Introduction

Depression and comorbid pain are frequently encountered clinically. In patients with all types of depression, mostly major depressive disorder (MDD), the mean prevalence of painful symptoms is up to 60%1,2,3. Additional longitudinal research has also demonstrated that depression is a risk factor for developing chronic pain4,5. Furthermore, depression comorbid with pain has worse treatment outcomes than that of either condition alone6, which implies that this comorbidity has different pathogenic mechanism. To address this issue, there is a great need to better understand the complex pathogenesis of the comorbidity, as well as to provide novel molecular targets for treatment.

Depression and pain can trigger each other, creating a vicious cycle whereby pain exacerbates depressive symptoms, which in turn augments pain perceptions7. On one hand, pain consists of two dimensions: a sensory discriminative dimension and an affective-motivational dimension8. An expanding body of research indicates that sensory and affective pain symptoms may involve different brain adaptations9. For example, mouse models of allodynia in depression-like conditions exhibit maladaptive plasticity of the central nucleus of the amygdala→parafascicular nucleus (CeA→PF) circuit, whereas inflammatory or neuropathic pain models do not10,11. In addition, distinct thalamocortical circuits of the posterior thalamic nucleus (POGlu) to primary somatosensory cortex glutamatergic neurons (S1Glu) and the parafascicular thalamic nucleus (PFGlu) to anterior cingulate cortex GABA-containing neurons to glutamatergic neurons (ACCGABA→Glu) subserve allodynia associated with tissue injury and depression-like states, respectively9. On the other hand, development of depression and chronic pain may involve the same brain structures7,12,13,14. The anterior cingulate cortex (ACC) has been implicated in emotional and pain processing15,16,17,18. Clinical studies have reported that patients with MDD and chronic pain have ACC volume reductions19,20. Functionally, neuroimaging studies on humans have repeatedly shown that patients with depression and chronic pain have hyperactivity in the ACC21,22. Indeed, in mice of the comorbid pain in depression, the excitability of ACC glutamatergic neurons was increased, and the excitability of ACC GABAergic neurons was decreased. Chemogenetic inhibition of ACC glutamatergic neurons or chemogenetic activation of ACC GABAergic neurons could relieve depressive-like behaviors and depression related allodynia9. Although these results suggest that depression with comorbid pain is caused by ACC hyperactivity, the exact molecular mechanism that causes ACC hyperactivity is yet unknown.

Sigma non-opioid intracellular receptor 1 (SIGMAR1) is an endoplasmic reticulum (ER) transmembrane chaperone protein which is enriched in central nervous system (CNS) and regulates various physio-pathological processes23,24. Several studies have identified the possible involvement of SIGMAR1 in the pathogenesis of CNS diseases such as anxiety, depression, cognitive disorders and pain via regulating dopaminergic, N-methyl-d-aspartate (NMDA) and glutamatergic neurotransmission25,26. Clinical research has found that a nucleotide substitution in Sigmar1 gene is associated with the occurrence of MDD in Japanese population27. Sigmar1-/- mice exhibited depressive disorders by showing prolonged immobility time in the forced swim test (FST) and the tail suspension test (TST)28,29,30. On the contrary, there are also studies showing SIGMAR1 antagonism inhibits depressive-like behaviors related with osteoarthritis pain in mice, and CD-1 Sigmar1-/- mice exhibit reduced behavioral despair throughout their lifespan31,32. Depression and pain are closely linked, therefore, the association of Sigmar1 with depression and depression related pain needs further clarification.

In the present study, using a variety of research approaches, such as immunofluorescence, Golgi staining, cell-type-specific chemogenetics, c-fos-tTA strategy, translating ribosome affinity purification (TRAP), pharmacological and rodents-based behavioral tests, we elucidated a pivotal role of Sigmar1 within the ACC in the context of depression comorbid with pain. In the disease model of depression comorbid with pain via chronic restraint stress (CRS), mice exhibited increased dendrite complexity and number in the ACC. Chemogenetic activation of glutamatergic neurons in the ACC can induce depressive-like and pain-like behaviors, while chemogenetic inhibition of these neurons can relieve these behaviors at CRS 4 W. We then utilized c-fos-tTA strategy to specifically target the depression-pain related neurons, and conducted TRAP and RNA sequencing of these neurons. The molecular profiling data showed that SIGMAR1 could be a potential molecular target for the treatment of depression comorbid with pain, which was confirmed by pharmacological experiments. Taken together, this study identified potential molecular mechanisms and promising non-opioid therapeutic targets for treating depression-pain comorbidity.

Materials and methods

Animals

C57BL/6 J (purchased from Cavens) male mice at the age of 8–12 weeks were used. Mice were maintained under specific-pathogen-free (SPF) conditions (12-h light-dark cycle, lights on from 8:00 am to 8:00 pm, temperature of 23 ± 2 °C and humidity of 50%–60%) and housed in a colony (3–5 mice per cage) with ad libitum access to food and water, except during the necessary modeling and behavioral tests. All the conducted experiments were reviewed and approved by the Animal Care and Use Committee of Xuzhou Medical University (Approval number: 202309T017).

