Transactivation of the novel 5’ cis-acting element of mouse mammary tumor virus (MMTV) by human retroviral transactivators Tat and Tax

Khader, Thanumol Abdul; Ahmad, Waqar; Akhlaq, Shaima; Panicker, Neena Gopinathan; Gull, Bushra; Baby, Jasmin; Rizvi, Tahir A.; Mustafa, Farah

doi:10.1038/s42003-024-07139-9

Download PDF

Article
Open access
Published: 16 November 2024

Transactivation of the novel 5’ cis-acting element of mouse mammary tumor virus (MMTV) by human retroviral transactivators Tat and Tax

Communications Biology volume 7, Article number: 1521 (2024) Cite this article

3042 Accesses
1 Citations
1 Altmetric
Metrics details

Subjects

Abstract

The mouse mammary tumor virus (MMTV) encodes a 5’ element crucial for transcription of its genome along with the Rem/Rem-responsive element (RmRE) responsible for nuclear export of this unspliced RNA. Whether the 5’ element is Rem-responsive or has any functional interaction with host/viral factors to facilitate MMTV gene expression was tested in this study. Our results reveal that the 5’ element is non-responsive to Rem, but can be transactivated by both HIV Tat and HTLV-1 Tax activators. Reciprocally, MMTV could transactivate not only HIV TAR (similar to HTLV Tax), but also its 5’ element. Furthermore, we reveal involvement of pTEFb, a general elongation factor associated with transactivation by Tat/Tax. This makes MMTV the first betaretrovirus to encode both Rem/RRE and Tat/TAR-Tax/TRE-like transcription regulatory systems. This study should enhance not only our understanding of retrovirus replication and virally-induced cancers/immunodeficiency syndromes, but also development of improved retroviral vectors for human gene therapy.

Current landscape of vector safety and genotoxicity after hematopoietic stem or immune cell gene therapy

Article Open access 08 April 2025

Therapeutic limitations of oncolytic VSVd51-mediated miR-199a-5p delivery in triple negative breast cancer models

Article Open access 13 May 2025

Favipiravir, an antiviral drug, in combination with tamoxifen exerts synergistic effect in tamoxifen-resistant breast cancer cells via hTERT inhibition

Article Open access 22 January 2024

Introduction

The mouse mammary tumor virus (MMTV) is a classic betaretrovirus that causes breast adenocarcinomas and sporadically lymphomas/leukemia [reviewed in refs. ^1,2]. It was first discovered in the 1930s as a milk transmitted agent that caused mammary tumors in mice³. MMTV can be transmitted from the mother to the offspring exogenously via mother’s milk or endogenously through the germ line^1,2. This makes the MMTV/mouse model the most suitable and relevant animal model system to study human breast cancer development and progression as well as lymphomas/leukemias². MMTV is also an ideal system for the development of safer vectors for human gene therapy since MMTV is phylogenetically distant from primate retroviruses, reducing the chances of recombination with related retroviruses in humans. Furthermore, evidence suggests that MMTV can also infect non-dividing cells, the main targets of gene therapy in humans^4,5. Considering that this is a property unique to the lentivirus genera, this makes MMTV a valuable viral vector system for further exploration.

Despite being designated as a simple retrovirus early on (a retrovirus with only three to four canonical structural/enzymatic genes, gag, dut/pro, pol, and env), several studies have shown that MMTV is in fact a complex retrovirus as it harbors regulatory and accessory genes and sequences in its genome, similar to the classical complex retroviruses like human immunodeficiency virus (HIV) and human T-lymphotropic virus (HTLV)^4,6. For example, HIV contains the regulatory genes tat and rev that help transactivate basal gene expression and facilitate export of the unspliced genomic RNA (gRNA) from the nucleus to the cytoplasm for efficient protein expression using the cis-acting regulatory elements TAR and Rev-responsive element (RRE), respectively^7,8. In addition, other genes (vif, vpr, vpu, and nef) help HIV exploit cellular pathways for its replication, evasion from the host anti-viral and immune responses, and induce pathogenesis (reviewed in Deeks et al.⁸; Ramdas et al.⁹). Similar to HIV-1, HTLV-1 also encodes the typical structural and enzymatic genes (gag, pro, pol, & env) as well as regulatory genes analogous to HIV-1 tat & rev, namely tax and rex. In addition, it also encodes three additional transcripts, p12 & p13, important for viral infectivity & persistence, and p30, important for transcriptional regulation¹⁰. However, it also encodes the hbz gene, transcribed from the antisense strand using the 3′ LTR. While Tax is crucial for enhancing viral transcription from the 5′ LTR and inducing cell transformation, Hbz counteracts Tax function in transcription activation. This modulation influences various cellular signaling pathways involved in cell growth, immune response, and T-cell differentiation, resulting in the ability of HTLV-1 to establish latency and induce transformation of target T cells (reviewed in Boxus et al.¹⁰; Kannian and Green et al.¹¹, Currer et al.¹²; Ernzen & Panfil. et al.¹³).

