOM/C nor the non-inhibitory DOM3 affected thrombus formation (Fig. 4f,g). These data showed that the release of sGPV acts as a safety valve to limit thrombus growth after initial platelet activation required for hemostasis. We have previously shown that the absence of the two major collagen receptors GPVI and integrin α₂β₁ causes severe bleeding in mice⁴¹. In line with the reversal of bleeding defects caused by GPVI deficiency in Gp5^−/− mice, DOM/B treatment restored hemostasis and thrombus formation in the complete absence of the two major platelet collagen receptors GPVI and α₂β₁ (Extended Data Fig. 8e–g, summarized in Extended Data Fig. 8h).

These results suggest that interference with GPV cleavage can be used to enhance fibrin formation in the context of defective hemostasis caused by diverse mechanisms. We therefore investigated whether GPV-cleavage blockade with DOM/B not only restored hemostasis in the case of defective (hem)ITAM signaling but also other genetic and pharmacological impairments of platelet function. Lack of the small GTPase RhoA causes macrothrombocytopenia and defective platelet activation, resulting in a bleeding defect⁴². Similarly, neurobeachin-like 2 (NBEAL2) deficiency leads to macrothrombocytopenia and lack of α-granules, resulting in severely impaired hemostasis⁴³. Interestingly, DOM/B treatment improved and restored hemostasis in mice with platelet RhoA deficiency or lacking NBEAL2 (Fig. 4h,i).

Thrombocytopenia is a major clinical challenge occurring frequently in the context of a variety of pathologies or medical treatments that is associated with increased bleeding and often with the need for immediate therapeutic intervention^44,45. To test a possible benefit of a GPV-cleavage blockade in this setting, we induced severe thrombocytopenia by reducing platelet counts to 5–10% of normal by injecting a platelet-depleting antibody^46,47. While a resulting severe bleeding defect was observed in all nine platelet-depleted control mice, this was significantly attenuated by DOM/B treatment, and, remarkably, nine of 11 DOM/B-treated thrombocytopenic mice managed to stop bleeding within the observation period (Fig. 4j). The current clinical standard of care to reduce the risk of heart attack and ischemic stroke is the pharmacological inhibition of platelet function by purinergic P2Y₁₂ ADP receptor blockers alone or in combination with acetyl salicylic acid. As seen in humans, mice treated with the P2Y₁₂ blocker clopidogrel exhibited increased bleeding that was reversed by treatment with DOM/B, blocking thrombin-dependent GPV release from platelets (Fig. 4k). Thus, specific targeting of GPV with DOM/B prevented prolongation of the bleeding time caused by thrombocytopenia, genetic defects and anti-platelet therapy, indicating clinical potential of anti-GPV treatment to restore hemostasis by improving thrombin-dependent fibrin formation.

Blocking GPV cleavage increases fibrin formation in human blood

We therefore evaluated the relevance of this concept for human platelet function and screened a panel of newly generated anti-human GPV (hGPV) monoclonal antibodies (termed LUM monoclonal antibodies) for their ability to interfere with thrombin-mediated cleavage of GPV. Recapitulating the inhibitory properties of DOM/B in the mouse system, LUM/B prevented thrombin-mediated cleavage of GPV on human platelets, whereas other anti-hGPV monoclonal antibodies (LUM1–LUM5) were non-inhibitory (Fig. 5a and Extended Data Fig. 9c). LUM/B per se did not activate human platelets (Extended Data Fig. 9a,b) or influence thrombin clotting (Extended Data Fig. 9e) or thrombin-induced platelet activation as shown by unaltered integrin α_IIbβ₃ activation or P-selectin exposure in the presence of the antibody (Fig. 5b and Extended Data Fig. 9d). In the established flow assay on immobilized collagen–TF, GPV blockage on human platelets with LUM/B significantly accelerated fibrin formation in recalcified whole blood (Fig. 5c–e), whereas the non-inhibitory LUM3 antibody was without effect (Extended Data Fig. 9f,g). Thus, spatio-temporal control of fibrin formation on thrombogenic surfaces by GPV is a species-conserved mechanism to restrict thrombosis while preserving hemostasis.

**Fig. 5: The anti-hGPV monoclonal antibody LUM/B interferes with thrombin cleavage and accelerates fibrin formation.**

Discussion

We here delineate the function of platelet GPV that is proteolytically released by thrombin in the context of platelet activation at sites of vascular injury. Genetic blockade of thrombin-mediated shedding of GPV uncovered the crucial role of sGPV as a regulator of fibrin formation and thrombus growth. The cleavage of membrane-bound GPV occurs after platelet adhesion and initiation of thrombin generation and is thus temporally separated from the initial hemostatic response. We show that generated sGPV then interacts with generated fibrin and dampens thrombin activity toward fibrinogen. This spatially restricted action of sGPV after release from the platelet surface specifically limits thrombus growth in vitro and in vivo (summarized in Fig. 6). As demonstrated by pharmacological application of rhGPV, sGPV provides protection from thrombo-inflammatory neurological damage in an experimental model of ischemic stroke without causing hemostatic impairments. Conversely, specific blockade of thrombin-mediated GPV shedding can enhance local fibrin formation in a variety of contexts associated with severe defects in platelet function. This unique spatio-temporal control of thrombin activity by GPV can thus be harnessed to promote hemostasis.

**Fig. 6: GPV modulates thrombin-mediated platelet activation and fibrin formation.**

Prevention of thrombosis while preserving hemostasis has been a central goal of anti-thrombotic drug development. Despite the broader application and safety of target-selective oral anticoagulants, preventing bleeding complications remains an unmet clinical need. Although a recent study provides proof of principle that platelet-mediated thrombin generation can rescue bleeding defects due to increased fibrinolysis⁴⁷, there is an unmet clinical need for more general and specific spatio-temporal control of fibrin formation. New hemostatic agents are approved or in development to bypass genetic or acquired deficiencies in the coagulation cascade⁴⁸, but platelet transfusion remains the only therapeutic option to acutely restore defective platelet function or severe forms of thrombocytopenia to secure hemostasis. Akin to the strategies that ‘inhibit the inhibitors’ of coagulation, we here propose a therapeutic strategy of tailored activation of hemostatic fibrin plug formation in the spatio-temporal context of platelet deposition at sites of vessel wall injury. By increasing local thrombin bioavailability without compromising scavenging of thrombin by endothelial cell-expressed thrombomodulin, this approach has little risk to interfere with physiological anticoagulation in the body and vascular-protective and anti-inflammatory signaling of the protein C–PAR1 pathway¹⁰.

Methods

Animals

Mice were maintained under specific pathogen-free conditions (constant temperature of 20–24 °C and 45–65% humidity with a 12-h light–dark cycle, ad libitum water and food access), and experiments were performed in accordance with German law and the governmental bodies and with approval from the District of Lower Franconia.

Gp5^−/− (ref. ¹²) and Itga2^−/− (ref. ⁴⁹) mice were kindly provided by F. Lanza (Inserm-Université de Strasbourg, Strasbourg, France) and B. Eckes (Department of Dermatology, University of Cologne, Cologne, Germany), respectively. Gp5^dThr mice, which carry a point mutation in the sequence corresponding to the thrombin cleavage site of GPV, were generated and are described in Extended Data Fig. 1a. Gp5^dThr mice were intercrossed with Flip-positive mice to delete the Neo cassette and backcrossed to the C57Bl/6J background. Rhoa^fl/fl (ref. ⁵⁰) mice were kindly provided by C. Brakebusch (University of Copenhagen, Copenhagen, Denmark). To generate MK- or platelet-specific knockout mice, floxed mice were intercrossed with mice carrying the sequence for Cre recombinase under control of the Pf4 (platelet factor) promoter. Nbeal2^−/− (ref. ⁴³) mice were described previously. All mice were kept on a C57Bl/6J background, and all animal experiments and analysis of the corresponding data were performed blinded.

Female Wistar rats (strain RjHan:WI, starting at 6 weeks of age) were immunized to generate monoclonal anti-GPV antibodies.

Human blood samples

For this study, blood samples were obtained from healthy volunteers, free from anticoagulant or anti-platelet therapy for at least 4 weeks, following written informed consent in accordance with the Declaration of Helsinki and after approval by the Institutional Review Boards of the University of Würzburg (votes 167/17 and 295/20).

Chemicals

Midazolam (Roche Pharma), dorbene (Pfizer) and fentanyl (Janssen-Cilag) were used according to regulations of the local authorities. Clopidogrel was from Sanofi, low-molecular-weight heparin was from ratiopharm, and recombinant hirudin was from CoaChrom. Human fibrinogen (F4883), bovine thrombin (T4648), N-ethylmaleimide (23030) and prostacyclin (PGI₂) were from Sigma-Aldrich. ProLong Glass Antifade Mountant (P36980) and fibrin(ogen) AF488 (F13191) were from Thermo Scientific. Iron(III) chloride (FeCl₃) was from Roth. A23187 was from AppliChem; ionomycin was from VWR. Convulxin was from Axxora. Fibrillar type I collagen (Horm) was from Takeda; rhodocytin was provided by J. Eble (University of Münster, Münster, Germany). Collagen-related peptide (CRP) was generated in house by formaldehyde cross-linking of GKO(GPO)₁₀GKOG (purchased from Cambridge Research Biochemicals, with O = l-hydroxyproline)⁵¹. Integrilin was from GlaxoSmithKline. Human thrombin was from Roche (Sigma-Aldrich, 10602400001). Apyrase type III was from GE Healthcare; biotinylated thrombin (69672-3) was from Merck–Millipore. Z-GGR-AMC-HCl was from Bachem; thrombin calibrator was from Stago; human recombinant TF (Dade Innovin) was from Siemens Healthcare. The fluorogenic thrombin substrate Pefafluor TH was from Pentapharm. Donkey anti-rat IgG FITC (112095068) was from Jackson ImmunoResearch. DNA aptamers (HD1, GGTTGGTGTGGTTGG; HD22, AGTCCGTGGTAGGGCAGGTTGGGGTGACT) to block thrombin exosites and the control aptamer HD23 (AGTCCGTAATAAAGCAGGTTAAAATGACT) were from Future Synthesis.