Chronic restraint stress

Mice were individually confined to 50 ml plastic centrifuge tubes with several holes for 6 h per day for 28 days as previously reported9. The control mice were deprived of food and water at the same time and allowed to move freely in their home cages.

Assessment of depressive-like behaviors

All behavioral tests were performed in a dimly lit (~20 lux) room to minimize the stress of the mice. Behavioral assessments were conducted between 9:00 am and 5:00 pm during the light phase. Mice were acclimated in the test room for at least one day prior to testing and were undisturbed for at least 30 min before the tests. All behaviors were recorded using a tracking system (SMART 3.0, Panlab).

Tail suspension test (TST)

Mice were suspended individually about 50 cm above the table with the adhesive tape, which was placed 1 cm from the tail tip to ensure that the mice could not make any other contact or climb upwards during the test. During the 6 min test (2 min for adaptation, 4 min for recording), the immobility duration for the last 4 min was measured by a blinded observer. Mice were considered immobile when their front feet only make slight movements or no movement at all33.

Forced swimming test (FST)

Mice were placed individually in a transparent Plexiglas cylinder (diameter 15 cm, height 30 cm), which was filled with 15 cm depth of water (25 ± 1 °C) so that the mice could not touch the bottom with their hind paws. During the 6 min test (2 min for adaptation, 4 min for recording), the immobility duration for the last 4 min was measured by a blinded observer. Mice were considered immobile when they kept floating or swimming only with tiny movements to keep their heads above the water34,35,36.

Sucrose preference test (SPT)

The SPT was assayed according to we previously reported37. Mice were singly housed and habituated with two water bottles for 48 h then followed by the 24 h testing period during which the liquid in one of the bottles was replaced with 1% sucrose. The position of the two bottles was switched at 12 h to eliminate position preference. Sucrose preference was calculated as a percentage (100 x volume of sucrose consumed/total liquid consumed).

Assessment of pain-like behaviors

50% paw withdrawal thresholds (50%PWTs)

Mechanical allodynia was measured by PWT in a double-blinded manner by using the up and down method with von Frey filaments. Mice were placed on a wire mesh grid and allowed for 60-minute acclimation. A von Frey hair weighing 0.008 to 2.0 g was used. The filaments (from 0.16 g filament) were perpendicularly applied to the plantar surface of the left hind paw through the wire mesh grid. Once a positive response is observed, change the filament to next lowest level. In the absence of a response, move to the next highest filament. Paw withdrawal, flinching, or paw licking was considered a positive response. 50% PWTs was determined as 50%PWT = Power[10,(Xf+κδ)] in a Microsoft Excel (2010) document, Xf = value (in log units) of the final von Frey filament used; κ = tabular value (see Appendix from ref.38) for the pattern of positive/negative responses, and δ = mean difference (in log units) between stimuli (here, 0.411).

Paw withdrawal latency (PWL)

Thermal hyperalgesia was evaluated by PWL in a double-blinded manner following Hargreaves et al.39. Briefly, the mice were placed on a glass platform and allowed for 60-minute acclimation. Thermal stimulation was focused on the plantar surface of the left hind paw through the glass plate. The time taken to withdraw from the heat stimulus is recorded for 3 times at an interval of 5 min for rest. The average time was considered as the PWL. Thermal stimulation was no more than 20 s.

Viral injection

Stereotaxic brain injection was conducted using a stereotactic rack (RWD Life Technology Co. LTD, Shenzhen, China) under general anesthesia with pentobarbital sodium (40 mg/kg, i.p.). A heating pad was used to maintain the core body temperature of the animals at 37 °C throughout the procedure. The coordinates were defined as anterior-posterior (AP) starting from bregma, medial-lateral (ML) starting from midline, and dorsal-ventral (DV) starting from brain surface.

For chemogenetic manipulation, a volume of 200 nl rAAV-CaMKIIa-hM3D(Gq)-mCherry-WPREs-pA (AAV2/9, 5.32 × 1012 vgml−1) virus or rAAV-CaMKIIa-hM4D(Gi)-mCherry-WPREs (AAV2/9,5.34 × 1012 vgml−1) virus was injected bilaterally into the ACC (AP: 1.0 mm; ML: ±0.3 mm; DV: −1.9 mm) at a speed of 100 nl/min with a 10 min delay before the needle was withdrawn. Three weeks after viral injection, an intraperitoneal injection of Clozapine N-oxide (CNO,1 mg/kg or 3 mg/kg) was given 30 min before the depression-like behavior tests or the next day after the last injection for behavioural testing (repeated manipulation experiment). The rAAV-CaMKIIa-mCherry-WPRE-hGH-pA (AAV2/9, 5.29 × 1012 vgml−1) virus was used as the controls. All viruses were purchased from BrainVTA technology Co., Ltd. (Wuhan, China).