Initially, MMTV was thought to encode only one accessory gene, dUTPase^14,15,16; however, over the years, it has been observed to contain superantigen (sag)¹⁷ and rem^4,6. dUTPase is thought to help the virus counteract the effect of host antiviral APOBEC protein^18,19 and maintain an appropriate nucleotide pool in the cell important for virus replication in perhaps non-dividing cells^5,20, while Sag is critical for the spread of virus in infected mice from the gut to the mammary gland^21,22,23. Rem is analogous to HIV-1 Rev/HTLV-1 Rex, an RNA-binding protein responsible for the successful export of unspliced gRNA from the nucleus to the cytoplasm^4,6. Like HIV-1 Rev/HTLV-1 Rex, MMTV Rem functions via a cis-acting RNA element, the Rem-responsive element (RmRE), located at the 3’ end of the viral genome^24,25. Once Rem interacts with RmRE, the CRM1 pathway of nuclear mRNA export is exploited by MMTV to deliver the unspliced RNA safely to the cytoplasm without splicing where it is used to make the structural proteins and also for its encapsidation into the assembling virions as gRNA^4,6. Interestingly, both HIV-1 Rev and HTLV-1 Rex can cross interact with MMTV RmRE and enhance expression of the MMTV as well as reporter gene expression²⁴. However, unlike HIV/ HTLV, MMTV so far is not known to contain a factor similar to Tat/Tax for transactivation of its basal gene expression.

In addition to post-transcriptional control, regulation of MMTV gene expression also occurs at the transcriptional level once the virus has reverse transcribed into a double stranded DNA and integrated into the host genome. The long terminal repeats (LTR) flanking the structural and enzymatic genes of the viral genome serve as the main source of cis-acting regulatory elements that control MMTV gene expression at the transcriptional level²⁶. The U3 region of the viral LTR includes promoters, enhancers, and transcription factor binding sites, including factors such as, NF1, Oct1, AP-2, and TFIID that facilitate basal gene expression^26,27,28. MMTV is also known for its tissue specific gene expression where the virus downregulates its structural gene expression in lymphocytes to hide from the immune system, while promoting its expression in the differentiated mammary epithelial cells to allow it to replicate to high levels necessary for exogenous milk borne transmission²⁸. The tissue specific gene expression is achieved with the help of negative regulatory elements (NREs) that bind SATB1 and CDP, two homeodomain proteins that inhibit virus expression in the lymphocytes^29,30,31,32. On the other hand, the hormone response elements (HREs) and mammary gland enhancer (MGE) boost virus gene expression in the mammary gland, facilitating virus replication in permissive, hormone responsive cells like the mammary epithelial cells^33,34,35,36.

Recently, we identified a novel 24-nucleotide region at the 5’ end of the MMTV genome that had a profound effect on virus gene expression when mutated³⁷. Its deletion or substitution severely affected MMTV transcript stability and elongation, resulting in a complete loss of Gag structural gene expression. A similar cis-acting element has been observed at the 5’ end of the HIV-1 and HTLV-1 genomes, though within the LTR^38,39. In the case of HIV-1, its trans-activation response element (TAR) has been proposed to be a second putative Rev responsive element (RRE), an internal loop within this region encompassing the HIV-1 packaging sequences was shown to bind Rev protein and mutations in this loop were shown to reduce nuclear export of viral gRNA and packaging^38,39. These observations suggested the possibility that the 5’ MMTV element is either a second RmRE (similar to HIV-1’s second putative RRE) or a cis-acting region analogous to HIV-1 TAR/HTLV-1 Tax responsive element (TRE), regulating transcriptional activation of its promoter by utilizing either viral (similar to Tat or Tax) or cellular factor(s) for function^11,12,40,41. Therefore, the goal of this study was to interrogate the ability of the MMTV novel 5’ cis-acting element for its Rem, Tat, and Tax responsiveness.