Antibodies

PAC-1–FITC (340507) and anti-CD62P–APC (550888) antibodies were from BD Biosciences; control rat IgG (I4131) and anti-GAPDH antibody (G9545) were from Sigma. Anti-mGPV antibody (AF6990) for western blot analysis was from R&D; the anti-hGPV antibody (sc271662) for western blot analysis was from Santa Cruz. The platelet-depletion antibody R300 (rat anti-GPIbα IgG antibody) was from Emfret Analytics. Anti-mCD31 antibody (clone 390, conjugated in house to AF647) was from BioLegend (102402). A detailed list of antibodies generated in house is provided in Supplementary Table 1 (refs. ^{52,53,54,55,56,57,58,59,60,61,62}).

New antibodies were generated by hybridoma technology following immunization of Gp5^−/− mice or Wistar rats with recombinant hGPV protein or GPV immunoprecipitated from mouse or human platelet lysates.

Expression and purification of recombinant hGPV

The gene fragment encoding the GP64 signal peptide (MVSAIVLYVLLAAAAHSAFA), the human GPV extracellular domain (amino acids 17–518) and a decahistidine tag was amplified, inserted into the pFastBac dual vector and transformed into the DH10Bac Escherichia coli strain (Thermo Fisher Scientific). The resulting bacmid DNA was prepared and then transfected into Sf9 insect cells (Thermo Fisher Scientific, 11496015) using CellFectin II reagent (Thermo Fisher). The high-titer P2 baculovirus stock was prepared from scaled-up Sf9 cells in Sf-900 II serum-free medium (Thermo Fisher Scientific, 10902088) following the instructions for the Bac-to-Bac Baculovirus Expression System (Thermo Fisher Scientific) and used to induce hGPV expression in Sf9 cells (2 × 10⁶ cells per ml, MOI of 2) for 72 h. hGPV was purified from insect cell medium by Ni affinity chromatography using a GE Healthcare Ni Sepharose excel column (elution buffer: 20 mM sodium phosphate, 500 mM NaCl, 500 mM imidazole, pH 7.4), followed by size-exclusion chromatography using a GE Healthcare HiLoad 16/600 Superdex 200-pg column (elution buffer: PBS containing 0.1% Tween-20, pH 7.4). The purified protein was stored at −80 °C in PBS containing 0.1% Tween-20 and 20% glycerol. Notably, rhGPV precipitated at concentrations above 0.5 mg ml⁻¹, limiting its biophysical characterization.

Antibody treatment

For antibody treatment experiments, mice were separated into antibody and control treatment groups in a randomized manner using https://www.random.org/lists/. Next, 100 µg JAQ1 IgG was injected intraperitoneally at day 7 and day 5 before the experiment, resulting in a GPVI-knockout-like phenotype³¹. All other antibodies (each 100 µg) were injected i.v. or i.p. directly before the experiment.

Platelet depletion

Thrombocytopenia was induced by intravenous injection of the rat anti-GPIbα IgG antibody R300 (Emfret Analytics, 0.14–0.18 μg per g body weight). This low dose of platelet-depletion antibody reduced the platelet count to 5–10% of the initial platelet count⁴⁶. Peripheral platelet count was determined by flow cytometry 16 h after platelet depletion (before the tail-bleeding time experiment).

Treatment with clopidogrel or rhGPV

Mice were fed orally with 3 mg per kg clopidogrel 48 h and 24 h before the experiment. A dose titration for rhGPV was performed using 10–80 µg rhGPV per mouse in an arterial thrombosis model. The dose of 10 µg rhGPV resulted in variable results, while no difference in the anti-thrombotic effect of rhGPV was noted for 20, 40 or 80 µg rhGPV per mouse. Consequently, 20 µg (as the lowest rhGPV concentration that yielded reproducible results) was chosen for all in vivo experiments, and 20 µg ml⁻¹ was chosen for in vitro assays. Mice were injected intravenously with 20 µg rhGPV 5 min before the experiment.

Preparation of PRP and washed platelets

Mice were anesthetized using isoflurane and bled to 300 μl heparin (20 U ml⁻¹ in TBS, pH 7.3, ratiopharm). The blood was centrifuged twice at 300g for 6 min to obtain PRP. PRP was supplemented with 0.02 U ml⁻¹ apyrase (A610, Sigma-Aldrich) and 0.1 μg ml⁻¹ PGI₂ (P6188, Sigma-Aldrich), and platelets were pelleted by centrifugation at 800g for 5 min and washed twice with Tyrode’s buffer (134 mM NaCl, 0.34 mM Na₂HPO₄, 2.9 mM KCl, 12 mM NaHCO₃, 5 mM HEPES, 5 mM glucose, 0.35% BSA, pH 7.4) containing 0.02 U ml⁻¹ apyrase and 0.1 μg ml⁻¹ PGI₂. The platelets were allowed to rest for at least 30 min at 37 °C before experiments.

Aggregation assay

Washed platelets (160 µl with 1.5 × 10⁵ platelets per µl) and PRP (only used for ADP stimulation) were prepared as described. For aggregometry, washed platelets were analyzed in the absence (thrombin) or presence (all other agonists) of 70 µg ml⁻¹ human fibrinogen. Antibodies (10 µg ml⁻¹) were pre-incubated for 5 min at 37 °C before the experiment. Light transmission was recorded on a four-channel aggregometer (Fibrintimer, APACT) for 10 or 20 min (in the presence of LEN/B) and expressed in arbitrary units, with buffer representing 100% light transmission. Platelet aggregation was induced by addition of the indicated agonists.

Flow cytometry

To determine glycoprotein surface expression levels, whole blood was diluted 1:20 with Ca²⁺-free Tyrode’s buffer or PBS and stained with saturating amounts of fluorophore-conjugated antibodies for 15 min at room temperature in the dark.

Washed platelets adjusted to 50,000 per µl in Tyrode’s buffer with Ca²⁺ were stimulated with the indicated agonists and incubated with saturating amounts of fluorophore-conjugated antibodies to determine platelet activation or thrombin-mediated cleavage of GPV. Human thrombin (Sigma, 10602400001) was used to stimulate platelets.

All samples were analyzed directly after addition of 500 μl PBS on a FACSCalibur (BD Biosciences) using CellQuest Pro (version 6.0) software. Data were analyzed using FlowJo (version 10.7 and version 10.8.1). An exemplified gating strategy based on FSC–SSC characteristics is provided in Supplementary Fig. 2.

Thrombin- and N-ethylmaleimide-induced cleavage of GPV

Washed platelets were adjusted to a concentration of 1 × 10⁶ platelets per µl in Tyrode’s buffer without Ca²⁺ and diluted 1:1 with Tyrode’s buffer without Ca²⁺ (for resting and thrombin-stimulated samples (human thrombin (Sigma, 10602400001))) and with Tyrode’s buffer with Ca²⁺ (for N-ethylmaleimide (2 mM final concentration (f.c.))-incubated samples). Stimulation with 867 pM thrombin (for human thrombin, 0.1 U ml⁻¹ is equivalent to 867 pM thrombin) for 30 min at 37 °C was performed in the presence of 40 µg ml⁻¹ integrilin and 5 µM EGTA to prevent platelet aggregation. Afterwards, the platelet suspension was diluted, incubated with saturating amounts of FITC-conjugated platelet surface antibodies and directly analyzed on a FACSCalibur. The residual platelet suspension was pelleted, and the supernatant was analyzed in an ELISA for GPV.

GPV enzyme-linked immunosorbent assay

Ninety-six-well plates (Hartenstein, F-form) were coated with 50 μl per well DOM/C antibody (30 μg ml⁻¹) in carbonate buffer overnight at 4 °C, blocked with 5% non-fat dried milk in PBS for 2 h at 37 °C and washed. Samples were applied to plates, incubated for 1 h at 37 °C and washed. Plates were incubated with HRP-labeled DOM/B antibody for 1 h and washed again three times, and samples were developed using TMB substrate. The reaction was stopped by addition of 0.5 M H₂SO₄. Optical density was measured on a Multiskan EX device (Thermo Electron). Absorbance was read at 450 nm; the 620-nm filter served as the reference wavelength. Plasma samples from Gp5^−/− mice served as the negative control; supernatant after platelet thrombin stimulation served as the positive control.

Clot retraction

Clot-retraction studies were performed at 37 °C in an aggregometer tube containing diluted PRP (3 × 10⁵ platelets per μl), thrombin (34.68 nM) and CaCl₂ (20 mM). Clot retraction was recorded with a camera over a time span of 2 h after activation.

Thrombin time

To determine thrombin time, citrated PRP was diluted 1:1 in PBS and stimulated with 17.5 nM f.c. bovine thrombin (equivalent to 2 U ml⁻¹). Thrombin time was analyzed with a four-channel mechanical ball coagulometer (Merlin Medical).

Thrombin generation

Thrombin generation was quantified in recalcified citrate anticoagulated PRP with platelet count adjusted to 1.5 × 10⁵ platelets per µl. Platelets were resuspended in pooled plasma preparations from two to four mice with the same genotype. After platelet stimulation with the indicated agonists (15 min at 37 °C), samples in duplicates (four volumes) were transferred to a polystyrene Immulon 2HB 96-well plate. The wells either contained one volume thrombin calibrator or TF (1 pM f.c.). Coagulation was initiated by adding one volume of fluorescent thrombin substrate (2.5 mM Z-GGR-AMC). Thrombin generation was measured and analyzed using Thrombinoscope software (version 5.0.0.742, Thrombinoscope)^63,64.