Golgi staining

Golgi staining was conducted using FD Rapid Golgi Stain (FD NeuroTechnologies). Mice were anesthetized by pentobarbital sodium (40 mg/kg, i.p.). The brains were immediately removed and immersed in mixed solutions A and B in brown bottles for 14 days, and the bottles were rotated every three days to ensure complete immersion. After 14 days, the brains were transferred to solution C and immersed for 48 h at 4 °C in the dark. The samples were sliced coronally into 120-um sections using a vibratome (Leica) and placed on gelatin-coated slides. After immersion in solution C for 2 min and subsequent air drying, the brain slices were rinsed twice with pre-cooled ddH2O for 4 min each, followed by staining in solutions D and E for 10 min. Stained brain slices were rinsed again with ddH2O twice for 4 min each and then dehydrated in a gradient of 50%, 75%, 95% and 100% ethanol for 4 min each. The dehydrated brain slices were washed in xylene 3 times for 4 min each and sealed with neutral gum. Finally, the stained images of dendritic spines were captured using open field fluorescence microscope for observation and analyzed using ImageJ and Sholl.

Cannula implantation and microinjection

Mice were deeply anesthetized by pentobarbital sodium (40 mg/kg, i.p.) and mounted on a stereotactic holder. An incision was made in the skull to expose the surface. Two small holes were drilled on the skull surface above the ACC, and the dura was gently reflected. Guide cannulas were placed at the ACC of the mouse brain. SIGMAR1 agonist (SA4503, GC33697, GlpBio), antagonist (NE-100, HY-101484A, MCE) or saline-vehicle were delivered bilaterally into the ACC (0.5 µl/side over 1 min) once or once a day for 7 consecutive days. The injector cannula was held for 5 min before removement to prevent backflow. After microinjection, the mice were placed back to their home cages for 30 min, followed by behavioral observations. Subsequently, histological confirmation of the injection was performed.

Immunohistochemistry and imaging

Mice were deeply anesthetized by pentobarbital sodium (40 mg/kg, i.p.) and sequentially perfused with phosphate-buffered saline (PBS) followed by 4% paraformaldehyde solution. The brains were removed, postfixed with 4% paraformaldehyde solution at 4 °C overnight and dehydrated in 30% sucrose solution for 48 h. Brain slices were prepared coronally with freezing microtome (VT1000S, Leica Microsystems) at a 30 μm thickness and were incubated with the blocking buffer containing 1% BSA and 0.1% Triton X-100 in PBS for 2 h at room temperature and then overnight at 4 °C with the primary antibodies including anti-glutamate (1:500, mouse, Invitrogen) and anti-c-Fos (1:1000, rabbit, Cell Signaling Technology). After the slices were washed with TBS 3 times for 10 min each time, they were incubated with secondary antibodies (1:500, Thermo Fisher Scientific) for 2 h at room temperature and followed by washing with PBS and mounting. After staining, slices were visualized with the laser scanning confocal microscopy (LSM880; Zeiss).

c-Fos-tTA strategy and molecular profiling

C57BL/6 J mice were dosed with Dox (200 mg/L, dissolved in drinking water) 3 days before the stereotactic surgery. Stereotactic surgeries were performed by injecting the ACC on each side with 200 nl of mixed rAAV-cFos-tTA-NLS-FLAG (AAV2/9, 2.07 × 1012 vgml−1, BrainCase, China) and rAAV-TRE3G-HA-NBL10 (AAV2/9, 2.45 × 1012 vgml−1, Braincase, China) viruses to selectively label ribosomes of activated neurons. 3 days after surgery, the mice were used for establishing depression-pain comorbidity models. After four weeks of restraint, Dox-containing water was replaced with normal drinking water for 3 days to allow adequate labelling of imprinted neurons associated with depression-pain comorbidity in the ACC. After tagging, Dox was re-introduced into the drinking water. Mice were subsequently executed for molecular analyses as previously described11,35,40. Briefly, the ACC was rapidly dissected on ice and transferred into the dissection buffer. Mice brains were divided into three groups of four mice each and immunoprecipitated in the presence of anti-HA magnetic beads (ThermoFisher). The collected RNA samples were purified by RNeasy Mini Kit (QIAGEN) and quantified using Quant-iT dsDNA HS Assay Kit, followed by RNA sequencing library construction and Illumina sequencing.

RNA extraction and qPCR

The RNA was extracted from mouse ACC tissues using Trizol reagent. Total RNA from each sample was subjected to a reverse transcription (RT) reaction using Goldenstar™ RT6 cDNA Synthesis Kit (TSINGKE, China), with a final volume of 10 μL of reaction solution. The genomic region of Sigmar1 was amplified by qPCR using primers flanking the target site. Assays were performed on an ABI QuantStudio 7 Flex Real-Time System (ThermoFisher Scientific, Waltham, MA) in a 10 μL volume containing 1 μL of cDNA template, 10 μM of each primer, and 5 μL of 2 x T5 Fast qPCR Mix (SYBR Green I). The reactions were performed for 40 cycles under the following conditions: 95 °C for 15 s, 60 °C for 20 s, and 72 °C for 20 s. The expression of housekeeping gene Gapdh was included as control. The specific primers sequence (5’ to 3’) used in qPCR are as follows: Gapdh-F ACTCTTCCACCTTCGATGCC; Gapdh-R TGGGATAGGGCCTCTCTTGC; Sigmar1-F GCTCGACAGTATGCGGGGCT; Sigmar1-R CAGACAGCGAGGCGTGCAGA.

Statistics and reproducibility

All data presented in this work were analyzed using GraphPad Prism 9.5 (GraphPad Software, Inc., USA). Two-tailed unpaired Student’s t-tests were used to perform statistical comparisons between two groups. Comparisons between multiple groups were analyzed using a one-way or two-way analysis of variance (ANOVA) followed by post hoc Bonferroni’ s multiple comparisons test when appropriate. Statistical significance was defined as P < 0.05, and results are expressed as the mean ± s.e.m.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Results

ACC glutamatergic neurons are activated in CRS mice with depression-pain comorbidity

To investigate ACC neuronal response under depression-pain comorbidity, we established a mouse model of depression-pain comorbidity via chronic restraint stress (Fig. 1A). 3 weeks after CRS (CRS 3 W), the mice displayed multiple depressive-like behaviors of increased immobility time in routine assays, including a tail-suspension test and a forced-swim test, and a decrease in 50% paw withdrawal thresholds (50% PWTs) and PWLs (Fig. 1B–F); Meanwhile, the 50% PWTs, the PWLs, the TST, the FST immobility time and SPT were more pronounced 4 W after CRS (Fig. 1G). These behavioral phenotypes last to 6 weeks after CRS which indicated that CRS-induced depression-like and pain-like behaviors can provide a sufficient time for subsequent functional investigations (Fig. 1H–J). Furthermore, to examine whether the pain we observed is affective pain associated with depression-like behaviors rather than somatic pain due to chronic restraints, we treated the mice with depression-pain comorbidity with a sub-anesthetic dose of 20 mg/kg S-ketamine treatment 12 h before the behavioral tests. As previously reported, S-ketamine can relieve depression-like behaviors and the affective pain but cannot reverse the reduction of 50% PWTs in both CFA and SNI mice only with sensory pain11. Our results demonstrated that pretreatment of S-ketamine reversed the reduction of 50% PWTs and normalized the increase of immobility time in the TST and FST in CRS mice (Supplementary Fig. 1A, B), which suggested that the pain-like behaviors observed in the CRS model were depression-related.

Fig. 1: ACC neurons are activated in CRS mice with depression-pain comorbidity.
figure 1

A Experimental procedure for mice with CRS treatment and behavioral tests. B 50% PWTs at different time points after CRS (Control, n = 8 mice; CRS, n = 16–20 mice). C PWLs at different time points after CRS (Control, n = 8 mice; CRS, n = 8 mice). D–J Behavioral tests of TST, FST and SPT in Control and CRS mice at 1 W (D), 2 W (E), 3 W (F), 4 W (G), 5 W (H), 6 W (I), and 7 W (J) (Control, n = 8 mice; CRS, n = 10–18 mice). K Representative confocal images (left) of c-Fos protein expression in ACC of Control, CRS 2 W and CRS 4 W mice and the quantification (right) of c-Fos positive neurons in ACC (n = 20 slices, 4–5 mice/group). Scale bar, 200 μm. L Representative Golgi-staining images of dendritic spine morphology of the ACC in Control and CRS 4 W mice (Scale bar, top: 50 μm; middle: 10 μm; bottom:10 μm). M Sholl analysis of dendritic branching complexity in the basal and apical dendrites of Control and CRS 4 W mice (n = 18–22, 4 mice/group). N, O Summary of the total dendritic length (left), the number of mushroom/stubby type dendritic spines (middle) and the number of thin/filopodia type dendritic spines (right) on basal (N) and apical (O) dendrites of ACC pyramidal neurons in Control and CRS 4 W mice (n = 18–22, 4 mice/group). Data were analyzed by one-way (K) or two-way ANOVA with post hoc Bonferroni’ s multiple comparisons test (B, C, M) or two-tailed unpaired Student’s t-test (D–J, N–O). All data are presented as the mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, ns not significant. CRS chronic restraint stress, ACC anterior cingulate cortex, BL baseline, W week, PWL paw withdrawal latency, PWT paw withdrawal threshold, TST tail suspension test, FST forced swimming test, SPT sucrose preference test.

Full size image

To detect the neuronal activity related to depression-pain comorbidity in mice, we conducted an automated survey of whole-brain c-Fos mapping. Immunofluorescence results showed that the expression of c-Fos protein in mice with depression-pain comorbidity was increased in several brain areas compared to the CRS 2 W animals (Supplementary Fig. 2A, B), including the medial prefrontal cortex (mPFC, containing prelimbic (PrL) and infralimbic subareas (IL)), the nucleus accumbens (NAc, containing the shell (NAc shell) and core (NAc core)), the paraventricular nucleus of the thalamus (PVT), the bed nucleus of the stria terminalis (BNST), hippocampus (Hip), the central amygdala (CeA), the basal lateral amygdala (BLA), the periaqueductal grey region (PAG), and the anterior cingulate cortex (ACC) (Supplementary Fig. 2A, B and Fig. 1K). Since previous studies have shown that ACC is a key nucleus in sensory perception and emotional responses41, we therefore explored the potential role of ACC in modulating depression and pain after chronic restraint stress. We then characterized the subtype of activated neurons after CRS. The analysis revealed a significant increase of c-Fos-positive neurons in CRS-treated mice and approximately 85% of the c-Fos+ cells were co-labelling with CaMKIIa (Supplementary Fig. 2C), which indicated that the CRS-activated neurons in the ACC were glutamatergic.