Static fibrin polymerization

Unlabeled fibrinogen (1.35 mg ml⁻¹ f.c.) and AF A488-labeled fibrinogen (45 µg ml⁻¹ f.c.) were mixed (30:1) in the absence or presence of rhGPV (20 µg ml⁻¹, stained with LUM/B AF647). Fibrin polymerization was initiated by addition of 867 pM thrombin or 1 U ml⁻¹ batroxobin (Loxo) in the presence of 5 mM CaCl₂. The mixture was immediately transferred to an uncoated eight-well 15µ-slide (ibidi), which was placed in a dark humidity chamber for 2 h at room temperature to allow fibrin polymerization. Images were obtained using a Leica SP8 inverted microscope with a ×63 oil-immersion lens. Optical z stacks (8 µm, step size of 0.1, Nyquist conform) were deconvolved (Huygens Essential software, version 21.04) and are shown as a maximum projection (ImageJ software). Fibrin fibers per visual field and surface coverage of hGPV staining were quantified using Fiji.

Coagulation flow chamber

Glass coverslips were coated with collagen type I (10 µl, 50 µg ml⁻¹) and TF (10 μl, 100 pM or 10 pM for experiments with human blood or mouse blood, respectively) and blocked with 1% BSA–PBS. Citrated whole blood was recalcified by co-infusion with 6.3 mM CaCl₂ (f.c.) and 3.2 mM MgCl₂ (f.c.) and perfused over the collagen–TF spots for up to 6 min at a shear rate of 1,000 s⁻¹ (ref. ⁶⁵). Before each experiment, blood samples were prelabeled with AF488-conjugated fibrinogen, an anti-GPIX derivative (mouse) or an anti-GPIbβ derivative (human) to stain platelets. For human samples, control and antibody-treated samples of the same donor were always run in parallel.

Time series experiments

Before each experiment, blood samples were pre-incubated with AF488-conjugated fibrinogen, AF647-conjugated anti-GPIX derivative (mouse) or AF647-conjugated anti-GPIbβ derivative (human) platelets. For time series experiments, fluorescence microscopic images were captured at 30-s intervals to evaluate kinetics for up to 6 min (Leica DMI 6000 B, ×63 objective, Leica Application Suite (LAS) X software (version 1.9.013747)). Recorded images were further processed with the background-subtraction method Instant Computational Clearing) to remove out-of-focus blur on a Leica THUNDER microscope (LAS X software version 3.7). Next, the exported images were analyzed for surface area coverage of fibrin formation with self-written Python scripts⁶⁶. In detail, in the first step, an entropy filter with a disk size of five pixels was applied, followed by a median filter (disk size, ten pixels) and Otsu thresholding. To compensate for a nearly empty field of view during the first images in the time series, we introduced a ‘scaling factor’, sf, with which we multiplied the found Otsu threshold value and thus increased the threshold slightly for the first images (usually the first 60–150 s, with sf = 1.03–1.05). The thresholded area (as a fraction of the whole field of view) represents the area covered by fibrin.

For heatmap representation, mean values were univariate scaled from −4 to 4. Gene effect heatmaps were constructed by subtracting scaled average values of the control strain from those of the mutant strain. For details, see ref. ³⁵.

Three-dimensional confocal microscopy

Samples were stained as described for Time series experiments. To acquire z stacks of complete thrombi, samples were fixed with 4% paraformaldehyde (PFA)–PBS, mounted with ProLong Glass (Thermo Scientific) and further analyzed by confocal microscopy (Leica SP8 inverted microscope). z stacks of thrombi were acquired with an SP8 confocal microscope (Leica) in HyVolution mode (×63; z step, 0.1 µm). Images were deconvolved using Huygens Professional software (version 21.04) with a signal-to-noise ratio between 2 and 10 (identical for regions of interest in the same animal), an automatic background subtraction using the ‘in/near object’ option with a search radius of 2 µm and a maximum of 40 iterations. The deconvolved dataset was exported in Imaris file format and visualized with Fiji⁶⁷ (https://www.biovoxxel.de/development/).

To analyze GPV–fibrin localization outside the thrombus, blood samples were pre-incubated with AF488-conjugated fibrinogen, AF546-conjugated anti-GPV derivative (as direct labeling of rhGPV with a fluorophore abolished its biological activity) and AF405-conjugated anti-GPIX derivative. Single images from the bottom of a thrombus were acquired using a Zeiss LSM 980 Airyscan microscope (×63 objective) in super-resolution mode using the smart setup. Images were deconvolved with Zeiss ZEN software (version 3.2) and analyzed with Fiji. First, masks from the fibrin(ogen) and platelet (GPIX) channels were generated using Li thresholding. Masks were then used as ‘positive’ (pixel intensity of 1 inside the structure and 0 outside the structure) and ‘negative’ (pixel intensity of 0 inside the structure and 1 outside the structure) imprints and applied to the GPV channel. To analyze GPV intensities outside the thrombus but inside fibrin fibers, the positive fibrin mask was multiplied with the negative thrombus mask.

In detail, after Li thresholding, the intensity values in the binarized images were changed to 0 and 1 by dividing through 255. Next, this procedure for preparation of the positive and negative binary masks was repeated for the GPIX channel. Afterward, the prepared masks based on single-channel thresholds were combined by multiplication (leading to a value of 1 if positive in both masks). This resulted in the following regions: (1) inside fibrin but non-platelet area and (2) outside fibrin and non-platelet area → background count rate.

Finally, the intensity of GPV was determined in the area of fibrin by multiplication of the obtained masks with the GPV channel. Values outside the mask were set to 0, and pixels inside the mask have an intensity of 1, thus the original intensity of GPV was preserved. This calculation was performed for all masks, and surface coverage as well as raw integrated density were determined. Next, the average intensity per pixel was calculated inside the covered area, and the raw integrated density was divided by the number of pixels to obtain the average intensity per non-zero pixel.

For each step, a Fiji macro was recorded. All Fiji macros and Python scripts used for fluorescence image analysis can be downloaded from https://github.com/HeinzeLab/GPV-flowchamber.

Thrombin activity

The coagulation flow assay was performed as described above without staining for platelets and fibrin(ogen). The outflow was collected in 10 mM EDTA and 1.5 µM HD1. Thrombin activity was measured immediately using the fluorogenic thrombin substrate Pefafluor TH (Pentapharm) at 460 nm.

Thrombin activity in the formed thrombi was determined using the fluorogenic thrombin substrate Z-GGR-AMC.

Western blot after pulldown

Washed platelets were adjusted to 1 × 10⁶ platelets per µl and either left unstimulated or were stimulated with biotinylated thrombin (433 pM) for 15 min at 37 °C. When indicated, hirudin (0.1 U ml⁻¹) or GM6001 (100 µM f.c.) was added before platelet stimulation. Platelets were pelleted, and the supernatant was incubated with magnetic streptavidin beads to pull down biotinylated thrombin. After incubation, beads were collected and washed. The eluate was used for western blot analysis, and the samples were detected with an anti-GPV antibody (R&D).

GPV–thrombin interaction in solution

We performed cross-linking experiments with BS3 or DTSSP following incubation of thrombin with varying concentrations of rhGPV. However, conditions with efficient cross-linking could not be established. Thrombin interaction with rhGPV was furthermore analyzed in a solution (HEPES buffer), and generation of sGPV was followed by western blotting and detection with an anti-hGPV antibody (Santa Cruz, sc271662). A serial dilution of cleaved sGPV was used to quantify the reaction product. The stability of thrombin was analyzed under the same conditions by determining thrombin activity with the chromogenic substrate S2238 (Chromogenix).

Tail-bleeding time

Mice were anesthetized by intraperitoneal injection of triple anesthesia (Dormitor, 0.5 μg per g; midazolam, 5 μg per g; and fentanyl, 0.05 μg per g body weight), and a 1-mm segment of the tail tip was removed using a scalpel. Tail bleeding was monitored by gently absorbing blood on filter paper at 20-s intervals without directly contacting the wound site. When no blood was observed on the paper, bleeding was determined to have ceased. The experiment was manually stopped after 20 min by cauterization.

Light sheet fluorescence microscopy

Sample preparation

The vasculature was stained by intravenous injection of AF647-conjugated anti-CD105 (clone MJ7/19, purified in house, 0.4 µg per g body weight) and AF647-conjugated anti-CD31 (BioLegend, clone 390, 0.4 µg per g body weight) antibodies. After in vivo labeling (30 min), mice were anesthetized by intraperitoneal injection of medetomidine (0.5 µg per g body weight), midazolam (5 µg per g body weight) and fentanyl (0.05 µg per g body weight) and transcardially perfused with ice-cold PBS to wash out the blood and ice-cold 4% PFA (P6148, Sigma-Aldrich, pH 7.2). Brains were removed, washed with PBS and dehydrated in methanol solutions of increasing concentrations (50%, 70%, 95%, 100%) to fix the tissue. The methanol was replaced stepwise by a clearing solution consisting of one part benzyl alcohol to two parts benzyl benzoate (BABB; 305197 and B6630, Sigma-Aldrich). After incubation in the clearing solution for at least 2 h at room temperature, tissue specimens became optically transparent and were used for light sheet fluorescence microscopy (LSFM) imaging on the following day⁶⁸.

Optically cleared brains were imaged with a custom-built light sheet microscope equipped with two EC Epiplan Neofluar ×2.5/0.06 M27 excitation objectives (Zeiss) and an HCX Fluotar ×5/0.15 dry detection objective (Leica)²⁹ with a voxel size of 2.6 µm and z spacing of 5 µm (pixel size, 2.6 × 2.6 × 5 µm). Major parts of the LSFM have been described previously⁶⁹. Additionally to the fluorescence signal of the AF647-conjugated antibodies staining the vessel system, brain autofluorescence was also collected by excitation at 488 nm with emission at 520 nm.