Basic and clinical studies have found that altered synaptic connectivity in brain regions, such as in the mPFC, hippocampus and NAc, is a fundamental reason that contributes to stress-induced depression and anxiety41,42. We aimed to investigate whether the depression-pain comorbidity is also caused by synaptic alterations in the ACC. First, we examined the dendritic formation and spine morphology of ACC pyramidal neurons using Golgi staining in control and CRS-treated mice. Sholl analysis revealed that the dendritic complexity of basal and apical dendrites of pyramidal neurons were increased in the CRS-treated mice (Fig. 1L, M). In addition, the total dendritic length of basal and apical spines were significantly increased in CRS-treated pyramidal neurons (Fig. 1N, O, left). Moreover, the number of mushroom/stubby type spines was increased in apical rather than basal dendritic spines (Fig. 1N, O, middle), and there were no changes in the number of thin/filopodia type spines in basal and apical dendrites (Fig. 1N, O, right).

Chemogenetic modulation of glutamatergic neurons in the ACC mediates depression-like behaviors and related pain

To determine the causal link between the activity of ACC glutamatergic neurons and depression-like behaviors and related pain, we first selectively activated CaMKIIa+ neurons in the ACC by injecting AAV-CaMKIIa-hM3Dq-mCherry into the ACC of naive mice (Fig. 2A). Immunofluorescence staining confirmed a robust virus expression in the ACC (Fig. 2B). Von Frey test showed that a single dose of intraperitoneal injection of the DREADD agonist clozapine N-oxide (CNO, 1 mg/kg, 30 min prior to the behavioral test) was sufficient to induce a significant decrease in 50% PWTs while there is no effect on TST or FST immobility time (Fig. 2C). However, a 7-day repeated injection of CNO (once daily) reduced the 50% PWTs as well as increased the TST and FST immobility time (Fig. 2D). These results suggest that chemogenetic activation of ACC glutamatergic neurons is sufficient to induce pain-like behaviors, whereas generation of depression-like behaviors takes a prolonged and repetitive activation of the ACC glutamatergic neurons.

Fig. 2: Chemogenetic modulation of ACC glutamatergic neurons bidirectionally regulate depression-like and pain behaviors in mice.
figure 2

A Experimental procedure for chemogenetic activation of naive C57BL/6 J mice. B Schematic illustration for virus injection and representative confocal images of AAV-CaMKIIa–hM3Dq–mCherry expression in the ACC. Scale bar, 200 µm. C 50% PWTs (left), TST immobility time (middle) and FST immobility time (right) 30 min after a single CNO administration (Control, n = 10 mice; hM3Dq, n = 13 mice). D 50% PWTs (left), TST immobility time (middle) and FST immobility time (right) 30 min after a 7-day repeated CNO treatment (Control, n = 10 mice; hM3Dq, n = 13 mice). E Experimental procedure for chemogenetic inhibition of CRS mice. F Schematic illustration for virus injection and representative confocal images of AAV-CaMKIIa–hM4Di–mCherry expression in the ACC. Scale bar, 200 µm. G 50% PWTs (left), TST immobility time (middle) and FST immobility time (right) upon chemogenetic inhibition of ACC glutamatergic neurons in CRS mice with depression-pain comorbidity. Behavioral tests were performed 30 min after CNO administration (Control-mCherry, n = 9 mice; Control-hM4Di, n = 9 mice; CRS-mCherry, n = 11 mice; CRS-hM4Di, n = 12 mice). Data were analyzed by two-tailed unpaired Student’s t-test (C, D) or two-way ANOVA with post hoc Bonferroni’ s multiple comparisons test (G). All data are presented as the mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001, ns not significant. CRS chronic restraint stress, ACC anterior cingulate cortex, PWT paw withdrawal threshold, TST tail suspension test, FST forced swimming test. CNO clozapine n-oxide.

Full size image

Similarly, we then injected AAV-CaMKIIa-hM4Di-mCherry into the ACC one week prior to chronic restraint stress (Fig. 2E, F). In the Von Frey test, we observed that a single dose of CNO (3 mg/kg, 30 min before the behavioral test) resulted in an increase of 50% PWTs in CRS mice injected with AAV-CaMKIIa-hM4Di-mCherry compared to those receiving control virus (Fig. 2G, left). This effect was not observed in the control mice. Meanwhile, chemogenetic inhibition of ACC glutamatergic neurons also normalized the TST and FST immobility time (Fig. 2G, middle and right). Taken together, these results strongly indicate that the activity of ACC glutamatergic neurons is closely associated with regulation of depression-like symptoms and related pain behavior.