Segmentation of brain LSFM images

Images acquired by LSFM were saved in TIFF format and converted to the Imaris file format (Imaris 9.9, Bitplane, Oxford) for further processing and segmentation. Using the built-in image-processing tools, first the background was subtracted from both channels, and secondly a 3 × 3 × 3-voxel median filter was applied to the vessel channel (AF647 fluorescence). Next, the median-filtered vessel channel was segmented using the surface tool. Here, four-voxel smoothing (10.4 µm) and local contrast intensity thresholding (10 µm in diameter) were applied. The intensity threshold was adjusted manually to ~50% of the automatically proposed value. Finally, objects smaller than 1,000 voxels were removed.

Determination of vessel diameter

To determine the diameter of the vessel at selected regions of interest, the generated vessel surface was masked onto the vessel fluorescence such that the intensity outside the surface was zero, while, inside the surface, the original, median-filtered intensity values were present.

To estimate the diameter, the ‘measurement points’ option in Imaris was used, which was placed directly on the border of the selected vessel regions of interest. Correct placing of the measurement points was ensured by 3D inspection of the images.

Transient middle cerebral artery occlusion

Focal cerebral ischemia was induced by tMCAO as previously described⁷⁰. Briefly, a silicon-coated thread was advanced through the carotid artery up to the origin of the MCA, causing an MCA infarction. After an occlusion time of 60 min, the filament was removed, allowing reperfusion of the MCA territory. The extent of edema corrected brain infarction was quantitatively assessed 24 h after reperfusion on 2,3,5-triphenyltetrazolium chloride-stained consecutive brain sections. Neurological function was analyzed by calculating a neuroscore (score, 0–10) based on the direct sum of the Grip test (score, 0–5) and the inverted Bederson score (score, 0–5).

Posterior communicating artery scores

Posterior communicating artery (PcomA) scores were determined in brains from mice that were perfused with PBS followed by 3 ml black ink diluted in 4% PFA (1:5, vol/vol).

Mechanical injury of the abdominal aorta

To open the abdominal cavity of anesthetized mice (8–20 weeks old), a longitudinal midline incision was performed, and the abdominal aorta was exposed. A Doppler ultrasonic flow probe (0.5PSB699, Transonic Systems) was placed around the vessel, and thrombus formation was induced by a single firm compression (20 s) with a forceps upstream of the flow probe. Blood flow was monitored over 30 min or until complete occlusion occurred (blood flow stopped for >5 min). The abdominal aorta was excised and embedded in Tissue-Tek. Sections (5 µm) were fixed and stained according to the Carstairs method to distinguish platelets and fibrin⁷¹. Images of Carstairs stained sections were acquired on a Leica DMI400B using LAS software (version 2.6.0.R1).

FeCl₃-induced injury of mesenteric arterioles

Four-week-old mice were anesthetized, and the mesentery was exteriorized. Arterioles (35–60 μm in diameter) were visualized with a Zeiss Axiovert 200 inverted microscope (×10/0.25 air objective) equipped with a 100-W HBO mercury lamp and a CoolSNAP EZ camera (Visitron) using MetaMorph software (version 6.2r6). Endothelial injury was induced by topical application of a 3-mm² filter paper saturated with ferric chloride (FeCl₃; 20%). Adhesion and aggregation of fluorescently labeled platelets (DyLight 488-conjugated anti-GPIX derivative) were monitored for 40 min or until complete occlusion occurred (blood flow stopped for >1 min).

Data analysis

The presented results are mean ± s.d. from three independent experiments per group, and lines represent mean values, if not stated otherwise. Normal distribution was tested using the Shapiro–Wilk normality test. If passed, P values were calculated using the two-tailed unpaired t-test (two groups); if the values were not normally distributed, differences between two groups were analyzed using the Mann–Whitney two-tailed test. For more than two groups, one-way ANOVA (Kruskal–Wallis test) followed by Dunn’s test for multiple comparisons was performed using GraphPad Prism software (versions 7.03 and 7.05.). Two-tailed paired t-test (two groups, normally distributed), Wilcoxon matched-pairs signed-rank test (two groups, not normally distributed) and Friedman test followed by Dunn’s test for multiple comparisons (more than two groups, not normally distributed) were used for paired comparisons. For statistical analysis of non-occluded versus occluded vessels, Fisher’s exact t-test was used. P values <0.05 were considered statistically significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

All data supporting the analyses presented in this study are provided in the text and its associated files.

Code availability

Macros used for quantitative image analysis are available at https://github.com/HeinzeLab/GPV-flowchamber.