CRS induced depression-pain comorbidity via upregulation of sigma non-opioid intracellular receptor 1 in the ACC neurons

To uncover novel molecular targets and advance our understanding of the molecular mechanism underlying depression-pain comorbidity, we conducted an unbiased study to molecularly profile the ACC depression-pain comorbidity related neurons. A mixture of rAAV-cFos-tTA-NLS-FLAG and rAAV-TRE3G-HA-NBL10 were injected into the ACC of C57BL/6 J mice, which enabled the labelling of depression-pain comorbidity-activated neurons by Dox withdrawal. The mice were subjected to subsequent profiling procedures when they have completely recovered from the depression-pain comorbidity (7 W after CRS) (Fig. 3A, B). We conducted ribosomal immunoprecipitation (IP) and collected the IP RNA (named as Input RNA) and the total RNA as samples for RNA sequencing (RNA-seq). We then identified transcripts that are selectively expressed in CRS-induced depression-pain comorbidity related neurons. The fold enrichment for each RNA was calculated by dividing the IP RNA abundance by the total RNA abundance. Remarkably, 1361 transcripts were upregulated in different functional subfamilies (q < 0.05, ≥ 1.5-fold) (Fig. 3C). Sigmar1 was selected from the enriched transcripts as a potential candidate for further functional analysis (Fig. 3D). We also verified the expression of Sigmar1 using qPCR and it is significantly increased in CRS 4 W animals compared with the control animals (Fig. 3E).

Fig. 3: Identification of Sigmar1 in depression-pain comorbidity-related ACC engram neurons as a potential receptor target for regulating the comorbidity.
figure 3

A Experimental procedure. B Schematic illustration for virus injection and a representative confocal image for virus expression. Scale bar, 200 µm. C RNA-seq scatterplots for depression-pain comorbidity-related neurons in the ACC with normalized expression. Significantly different genes (q < 0.05) are displayed in red (enriched) and green (reduced), and all other genes are displayed in grey. Black lines represent unity and 1.5-fold change in enrichment. D Relative expression levels are shown for upregulated genes in depression and pain comorbidity-related neurons as compared between the IP and Input (Input, n = 12 mice/repeat, 3 repeats in total; IP, n = 12 mice/repeat, 3 repeats in total). E Fold change of mRNA expression of Sigmar1 in the ACC (Control, n = 9 mice; CRS, n = 9 mice). Data were analyzed by two-tailed unpaired Student’s t-test. All data are presented as the mean ± s.e.m. *P < 0.05. CRS chronic restraint stress, ACC anterior cingulate cortex, TRAP translating ribosome affinity purification, IP immunoprecipitation.

Full size image

Activation of SIGMAR1 induced depression-like and pain-like behaviors

We then examined the effects of pharmacological activation of ACC SIGMAR1 on depression-like and pain-like behaviors (Fig. 4A, B). According to the behavioral results, a single infusion of the SIGMAR1 agonist SA4503 (0.015 mg/kg, 1 μl) into the ACC significantly reduced the 50% PWTs in naive mice, whereas it had no effect on behavioral performance in the TST and FST (Fig. 4C). Meanwhile, a 7-day repeated infusion of SA4503 significantly reduced the 50% PWTs in the Von Frey test, as well as increased the immobility time in the TST and FST (Fig. 4D). Contrarily, global treatment of SA4503 by intraperitoneal injection eliminated depression-like behaviors of CRS mice (Supplementary Fig. 3A), which is consistent with the findings of previous studies that SA4503 can abolish stress related negative emotions43,44,45. Thus, the effects on depression-like behaviors by activation of SIGMAR1 are brain region dependent. Next, to demonstrate that activation of SIGMAR1 can induce affective pain but not sensory pain, we treated the mice with S-ketamine after a 7-day administration of SA4503. We found that S-ketamine alleviated SA4503-induced pain and normalized the TST and FST immobility time (Supplementary Fig. 3B–D).

Fig. 4: Effects of intra-ACC infusion of Sigmar receptor 1 agonist (SA4503) on depression-like and pain behaviors.
figure 4

A Experimental procedure. B Schematic illustration for cannula implantation and a representative confocal image showing cannula implantation site in naive mice. Scale bar, 1 mm. C 50% PWTs (left), TST immobility time (middle) and FST immobility time (right) of naive mice following a single dose of bilateral intra-ACC infusion of Sigma receptor 1 agonist SA4503 (Vehicle, n = 9 mice; SA4503, n = 9 mice). D 50% PWTs (left), TST immobility time (middle) and FST immobility time (right) of naive mice following a 7-day repeated of bilateral intra-ACC infusion of Sigma receptor 1 agonist SA4503 (Vehicle, n = 9 mice; SA4503, n = 8–9 mice). E Representative Golgi-staining images of dendritic spine morphology in naive mice subjected to local infusion of vehicle/SA4503 in the ACC (Scale bar, top: 50 μm; middle: 10 μm; bottom:10 μm). F Sholl analysis of dendritic branching complexity in the basal and apical dendrites of naive mice subjected to local infusion of vehicle/SA4503 (n = 18–22, 4 mice/group). G, H Summary of the total dendritic length (left), the number of mushroom/stubby type dendritic spines (middle), and the number of thin/filopodia type dendritic spines (right) on basal (G) and apical (H) dendrites of ACC pyramidal neurons in naive mice subjected to local infusion of vehicle/SA4503 (n = 18–22, 4 mice/group). Data were analyzed by two-tailed unpaired Student’s t-test (C, D, G, H) or two-way ANOVA with post hoc Bonferroni’ s multiple comparisons test (F). All data are presented as the mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001, ns not significant, ACC anterior cingulate cortex, PWT paw withdrawal threshold, TST tail suspension test, FST forced swimming test.

Full size image

Consistently, Golgi staining revealed that continuous activation of SIGMAR1 in the ACC significantly promoted dendritic spinogenesis. First, sholl analysis revealed that the dendritic complexity of basal and apical dendrites of ACC pyramidal neurons was increased upon administration of SA4503 (Fig. 4E, F). Furthermore, the total dendritic length of basal and apical spines was significantly increased in the pyramidal neurons of SA4503-treated mice compared to those treated with vehicle (Fig. 4G, H, left). However, the number of mushroom/stubby type spines was increased in apical rather than basal dendrites in SA4503-treated mice, and there were no changes in the number of thin/filopodia type spines in basal and apical dendrites (Fig. 4G, H, middle, right).

Inhibition of SIGMAR1 in the ACC confers antidepressant and analgesic effects

We then investigated the effect of pharmacological antagonism targeting SIGMAR1 on depression-like and pain-like behaviors in CRS mice (Fig. 5A, B). Behavioral tests showed that a single dose of SIGMAR1 antagonist NE-100 (0.15 nM, 0.5 µl46) had no effect on behavioral performance in the TST and FST, whereas it increased the 50% PWTs in the Von Frey test (Fig. 5C). A 7-day repeated administration of NE-100 reversed the reduction of 50% PWTs and normalized the immobility time of TST and FST (Fig. 5D). Similarly, we also utilized Golgi staining to detect the dendritic and spine morphology. We found that a 7-day repeated dose of NE100 reduced the dendritic branching complexity, total length of basal and apical dendrites, and the number of mushroom/stubby type apical dendritic spines (Fig. 5E–H). These results strongly suggested that a long-term repeated inhibition of SIGMAR1 in the ACC can prevent dendritic spinogenesis and exert antidepressant and analgesic effects.

Fig. 5: Effects of intra-ACC infusion of Sigmar receptor 1 antagonist (NE-100) on depression-like and pain behaviors.
figure 5

A Experimental procedure. B Schematic illustration for cannula implantation and a representative confocal image showing cannula implantation site. Scale bar, 1 mm. C 50% PWTs (left), TST immobility time (middle) and FST immobility time (right) of mice with depression-pain comorbidity following a single dose of bilateral intra-ACC infusion of Sigma receptor 1 antagonist NE-100 (Control-Vehicle, n = 7 mice; Control-NE-100, n = 7 mice; CRS-Vehicle, n = 7 mice; CRS-NE-100, n = 7 mice). D 50% PWTs (left), TST immobility time (middle) and FST immobility time (right) of mice with depression-pain comorbidity following a 7-day repeated of bilateral intra-ACC infusion of Sigma receptor 1 antagonist NE-100 (Control-Vehicle, n = 7 mice; Control-NE-100, n = 7 mice; CRS-Vehicle, n = 7 mice; CRS-NE-100, n = 7 mice). E Representative Golgi-staining images of dendritic spine morphology in Control- and CRS-treated mice subjected to local infusion of vehicle/NE-100 in the ACC (Scale bar, top: 50 μm; middle: 10 μm; bottom:10 μm). F Sholl analysis of dendritic branching complexity in the basal and apical dendrites of Control- and CRS-treated mice subjected to local infusion of vehicle/NE-100 (n = 18–22, 4 mice/group). G, H Summary of the total dendritic length (left), the number of mushroom/stubby type dendritic spines (middle), and the number of thin/filopodia type dendritic spines (right) on basal (G) and apical (H) dendrites of ACC pyramidal neurons in Control- and CRS-treated mice subjected to local infusion of vehicle/NE-100 (n = 18–22, 4 mice/group). Data were analyzed by two-way ANOVA with post hoc Bonferroni’ s multiple comparisons test. All data are presented as the mean ± s.e.m. *P < 0.05, **P < 0.01, ns not significant, CRS chronic restraint stress, ACC anterior cingulate cortex, PWT paw withdrawal threshold, TST tail suspension test, FST forced swimming test.

Full size image

Discussion

Treatment outcomes for patients with depression comorbid with pain are worse than that of either condition alone6,47. The current study aimed to determine the brain region involved in the regulation of depression-pain comorbidity as well as the cellular and molecular mechanisms by which the comorbidity is generated from chronic restraint stress. We established mouse models of CRS and demonstrated that SIGMAR1 facilitates the depression-pain comorbidity via regulating structural synaptic plasticity of glutamatergic neurons in the ACC. These are significant findings that unequivocally show that the brain’s pathophysiological underpinning for the comorbidity of depression-pain and might provide a promising therapeutic target for clinical management.

Excitation of ACC pyramidal neurons has been implicated in mediating stress-related negative emotions9,48,49 and preferentially encoding affective pain rather than sensory pain50. In the present study, we further demonstrated that ACC hyperactivity is necessary for the generation of stress-induced depression-pain comorbidity. Acute chemogenetic activation of ACC glutamatergic neurons in naïve mice elicited pain behaviors, while repeated activations were necessary for the generation of depression-like behaviors. This aligns with the notion that the development of negative emotions in humans required a relatively long-term process51,52. Furthermore, we also proved that the pain derived from repeated activations of ACC glutamatergic neurons is affective pain but not sensory pain by administration of S-ketamine after repeated chemogenetic activations. This is consistent with that alterations in ACC neurons are involved in the processing of affective dimension of pain53. Interestingly, a single chemogenetic inhibition of ACC glutamatergic neurons was sufficient to alleviate depression-like and pain behaviors. The rapid antidepressant effects of ACC can also be observed in MDD patients for increased ACC activity in MDD patients are positively correlated with NMDA antagonist of Ketamine which have rapid and sustained antidepressant properties54,55,56.