References

Swieringa, F., Spronk, H. M. H., Heemskerk, J. W. M. & van der Meijden, P. E. J. Integrating platelet and coagulation activation in fibrin clot formation. Res. Pract. Thromb. Haemost. 2, 450–460 (2018).
Article CAS PubMed PubMed Central Google Scholar
Furie, B. & Furie, B. C. The molecular basis of blood coagulation. Cell 53, 505–518 (1988).
Article CAS PubMed Google Scholar
Tomaiuolo, M., Brass, L. F. & Stalker, T. J. Regulation of platelet activation and coagulation and its role in vascular injury and arterial thrombosis. Interv. Cardiol. Clin. 6, 1–12 (2017).
PubMed PubMed Central Google Scholar
Kahn, M. L. et al. A dual thrombin receptor system for platelet activation. Nature 394, 690–694 (1998).
Article CAS PubMed Google Scholar
Stalker, T. J. et al. Hierarchical organization in the hemostatic response and its relationship to the platelet-signaling network. Blood 121, 1875–1885 (2013).
Article CAS PubMed PubMed Central Google Scholar
Versteeg, H. H., Heemskerk, J. W., Levi, M. & Reitsma, P. H. New fundamentals in hemostasis. Physiol. Rev. 93, 327–358 (2013).
Article CAS PubMed Google Scholar
Sang, Y., Roest, M., de Laat, B., de Groot, P. G. & Huskens, D. Interplay between platelets and coagulation. Blood Rev. 46, 100733 (2021).
Article CAS PubMed Google Scholar
Silva, L. M. et al. Fibrin is a critical regulator of neutrophil effector function at the oral mucosal barrier. Science 374, eabl5450 (2021).
Article CAS PubMed Google Scholar
Ryu, J. K. et al. Fibrin-targeting immunotherapy protects against neuroinflammation and neurodegeneration. Nat. Immunol. 19, 1212–1223 (2018).
Article CAS PubMed PubMed Central Google Scholar
Mosnier, L. O., Zlokovic, B. V. & Griffin, J. H. The cytoprotective protein C pathway. Blood 109, 3161–3172 (2006).
Article PubMed Google Scholar
Ruggeri, Z. M. et al. Unravelling the mechanism and significance of thrombin binding to platelet glycoprotein Ib. Thromb. Haemost. 104, 894–902 (2010).
Article CAS PubMed Google Scholar
Kahn, M. L. et al. Glycoprotein V-deficient platelets have undiminished thrombin responsiveness and do not exhibit a Bernard–Soulier phenotype. Blood 94, 4112–4121 (1999).
Article CAS PubMed Google Scholar
Li, R. & Emsley, J. The organizing principle of the platelet glycoprotein Ib–IX–V complex. J. Thromb. Haemost. 11, 605–614 (2013).
Article CAS PubMed PubMed Central Google Scholar
Mo, X., Liu, L., Lopez, J. A. & Li, R. Transmembrane domains are critical to the interaction between platelet glycoprotein V and glycoprotein Ib–IX complex. J. Thromb. Haemost. 10, 1875–1886 (2012).
Article CAS PubMed PubMed Central Google Scholar
Moog, S. et al. Platelet glycoprotein V binds to collagen and participates in platelet adhesion and aggregation. Blood 98, 1038–1046 (2001).
Article CAS PubMed Google Scholar
Nieswandt, B. & Watson, S. P. Platelet–collagen interaction: is GPVI the central receptor? Blood 102, 449–461 (2003).
Article CAS PubMed Google Scholar
Clemetson, K. J. A short history of platelet glycoprotein Ib complex. Thromb. Haemost. 98, 63–68 (2007).
Article CAS PubMed Google Scholar
Katsutani, S. et al. Cloning and characterization of the gene encoding the murine glycoprotein V: the conserved thrombin-cleavable protein on platelet surface. Thromb. Res. 92, 43–51 (1998).
Article CAS PubMed Google Scholar
Ravanat, C. et al. Gene cloning of rat and mouse platelet glycoprotein V: identification of megakaryocyte-specific promoters and demonstration of functional thrombin cleavage. Blood 89, 3253–3262 (1997).
Article CAS PubMed Google Scholar
Ni, H. Increased thrombogenesis and embolus formation in mice lacking glycoprotein V. Blood 98, 368–373 (2001).
Article CAS PubMed Google Scholar
Rabie, T., Strehl, A., Ludwig, A. & Nieswandt, B. Evidence for a role of ADAM17 (TACE) in the regulation of platelet glycoprotein V. J. Biol. Chem. 280, 14462–14468 (2005).
Article CAS PubMed Google Scholar
Ramakrishnan, V. et al. Increased thrombin responsiveness in platelets from mice lacking glycoprotein V. Proc. Natl Acad. Sci. USA 96, 13336–13341 (1999).
Article CAS PubMed PubMed Central Google Scholar
Nonne, C., Hechler, B., Cazenave, J. P., Gachet, C. & Lanza, F. Reassessment of in vivo thrombus formation in glycoprotein V deficient mice backcrossed on a C57Bl/6 strain. J. Thromb. Haemost. 6, 210–212 (2008).
Article CAS PubMed Google Scholar
McGowan, E. B., Ding, A. & Detwiler, T. C. Correlation of thrombin-induced glycoprotein V hydrolysis and platelet activation. J. Biol. Chem. 258, 11243–11248 (1983).
Article CAS PubMed Google Scholar
Estevez, B. et al. Signaling-mediated cooperativity between glycoprotein Ib–IX and protease-activated receptors in thrombin-induced platelet activation. Blood 127, 626–636 (2016).
Article CAS PubMed PubMed Central Google Scholar
Celikel, R. et al. Modulation of α-thrombin function by distinct interactions with platelet glycoprotein Ibα. Science 301, 218–221 (2003).
Article PubMed Google Scholar
Dumas, J. J., Kumar, R., Seehra, J., Somers, W. S. & Mosyak, L. Crystal structure of the GpIbα–thrombin complex essential for platelet aggregation. Science 301, 222–226 (2003).
Article CAS PubMed Google Scholar
Massberg, S. et al. A crucial role of glycoprotein VI for platelet recruitment to the injured arterial wall in vivo. J. Exp. Med. 197, 41–49 (2003).
Article CAS PubMed PubMed Central Google Scholar
Stegner, D. et al. Foudroyant cerebral venous (sinus) thrombosis triggered through CLEC-2 and GPIIb/IIIa dependent platelet activation. Nat. Cardiovasc. Res. 1, 132–141 (2022).
Article Google Scholar
Bender, M. et al. Combined in vivo depletion of glycoprotein VI and C-type lectin-like receptor 2 severely compromises hemostasis and abrogates arterial thrombosis in mice. Arterioscler. Thromb. Vasc. Biol. 33, 926–934 (2013).
Article CAS PubMed PubMed Central Google Scholar
Nieswandt, B. et al. Long-term antithrombotic protection by in vivo depletion of platelet glycoprotein VI in mice. J. Exp. Med. 193, 459–469 (2001).
Article CAS PubMed PubMed Central Google Scholar
Mangin, P. et al. Thrombin overcomes the thrombosis defect associated with platelet GPVI/FcRγ deficiency. Blood 107, 4346–4353 (2006).
Article CAS PubMed Google Scholar
Mangin, P. H. et al. Immobilized fibrinogen activates human platelets through glycoprotein VI. Haematologica 103, 898–907 (2018).
Article CAS PubMed PubMed Central Google Scholar
de Witt, S. M. et al. Identification of platelet function defects by multi-parameter assessment of thrombus formation. Nat. Commun. 5, 4257 (2014).
Article PubMed Google Scholar
Nagy, M. et al. Comparative analysis of microfluidics thrombus formation in multiple genetically modified mice: link to thrombosis and hemostasis. Front. Cardiovasc. Med. 6, 99 (2019).
Article CAS PubMed PubMed Central Google Scholar
Fredenburgh, J. C., Stafford, A. R., Leslie, B. A. & Weitz, J. I. Bivalent binding to γA/γ′-fibrin engages both exosites of thrombin and protects it from inhibition by the antithrombin–heparin complex. J. Biol. Chem. 283, 2470–2477 (2008).
Article CAS PubMed Google Scholar
Stoll, G. & Nieswandt, B. Thrombo-inflammation in acute ischaemic stroke—implications for treatment. Nat. Rev. Neurol. 15, 473–481 (2019).
Article CAS PubMed Google Scholar
Petrera, N. S. et al. Long range communication between exosites 1 and 2 modulates thrombin function. J. Biol. Chem. 284, 25620–25629 (2009).
Article CAS PubMed PubMed Central Google Scholar
Bock, L. C., Griffin, L. C., Latham, J. A., Vermaas, E. H. & Toole, J. J. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature 355, 564–566 (1992).
Article CAS PubMed Google Scholar
Tasset, D. M., Kubik, M. F. & Steiner, W. Oligonucleotide inhibitors of human thrombin that bind distinct epitopes. J. Mol. Biol. 272, 688–698 (1997).
Article CAS PubMed Google Scholar
Grüner, S. et al. Anti-glycoprotein VI treatment severely compromises hemostasis in mice with reduced α₂β₁ levels or concomitant aspirin therapy. Circulation 110, 2946–2951 (2004).
Article PubMed Google Scholar
Pleines, I. et al. Megakaryocyte-specific RhoA deficiency causes macrothrombocytopenia and defective platelet activation in hemostasis and thrombosis. Blood 119, 1054–1063 (2012).
Article CAS PubMed Google Scholar
Deppermann, C. et al. Gray platelet syndrome and defective thrombo-inflammation in Nbeal2-deficient mice. J. Clin. Invest. 123, 3331–3342 (2013).
Article CAS PubMed PubMed Central Google Scholar
Bakchoul, T. & Marini, I. Drug-associated thrombocytopenia. Hematology Am. Soc. Hematol. Educ. Program 2018, 576–583 (2018).
Article PubMed PubMed Central Google Scholar
Aster, R. H. & Bougie, D. W. Drug-induced immune thrombocytopenia. N. Engl. J. Med. 357, 580–587 (2007).
Article PubMed Google Scholar
Morowski, M. et al. Only severe thrombocytopenia results in bleeding and defective thrombus formation in mice. Blood 121, 4938–4947 (2013).
Article CAS PubMed Google Scholar
Sekhon, U. D. S. et al. Platelet-mimicking procoagulant nanoparticles augment hemostasis in animal models of bleeding. Sci. Transl. Med. 14, eabb8975 (2022).
Article CAS PubMed PubMed Central Google Scholar
Mast, A. E. & Ruf, W. Regulation of coagulation by tissue factor pathway inhibitor: implications for hemophilia therapy. J. Thromb. Haemost. 20, 1290–1300 (2022).
Article CAS PubMed PubMed Central Google Scholar
Holtkotter, O. et al. Integrin α₂-deficient mice develop normally, are fertile, but display partially defective platelet interaction with collagen. J. Biol. Chem. 277, 10789–10794 (2002).
Article CAS PubMed Google Scholar
Jackson, B. et al. RhoA is dispensable for skin development, but crucial for contraction and directed migration of keratinocytes. Mol. Biol. Cell 22, 593–605 (2011).
Article CAS PubMed PubMed Central Google Scholar
Knight, C. G. et al. Collagen–platelet interaction: Gly-Pro-Hyp is uniquely specific for platelet Gp VI and mediates platelet activation by collagen. Cardiovasc. Res. 41, 450–457 (1999).
Article CAS PubMed Google Scholar
Schulte, V. et al. Targeting of the collagen-binding site on glycoprotein VI is not essential for in vivo depletion of the receptor. Blood 101, 3948–3952 (2003).
Article CAS PubMed Google Scholar
Bergmeier, W. et al. Flow cytometric detection of activated mouse integrin α_IIbβ₃ with a novel monoclonal antibody. Cytometry 48, 80–86 (2002).
Article CAS PubMed Google Scholar
Stegner, D. et al. Thrombopoiesis is spatially regulated by the bone marrow vasculature. Nat. Commun. 8, 127 (2017).
Article PubMed PubMed Central Google Scholar
Nieswandt, B., Bergmeier, W., Rackebrandt, K., Gessner, J. E. & Zirngibl, H. Identification of critical antigen-specific mechanisms in the development of immune thrombocytopenic purpura in mice. Blood 96, 2520–2527 (2000).
Article CAS PubMed Google Scholar
Shida, Y. et al. Analysis of the role of von Willebrand factor, platelet glycoprotein VI-, and α₂β₁-mediated collagen binding in thrombus formation. Blood 124, 1799–1807 (2014).
Article CAS PubMed PubMed Central Google Scholar
Nieswandt, B. et al. Expression and function of the mouse collagen receptor glycoprotein VI is strictly dependent on its association with the FcRγ chain. J. Biol. Chem. 275, 23998–24002 (2000).
Article CAS PubMed Google Scholar
Gruner, S. et al. Multiple integrin–ligand interactions synergize in shear-resistant platelet adhesion at sites of arterial injury in vivo. Blood 102, 4021–4027 (2003).
Article PubMed Google Scholar
Nieswandt, B. et al. Glycoprotein VI but not α₂β₁ integrin is essential for platelet interaction with collagen. EMBO J. 20, 2120–2130 (2001).
Article CAS PubMed PubMed Central Google Scholar
Hofmann, S., Vögtle, T., Bender, M., Rose-John, S. & Nieswandt, B. The SLAM family member CD84 is regulated by ADAM10 and calpain in platelets. J. Thromb. Haemost. 10, 2581–2592 (2012).
Article CAS PubMed Google Scholar
Bergmeier, W., Rackebrandt, K., Schroder, W., Zirngibl, H. & Nieswandt, B. Structural and functional characterization of the mouse von Willebrand factor receptor GPIb–IX with novel monoclonal antibodies. Blood 95, 886–893 (2000).
Article CAS PubMed Google Scholar
Nieswandt, B. et al. Acute systemic reaction and lung alterations induced by an antiplatelet integrin GPIIb/IIIa antibody in mice. Blood 94, 684–693 (1999).
Article CAS PubMed Google Scholar
Hemker, H. C. & Beguin, S. Thrombin generation in plasma: its assessment via the endogenous thrombin potential. Thromb. Haemost. 74, 134–138 (1995).
Article CAS PubMed Google Scholar
Hemker, H. C. et al. Calibrated automated thrombin generation measurement in clotting plasma. Pathophysiol. Haemost. Thromb. 33, 4–15 (2003).
Article CAS PubMed Google Scholar
Brouns, S. L. N. et al. Platelet-primed interactions of coagulation and anticoagulation pathways in flow-dependent thrombus formation. Sci. Rep. 10, 11910 (2020).
Article CAS PubMed PubMed Central Google Scholar
van der Walt, S. et al. scikit-image: image processing in Python. PeerJ 2, e453 (2014).
Article PubMed PubMed Central Google Scholar
Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676–682 (2012).
Article CAS PubMed Google Scholar
Göb, V. et al. Infarct growth precedes cerebral thrombosis following experimental stroke in mice. Sci. Rep. 11, 22887 (2021).
Article PubMed PubMed Central Google Scholar
Amich, J. et al. Three-dimensional light sheet fluorescence microscopy of lungs to dissect local host immune-Aspergillus fumigatus interactions. mBio 11, e02752-19 (2020).
Article PubMed PubMed Central Google Scholar
Kleinschnitz, C. et al. Targeting platelets in acute experimental stroke: impact of glycoprotein Ib, VI, and IIb/IIIa blockade on infarct size, functional outcome, and intracranial bleeding. Circulation 115, 2323–2330 (2007).
Article CAS PubMed Google Scholar
Carstairs, K. C. The identification of platelets and platelet antigens in histological sections. J. Pathol. Bacteriol. 90, 225–231 (1965).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank F. Lanza (Strasbourg, France) for providing Gp5^−/− mice, J. Pinnecker (Julius-Maximilians-Universität Würzburg, Würzburg, Germany) for assistance in LSFM image acquisition, S. Hartmann and J. Goldmann for excellent technical assistance (both from University Hospital Würzburg, Institute of Experimental Biomedicine, Würzburg, Germany) and M. Spindler for excellent graphical assistance (University Hospital Würzburg, Institute of Experimental Biomedicine, Würzburg, Germany). Funding was provided by the German Research Foundation (Ni556/14-1, B.N.; SFB 1525, project number 453989101; TR240, project number 374031971; INST 93/1022-1), the National Institutes of Health (HL082808, R.L.; UM1 HL120877, W.R.), the European Union (Thrombo-Inflame, EFRE–Europäischer Fonds für regionale Entwicklung, Bavaria) and the Rudolf Virchow Centre for Integrative and Translational Bioimaging.

Author information

These authors contributed equally: Wolfram Ruf, David Stegner, Bernhard Nieswandt.

Authors and Affiliations

Rudolf Virchow Center for Integrative and Translational Bioimaging, Julius-Maximilians-Universität Würzburg, Würzburg, Germany
Sarah Beck, Patricia Öftering, Katherina Hemmen, Katrin G. Heinze, David Stegner & Bernhard Nieswandt
Institute of Experimental Biomedicine, University Hospital Würzburg, Würzburg, Germany
Sarah Beck, Patricia Öftering, David Stegner & Bernhard Nieswandt
Aflac Cancer and Blood Disorders Center, Children’s Healthcare of Atlanta, Department of Pediatrics, Emory University School of Medicine, Atlanta, GA, USA
Renhao Li & Yingchun Wang
Department of Biochemistry, CARIM, Maastricht University, Maastricht, the Netherlands
Magdolna Nagy & Johan W. M. Heemskerk
Department of Molecular Medicine, Scripps Research, La Jolla, CA, USA
Alessandro Zarpellon & Zaverio M. Ruggeri
Department of Neurology, University Hospital Würzburg, Würzburg, Germany
Michael K. Schuhmann & Guido Stoll
Center for Thrombosis and Hemostasis, Johannes Gutenberg University Medical Center Mainz, Mainz, Germany
Wolfram Ruf
Department of Immunology and Microbiology, Scripps Research, La Jolla, CA, USA
Wolfram Ruf

Authors

Sarah Beck
View author publications
You can also search for this author in PubMed Google Scholar
Patricia Öftering
View author publications
You can also search for this author in PubMed Google Scholar
Renhao Li
View author publications
You can also search for this author in PubMed Google Scholar
Katherina Hemmen
View author publications
You can also search for this author in PubMed Google Scholar
Magdolna Nagy
View author publications
You can also search for this author in PubMed Google Scholar
Yingchun Wang
View author publications
You can also search for this author in PubMed Google Scholar
Alessandro Zarpellon
View author publications
You can also search for this author in PubMed Google Scholar
Michael K. Schuhmann
View author publications
You can also search for this author in PubMed Google Scholar
Guido Stoll
View author publications
You can also search for this author in PubMed Google Scholar
Zaverio M. Ruggeri
View author publications
You can also search for this author in PubMed Google Scholar
Katrin G. Heinze
View author publications
You can also search for this author in PubMed Google Scholar
Johan W. M. Heemskerk
View author publications
You can also search for this author in PubMed Google Scholar
Wolfram Ruf
View author publications
You can also search for this author in PubMed Google Scholar
David Stegner
View author publications
You can also search for this author in PubMed Google Scholar
Bernhard Nieswandt
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization: S.B., J.W.M.H., W.R., D.S. and B.N. Methodology: Y.W., R.L., K.H., K.G.H., W.R. and B.N. Investigation: S.B., P.Ö., M.N., A.Z., Z.M.R., J.W.M.H., M.K.S., G.S., D.S. and B.N. Visualization: S.B. Funding acquisition: B.N. and R.L. Supervision: D.S. and B.N. Writing (original draft): S.B., W.R. and B.N. Writing (review and editing): S.B., P.Ö., R.L., K.H., M.K.S., K.G.H., Z.M.R., J.W.M.H., W.R., D.S. and B.N.

Corresponding authors

Correspondence to David Stegner or Bernhard Nieswandt.

Ethics declarations

Competing interests

S.B., D.S. and B.N. hold a patent on recombinant GPV for treating thrombotic diseases reporting sGPV (lacking a functional transmembrane domain) for use in the treatment or prevention of thrombotic diseases. Data on rhGPV preventing thrombus formation in vivo and reducing infarct volume in a tMCAO model in this study are partly covered by the patent (patent applicant, Julius-Maximilians-Universität Würzburg; inventors, B.N., D.S., S.B.; patent published, title, soluble glycoprotein V for treating thrombotic diseases; WO 2017/109212; US patent no. US 11,028,144 B2).

Peer review

Peer review information

Nature Cardiovascular Research thanks Cedric Duval, Louise D. McCullough and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended Data Fig. 1 R476A point mutation renders GPV insensitive for thrombin-induced cleavage in Gp5^dThr mice but does not alter platelet reactivity towards thrombin.

(a) Simplified targeting strategy. Gp5^dThr mice were generated by introduction of the point mutation R476A in the thrombin cleavage site. (b-e) Washed platelets were left untreated or stimulated with 867 pM thrombin (in the presence of 40 μg/ml integrilin and 5 μM EGTA to prevent platelet aggregation) or 2 mM N-ethylmaleimide (NEM) to induce metalloproteinase-induced shedding of GPV. (b) After stimulation, sGPV levels in the platelet supernatant were measured using a mGPV ELISA. Mean ± SD. n = 3 mice per group, 3 independent experiments, two-tailed unpaired t-test with Welch’s correction, p = 0.0001. (c-e) Stimulated platelets were incubated with saturating amounts of fluorophore-conjugated antibodies for 15 min at RT and the surface expression of GPV (c), GPIb (d) and GPVI (e) was immediately analysed by flow cytometry. Mean ± SD. n = 3 mice per group, 3 independent experiments, (c) two-tailed unpaired t-test with Welch’s correction, p = 0.0067. (f) Increased αIIbβ3 integrin activation measured by JON/A-PE staining of GPV-deficient platelets at threshold thrombin concentrations. Mean ± SD, n = 4 mice, 5 independent experiments, two-tailed unpaired t-test with Welch’s correction. 8.6 pM thrombin: p = 0.0009, 17.35 pM thrombin: p = 00039, 26 pM thrombin: p = 0.0026 (g, h) Platelet-rich plasma (PRP) was stimulated with ADP and light transmission of PRP was recorded on a Apact four-channel aggregometer over 10 min. Representative curves (g) and maximum aggregation (h) for n = 3 mice of 3 independent experiments expressed as mean ± SD. (i) Flow cytometry reveals unaltered reactivity of Gp5^dThr platelets upon thrombin stimulation compared to WT controls. Mean ± SD, n = 4 mice,5 independent experiments. (j) Clot formation in PRP was induced by the addition of thrombin and CaCl₂ and clot retraction was monitored over time. Residual volume of serum after clot retraction was measured. Mean ± SD. WT: n = 14, Gp5^−/−: n = 5, Gp5^dThr: n = 5, WT + DOM/B: n = 4 mice, 2 independent experiments. Representative images at 90 min after initiation of clot retraction. *p < 0.05; **p < 0.01; ***p < 0.001.

Source Data

Extended Data Fig. 2 GPV regulates platelet responsiveness to thrombin by interference with GPIbα-dependent PAR signaling.

(a) Platelets were incubated with increasing concentrations of p0p/B Fab fragments and BP-FIIa binding was assessed by flow cytometry. n = 4 mice, 2 independent experiments. (b, c) The thrombin-binding site on GPIbα was blocked by p0p/B Fab and αIIbβ3 integrin activation (JON/A-PE binding) of GPV-mutant and WT platelets measured by flow cytometry upon thrombin stimulation. (b, c) were measured in one experiment. Mean ± SD. n = 4 mice per group, 4 independent experiments. One-way ANOVA followed by Tukey’s multiple comparisons test. (d) Scheme of GPIb-thrombin and GPV-thrombin interactions. GPIX (green), GPIbβ (light blue), GPIbα and GPV (magenta) form a complex on the platelet surface. Thrombin binds to GPIbα via a high affinity binding site, cleaves GPV and activates platelets via PARs. The anti-GPIbα Fab p0p/B blocks the thrombin binding site on GPIbα and thereby reduces thrombin-mediated platelet activation. Both, GPV and Gp5^dThr act as an inhibitor of GPIb-mediated PAR activation. In the absence of GPV (e), access of thrombin to PARs is facilitated leading to increased platelet activation. (d, e) created with BioRender. (f-k) TF-initiated thrombin generation was measured in platelet-rich plasma (PRP) upon platelet activation. Platelets were left unstimulated (PRP) or activated by incubation with collagen-related peptide (CRP) (20 μg/ml), rhodocytin (RC, 1 μg/ml), ionomycin (10 μM) or A23187 (10 μM) for 10 min at 37 °C. Thrombin generation was triggered with tissue factor/CaCl₂. Lag time (f, i), maximal thrombin concentration (g, j) and time to peak (h, k) were determined. Values are depicted as mean ± SD. (f-h) n = 12 (CRP, RC), n = 8 (PRP), n = 3 (A23187, ionomycin). (i-k) n = 12 (Gp5^dThr: all conditions, WT: PRP, CRP, RC); WT: n = 13 (ionomycin), WT: n = 11 (A23187) mice, at least 2 independent experiments. Two-tailed unpaired t-test with Welch’s correction, p = 0.0106. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001.