We further investigated the morphogenesis of dendritic spines of ACC pyramidal neurons. The staining showed that the number of apical mushroom/stubby type spines, but not thin/filopodia ones, in CRS mice were significantly increased compared to the control animals. Dendritic spines are dynamic structures, and their addition and elimination have been interpreted as the gain and loss of excitatory synapses, respectively57. Mushroom and stubby spines are considered as mature ones which are associated with the level of synaptic activity58, while thin and filopodia spines are considered as immature ones but can be stable when coming into contact with a presynaptic counterpart and form the beginning of a synaptic connection59,60. Increased numbers of mushroom and stubby spines have been found to correspond with enhanced behavioral responses associated with depression and pain61,62. In particular, in the mouse model of chronic pain-induced depression, synaptic alterations including increased dendritic spinogenesis can also be observed in the ACC63. These data coincide with that stress-induced depression and pain are closely related with alterations in synaptic connections in brain regions involved with mood processing14,64,65,66.

Then how was the structural plasticity regulated in the ACC and facilitates the depression-pain comorbidity? We identified the Sigmar1 as a potential novel molecular candidate by specifically targeting the cells involved in the development of the comorbidity and conducting cell-type specific translating ribosome affinity purification for molecular profiling. We found a single pharmacological activation of SIGMAR1 in the ACC could reduce the 50% PWTs but had no effect on the TST and FST, while a 7-day repeated activation could induce depression-like behaviors. Conversely, a 7-day repeated pharmacological inhibition of SIGMAR1 in the ACC could relieve both depression and pain-like behaviors. The results of pharmacological administration were consistent with the chemogenetic manipulation of ACC, which suggested SIGMAR1 corelates with the hyperactivity of ACC. Furthermore, we used S-ketamine to confirm the pharmacological activation (SA4503) of SIGMAR1-induced pain is affective pain. It should be noted that S-ketamine can interact with SIGMAR1 (Ki = 139.6 μM) and SIGMAR2 receptors (Ki = 26.3 μM) indirectly, although the affinity with SIGMAR1 receptor is less potent than that of SIGMAR2, and also less than other antidepressants at nM levels, such as fluvoxamine, sertraline, fluoxetine67. The interaction between S-ketamine and SIGMAR1 may complicate the result. A previous study found that the antidepressant effect of the S1R agonist on Ketamine was dose dependent. A dose of SA4503 at 0.3 mg·kg−1·d−1, i.p., had no effect, but a dose at 1 mg·kg−1·d−1, i.p. for 3 days can magnify the antidepressant effect of ketamine (10 mg·kg−1·d−1, i.p.) on depression-like behaviors68. The dose of SA4503 and S-ketamine we used is 0.015 mg·kg−1·d−1 (local infusion) and 20 mg·kg−1·d−1, i.p., respectively. In the current study, we did not exclude the potential impact of SA4503 on the antidepressant effect of S-Ketamine, which should be taken into consideration for further studies. We also investigated the dendritic morphogenesis and found a causal link between the SIGMAR1 and increased number of apical mushroom/stubby type spines. However, in contrast to our conclusion that SIGMAR1 activation leads to depression and comorbid pain, Sigmar1 mutant mice also exhibited depression and displayed decreased number of mushroom spines in the hippocampus neurons69,70,71. Agonists of SIGMAR1 have been taken into clinical trials for antidepressant whereas inconclusive results from different clinical trials were obtained and clinical practice failed to show efficacy for antidepressants26,72,73,74. The discrepancy may be attributed to global inferences or local inferences of specific brain regions.

This study has potential limitations. First, we evaluated the neural and molecular mechanism based on an animal model with the comorbidity of depression and depression-related pain. Further validation is needed to investigate whether the mechanism is different in an animal model with the comorbidity of chronic pain and pain-related depression. Additionally, we used Von-Frey and Hargreaves tests to evaluate the impact of chronic stress on pain thresholds. The results can only demonstrate alterations in mechanical and thermal sensitivity, which suggests changes in nociceptive thresholds rather than definitive evidence of pain induction. We have to note that no test can measure pain in rodents directly—the presumably unpleasant emotional experience of pain can only be inferred from pain-like behaviors or nociception by evaluating the reaction to stimulus-evoked tests such as Von-Frey and Hargreaves tests or non-stimulus evoked methods such as grimace scales and burrowing75,76. Moreover, the study would benefit from a thorough investigation of the development from depression to depression and pain comorbidity. It would be interesting to dissect the differences in ACC neuron ensembles between these two states. Furthermore, the reliance on ACC intervention using Sigmar1 modulators would limit the generalizability of the potential target for clinical application. Further research is needed with peripheral intervention to confirm the generalizability of these findings.

In summary, our study delineates novel molecular mechanisms underlying the depression-pain comorbid states. Given the pharmacological options for treating the comorbidity is limited, these findings may offer a unique target for the development of clinical medicines.