Source Data

Extended Data Fig. 3 Absence of GPV restores thrombotic and haemostatic defects in the absence of GPVI.

GPVI was depleted from the platelet surface by injection of the anti-GPVI mAb JAQ1. Confirmation of GPVI depletion by Western blot analysis (a) and flow cytometry (b); representative of 3 independent experiments. (c) Quantification and representative images (scale bar: 50 µm) (d) of thrombus formation upon FeCl₃-induced injury of mesenteric arterioles. Thrombus formation in no more than two arterioles of each mouse were analysed; data points represent measurements of one arteriole. WT: 18 arterioles of 11 mice, Gp5^−/−:12 arterioles of 8 mice, WT + JAQ1: 15 arterioles of 8 mice, Gp5^−/−+ JAQ1: 12 arterioles of 7 mice. Two-tailed Fisher’s exact test for open vs. occluded vessels, p = 0.0005 (WT vs. WT + JAQ1), p = 0.0031 (Gp5^−/− vs. WT + JAQ1; Gp5^−/− + JAQ1 vs. WT + JAQ1); one-way ANOVA followed by Tukey’s test for multiple comparisons to compare occluded vessels, ## p = 0.0034 (WT vs. Gp5^−/−), # p = 0.0401 (WT vs. Gp5^−/− + JAQ1) compared to JAQ1-treated WT mice (p = 0.0031). * compared to JAQ1-treated WT mice. (e) The abdominal aorta was mechanically injured by a single firm compression with a forceps and blood flow was monitored with a Doppler flowmeter. Time to cessation of blood flow is shown. Each symbol represents one mouse. Two-tailed Fisher’s exact test for open vs. occluded vessels, one-way ANOVA followed by Dunn’s test for multiple comparisons to compare occluded vessels. WT: n = 18, Gp5^−/−: n = 16, WT + JAQ1: n = 7, Gp5^−/−+ JAQ1: n = 7, ***WT + JAQ1 vs. WT and vs. Gp5^−/−: p < 0.0001, ** WT + JAQ1 vs. Gp5^−/−+JAQ1: p = 0.0047), ### compared to untreated WT mice (WT + JAQ1: p = 0.0003). (f) Hemostatic function was assessed using a tail bleeding assay on filter paper. Each symbol represents one mouse. WT: n = 18, Gp5^−/−: n = 17, WT + JAQ1: n = 12, Gp5^−/−+ JAQ1: n = 9. one-way ANOVA followed by Dunn’s test for multiple comparisons to compare occluded vessels, p = 0.0001’*, ^# p < 0.05; **, ^## p < 0.01; ***, ^### p < 0.001.

Source Data

Extended Data Fig. 4 shGPV directly interacts with thrombin.

(a) P-selectin exposure at threshold thrombin concentrations in rhGPV-treated (20 µg/ml) and WT platelets. Mean ± SD of n = 5 mice, 3 independent experiments. (b) Unaltered αIIbβ3 integrin activation (JON/A-PE binding) at threshold thrombin concentrations in the presence of rhGPV. Mean ± SD, n = 5 mice, 3 independent experiments. Welch’s test. Fibrin fibres (c) and hGPV staining (d) were quantified upon static fibrin polymerization induced by thrombin or batroxobin in the absence or presence of rhGPV. Mean ± SD, (c) -rhGPV: n = 4, rhGPV: n = 5 (Thrombin), n = 4 (Batroxobin), two-tailed unpaired t-test with Welch’s correction, p = 0.0020, (d) -rhGPV: n = 4, rhGPV: n = 5 independent samples (mean of 2 ROI per sample), two-tailed unpaired t-test wit Welch’s correction, p = 0.0029 (thrombin), p = 0.0006 (batroxobin). (e-g) rhGPV and thrombin were incubated at equimolar ratio (1:1) or with an excess of rhGPV (10:1 ratio) and thrombin-mediated cleavage of rhGPV was assessed over time by immunoblotting. (f) Quantification of thrombin-cleaved sGPV over time. Mean ± SD, n = 5 independent western blot experiments. (g) rhGPV and thrombin were incubated at equimolar ratio (1:1) or with an excess of rhGPV (10:1, 30:1 ratio) and the activity of thrombin was determined using a chromogenic thrombin substrate. Mean ± SD, n = 3 independent samples, representative of 4 experiments. (h) Maximum projection of static fibrin polymerization induced by thrombin in the absence or presence of rhGPV (30:1 ratio). Thrombin and rhGPV were either directly added or preincubated for 10 min prior induction of polymerization. Fluorophore labelled fibrin(ogen): cyan, staining for hGPV: magenta. Scale bar: 20 μm. Quantification of fibrin fibres (i) and hGPV staining (j). Mean ± SD. n = 5 biologic samples (mean of 2 ROI per sample), (i) one-way ANOVA followed by Tukey’s multiple comparison test, p > 0.0001, (j) Kruskal-Wallis test followed by Dunn’s multiple comparisons test, p = 0.0175 (directly vs. no rhGPV), p = 0.0327 (preincubated vs. no rhGPV). *, p < 0.05; **p < 0.01; ***p < 0.001.

Source Data

Extended Data Fig. 5 rhGPV delays and reduces fibrin formation.

Recalcified whole blood was incubated in vitro with 20 µg/ml rhGPV prior to perfusion over collagen/TF spots. Quantification of fibrin generation during blood flow in human (a-c) and mouse blood (d, e). (a) Mean ± SEM; n = 4 donors, 3 independent experiments, two-tailed paired t-test, p = 0.0133. Ctrl: human donor. (b, d) Representative images displaying decreased fibrin formation after rhGPV-treatment. Scale bar: 20 µm. (c) Time to fibrin formation in rhGPV-treated human blood. Ctrl: Human control. Mean ± SD, n = 4 donors, 3 independent experiments, two-tailed paired t-test, p = 0.0163. (e) Time to fibrin formation in rhGPV-treated WT blood. Mean ± SD, WT: n = 6, WT + rhGPV: n = 7, 3 independent experiments, two-tailed Mann-Whitney test, p = 0.0023. (f) Analysis of fibrin fibrils by laser scanning confocal microscopy. Fibrin fibres were visualised using a Leica SP8 confocal microscope, 63x oil, Hyvolution mode, z-step size: 0.1 µm, 15 µm z-size. Images were deconvolved using Huygens Software. Maximum projection. Scale bar: 20 µm. Zoom-in: 5 µm. Representative of n = 5 mice. (g) Fibrin formation using Fibrin(ogen)A488 or the anti-Fibrin antibody 59D8. Representative images, scale bar: 20 µm. (h) Thrombin activity was determined in the outflow of the flow chamber using a fluorogenic thrombin substrate and measured immediately after sample collection. Mean ± SD; n = 7 mice, 3 independent experiments, two-tailed unpaired t-test with Welch’s correction, p < 0.0001. (i) Thrombin activity in flow chambers was determined using the fluorogenic thrombin substrate Z-GGR-AMC. (j) Representative images of (i). Mean ± SD; WT: n = 4, WT + rhGPV: n = 5 mice, 2 independent experiments, two-tailed unpaired t-test with Welch’s correction, p = 0.0039. Scale bar: 20 µm. (k) Carstairs staining of the abdominal aorta after mechanical injury-induced thrombus formation in a WT and rhGPV-treated mouse (red blood cells: yellow (indicated with black arrowhead), fibrin: bright red (red arrowhead), platelets: navy blue (white arrowhead), collagen: blue). Scale bar: 100 µm. rhGPV: 20 µg/ml. SAC: surface area coverage. *p < 0.05; **p < 0.01; ***p < 0.001.

Source Data

Extended Data Fig. 6 Unaltered MCA vessel diameter in Gp5^−/− mice.

Optically transparent brain samples of Gp5^−/− and WT mice were imaged using light sheet fluorescence microscopy (LSFM). (a) Due to its conserved branching and its easy recognition, we focused on the region around the middle cerebral artery (MCA) to allow better comparability between the samples. (b) We analysed the vessel diameter of the MCA (1) and 2 subsequent branches of the caudal (2) and rostral (5) branch of the MCA using Imaris Software. (c-e) Vessels in the left, right hemisphere and the combination of both hemispheres did not show any difference between GPV-deficient and WT mice. Mean ± SD. n = 4 mice. (f) Vessel diameters of microvessels in the brain were comparable between Gp5^−/− and WT mice. Mean ± SD. WT: n = 13 vessels of 4 mice, Gp5^−/−: n = 7 vessels of 4 mice. Two-tailed unpaired t-test with Welch’s correction. (g) PcomA scores (posterior communicating artery) were determined in brains from mice that were perfused with PBS followed 3 ml black ink diluted in 4% PFA (1:5 v/v) and comparable between Gp5^−/− and WT mice. n = 5. Mann-Whitney test. (a, b) created with BioRender.

Source Data

Extended Data Fig. 7 DOM/B does not alter platelet responses upon stimulation with collagen or thrombin in vitro, despite interfering with thrombin-mediated cleavage of GPV.

(a-c) Washed platelets were incubated in vitro with 10 µg/ml of the indicated antibodies for 5 min and stimulated with Horm or soluble collagen. Light transmission was recorded on an Apact four-channel aggregometer over 20 min. Representative aggregation curves of n = 3, 2 independent experiments. LEN/B: anti-α2 integrin antibody⁵¹. (d, e) Flow cytometry reveals unaltered reactivity of DOM/B-treated WT platelets upon thrombin stimulation compared to WT controls. Mean ± SD. n = 3 mice, 4 independent experiments, two-tailed unpaired t-test with Welch’s correction. (f) Aggregation upon thrombin-stimulation is not affected in the presence of DOM/B. Light transmission was recorded on an Apact four-channel aggregometer over 10 min. Representative curves of n = 3, 3 individual experiments. (g) Thrombin exosites I and II were blocked by the aptamers HD1 and HD22, respectively. Platelets were incubated with the indicated antibody (10 µg/ml) prior to thrombin stimulation. Thrombin-mediated cleavage of GPV was assessed by flow cytometry. Mean ± SD. n = 3 mice, 3 independent experiments. (h) Thrombin clotting time was assessed using a ball coagulometer in GPV mutant or anti-mGPV mAb treated PRP in the presence or absence of HD22. Antibody concentration: 10 µg/ml; aptamer concentration: 1.5 µM f.c., thrombin: 17 nM. Mean ± SD. WT, WT + DOM/B, WT + DOM/C: n = 5, Gp5^−/−: n = 4, Gp5^dThr, Gp5^−/−+HD22, Gp5^dThr + HD22: n = 3, WT + DOM/B + HD22, WT + DOM/C + HD22: n = 6, WT + HD22: n = 8. One-way ANOVA followed by Dunn’s test for multiple comparisons.

Source Data

Extended Data Fig. 8 DOM/B restores hemostasis and thrombus formation in the absence of GPVI, thereby reproducing the Gp5^−/− phenotype.

(a) Recalcified blood was perfused over collagen/TF spots. Thrombin activity was determined in the outflow using a fluorogenic thrombin substrate and measured immediately. Mean ± SD. WT, Gp5^−/−, WT + DOM/B: n = 7, Gp5^dThr: n = 8, one-way ANOVA followed by Tukey’s multiple comparisons test, p < 0.0001 for all groups compared to WT. (b) Recalcified blood was perfused over collagen/TF spots. Samples were stained for platelets (anti-GPIX), fibrin(ogen) and GPV, fixed and analysed with a Zeiss Airyscan microscope. Quantification of GPV intensities inside fibrin-rich, non-platelet area. Background GPV intensity in Gp5^−/− images is displayed as dashed line (n = 4). Mean ± SD. Two-way ANOVA followed by Tukey’s multiple comparisons test, p < 0.0001 (inside thrombus), p = 0.0089 (inside fibrin), WT. n = 11, WT + DOM/B: n = 16. (c, d) WT mice were injected with DOM/B (100 µg i.p.) and platelet count was assessed for 7 days (c). Platelet count at d0 was set to 100%. Mean ± SD. n = 5 mice, 2 independent experiments. (d) GPV platelet surface expression was assessed by flow cytometry for up to 7 days after DOM/B injection. Mean ± SD. n = 5 mice, 2 independent experiments. Receptor opsonization was measured using an anti-rat IgG FITC antibody. (e-g) GPVI was depleted from the platelet surface by injection of the anti-GPVI mAb JAQ1. Representative images (e) and quantification (f) of thrombus formation upon FeCl₃-induced injury of mesenteric arterioles in WT mice after JAQ1 and DOM/B treatment. Thrombus formation in no more than two arterioles of each mouse was analysed; data points represent measurements of one arteriole. WT: n = 18 arterioles of 10 mice, WT + DOM/B: n = 12 arterioles of 6 mice, WT + JAQ1: n = 13 arterioles of 7 mice, WT + DOM/B + JAQ1: n = 16 arterioles of 8 mice, two-tailed Fisher’s exact test to compare occluded vs. non-occluded vessels was used. p = 0.0007 (vs. WT), p = 0.0052 (vs. WT + DOM/B), p = 0.0011 (vs. WT + JAQ1 + DOM/B), # indicates vessel occlusion. Scale bar: 50 µm. (g) Mice lacking both collagen receptors GPVI and α2 were treated with DOM/B and hemostatic function was assessed using a tail bleeding assay on filter paper. Each symbol represents one mouse. WT: n = 8, Itga2^−/−: n = 10, Itga2^−/− + JAQ1: n = 25, Itga2^−/− + JAQ1 + DOM/B: n = 16, two-tailed Fisher’s exact test for open vs. occluded vessels. p = 0.0009 (vs. WT), p = 0.0003 (vs. Itga2^−/−), p = 0.0001 (vs. Itga2^−/−+JAQ1 + DOM/B), (h) Summary of the effects of the different anti-mGPV antibodies. n.e.: no effect. *p < 0.05; **p < 0.01; ***p < 0.001.

Source Data

Extended Data Fig. 9 LUM/B has no effect on thrombin-mediated platelet activation.

(a) Human platelets were incubated with 10 µg/ml LUM/B prior to flow cytometric analysis of PAC1-binding. Mean ± SD, n = 4 donors. (b) Human platelets were incubated with the indicated anti-hGPV mAbs light transmission was recorded on a Apact four-channel aggregometer over 10 min. Representative curves for n = 3. (c) Human platelets were incubated with the indicated antibody (10 µg/ml) prior to thrombin stimulation. Thrombin-mediated cleavage of GPV was assessed by flow cytometry. Mean ± SD, n = 2 donors, 3 independent experiments. (d) Flow cytometry reveals unaltered reactivity of LUM/B-treated platelets upon thrombin stimulation compared to controls. (e) Neither blockade of hGPV by LUM/B F(ab)₂ nor rhGPV (290 nM) affect thrombin time. (a, c, d, e) Values are displayed as mean ± SD. (d) n = 4 donors, 3 independent experiments, two-tailed unpaired t-test with Welch’s correction. (e) n = 3 donors, one-way ANOVA. (f, g) Recalcified whole blood was incubated in vitro with 10 µg/ml anti-hGPV antibody LUM3 prior to perfusion over collagen/TF spots. Quantification time to fibrin formation (f) and fibrin surface coverage (g) during blood flow of LUM3-treated (n = 8 donors) and control samples (n = 10 donors). (f) n = 6 donors Values are depicted as mean ± SEM (g). SAC: Surface area coverage. Ctrl: Human donor.

Source Data

Extended Data Table 1 Analysis of platelet count, size, and surface expression of glycoproteins in Gp5^dThr mice

Full size table

Supplementary information

Supplementary Information

Supplementary Table 1 and Figs. 1 and 2.

Reporting Summary

Source data

Source Data Fig. 1

File contains source data.

Source Data Fig. 2

File contains source data.

Source Data Fig. 2

Contains uncropped western blot image of Fig. 2h.

Source Data Fig. 3

File contains source data.

Source Data Fig. 4

File contains source data.

Source Data Fig. 5

File contains source data.

Source Data Extended Data Fig. 1

File contains source data.

Source Data Extended Data Fig. 2

File contains source data.

Source Data Extended Data Fig. 3

File contains source data.

Source Data Extended Data Fig. 3

Contains uncropped western blot image of Extended Data Fig. 3a.

Source Data Extended Data Fig. 4

File contains source data.

Source Data Extended Data Fig. 4

Contains uncropped western blot image of Extended Data Fig. 4e.

Source Data Extended Data Fig. 5

File contains source data.

Source Data Extended Data Fig. 6

File contains source data.

Source Data Extended Data Fig. 7

File contains source data.

Source Data Extended Data Fig. 8

File contains source data.

Source Data Extended Data Fig. 9

File contains source data.

Source Data Extended Data Table 1

File contains source data.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Beck, S., Öftering, P., Li, R. et al. Platelet glycoprotein V spatio-temporally controls fibrin formation. Nat Cardiovasc Res 2, 368–382 (2023). https://doi.org/10.1038/s44161-023-00254-6

Download citation

Received: 23 May 2022
Accepted: 15 February 2023
Published: 23 March 2023
Issue Date: April 2023
DOI: https://doi.org/10.1038/s44161-023-00254-6

This article is cited by

RE: Fibrin Network and Platelets Densities in Platelet‑Rich Fibrin (PRF) Membranes Produced from Plastic Tubes Without Additives—A New Approach to PRF Clinical Use
- Carlos Fernando Mourão
- Nelson Pinto
- Bruno Vasconcelos Gurgel
Journal of Maxillofacial and Oral Surgery (2024)
Glycoprotein V exerts local control of fibrin
- Elizabeth A. Knauss
- Marvin T. Nieman
Nature Cardiovascular Research (2023)

Subjects

Abstract

Similar content being viewed by others

Main

Results

Thrombus formation is accelerated in Gp5-mutant mice

sGPV binds to thrombin and localizes to fibrin

rhGPV reduces fibrin formation and protects from thrombosis

Blocking GPV cleavage offsets defects in hemostatic platelet function

Blocking GPV cleavage increases fibrin formation in human blood

Discussion

Methods

Animals

Human blood samples

Chemicals

Antibodies

Expression and purification of recombinant hGPV

Antibody treatment

Platelet depletion

Treatment with clopidogrel or rhGPV

Preparation of PRP and washed platelets

Aggregation assay

Flow cytometry

Thrombin- and N-ethylmaleimide-induced cleavage of GPV

GPV enzyme-linked immunosorbent assay

Clot retraction

Thrombin time

Thrombin generation

Static fibrin polymerization

Coagulation flow chamber

Time series experiments

Three-dimensional confocal microscopy

Thrombin activity

Western blot after pulldown

GPV–thrombin interaction in solution

Tail-bleeding time

Light sheet fluorescence microscopy

Sample preparation

Segmentation of brain LSFM images

Determination of vessel diameter

Transient middle cerebral artery occlusion

Posterior communicating artery scores

Mechanical injury of the abdominal aorta

FeCl3-induced injury of mesenteric arterioles

Data analysis

Reporting summary

Data availability

Code availability

References

Acknowledgements

Author information

Authors and Affiliations

Contributions

Corresponding authors

Ethics declarations

Competing interests

Peer review

Peer review information

Additional information

Extended data

Supplementary information

Source data

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Search

Quick links

FeCl₃-induced injury of mesenteric arterioles