The results of this study reveal that while the novel cis-acting element does not respond to MMTV Rem, it is responsive to not only HIV-1 Tat, but also to HTLV-1 Tax. More importantly, the MMTV genome itself was able to transactivate transcription from this novel element, strengthening the observation that MMTV not only has a TAR/TRE like element, but that it also harbors a yet-to-be-identified virally-encoded factor that can activate gene expression from this element, making MMTV the first example of a betaretrovirus with this gene regulatory system.

Results

Description of the MMTV 5’ element

Figure 1A shows the location of the 5’ element within the MMTV genome. We called this element “novel” due to its unique location immediately upstream of the Gag ATG rather than within the viral LTR which classically houses the viral promoter, transcription factor binding sites and other enhancer/negative regulatory elements that control gene expression. Figure 1B shows the sequence of the 5’ element and the location of the major splice donor (mSD) and Gag ATG relative to the 5’ element. It also shows the two deletions introduced into the 5’ element (Δ12 bp and Δ24 bp) that abrogated MMTV gene expression³⁷. Conserved between different strains of MMTV, this element resides within the stable bifurcated stem loop 4 (SL4) observed to be critical for gRNA dimerization and its encapsidation into the nascent virus particles^42,43,44 (Fig. 1C).

**Fig. 1: Location & structure of the MMTV genomic region containing the 5’ element.**

The 5’ element is not Rem responsive

First, we investigated the Rem responsiveness of the 5’ element by cloning it into the previously-published vector, pHMΔeLTRluc, in which the Renilla luciferase gene was flanked by MMTV internal splice sites (EnvSD and SagSA; Fig. 2A)⁶. Thus, the luciferase reporter activity from this vector should be eliminated via splicing unless the vector contained a cis-acting element like RmRE that could rescue splicing and thereby luciferase expression, but only in the presence of the Rem protein. Either RmRE as a positive control ((+) C) or the 5’ element (the entire region between R to the Gag ATG to preserve the RNA structure of the region) were cloned into this vector downstream of the luciferase gene, creating a clone named TAK4 (wild type, WT). Both vectors were tested in the human embryonic kidney 293T (HEK293T) cells which are devoid of endogenous mtvs (unlike mouse cell lines) to ensure clarity of results since these loci could express endogenous Rem.

**Fig. 2: The 5’ MMTV *cis*-acting element is not responsive to Rem.**

The HEK293T cells were co-transfected with either the (+) C or WT (TAK4) reporter constructs in the presence or absence of increasing amounts of a Rem expression plasmid, GFPRem⁶ to determine if luciferase gene expression could be rescued by the 5’ element. Forty-eight hours post transfection, cells were harvested, and dual luciferase assay was performed. The Renilla luciferase values were normalized to those of the Firefly luciferase activity originating from pGL3-Control plasmid used to control transfection efficiency and further normalized to the microgram of protein tested in the assay (see Methods). As can be seen in Fig. 2, Rem was able to prevent the splicing of the Renilla luciferase transcript in the RmRE-containing (+) C vector, enhancing its expression by nearly 140 folds, while no luciferase expression could be rescued by Rem in the WT (TAK4) vector containing the 5’ element, even when 5- and 10-fold more concentration of Rem plasmid was used compared to that used for the (+) C (Fig. 2B).

Next, we determined whether the lack of response could have been due to the nature of the cell line used since HEK293T are of human origin rather than mice, which is the natural host of MMTV. Thus, the experiment was repeated in the MMTV permissive normal mouse mammary cell line, HC11 (Fig. 2C). Essentially the same observations were made in this cell line as HEK293T cells where efficient rescue of Renilla luciferase gene expression was observed with the RmRE-containing (+) C vector by Rem in a statistically significant manner (p value ≤ 0.000001), but not with the WT (TAK4) vector containing the 5’ element (Fig. 2C). Only the level of expression of the luciferase gene rescued by RmRE was different which was about 40-folds in the HC11 cells, nearly 3.5-fold lower than what was observed in the HEK293T cell line (Fig. 2Cversus 2B). This most likely is due to the presence of Rem expressed from endogenous mtvs present in HC11 cells, enhancing the basal level of luciferase expression in these cells and reducing the effect of exogenous Rem, as anticipated earlier. Western blot analysis confirmed the expression and dose response of Rem expression plasmid (Fig. 2D). Together, these results show that the 5’ element is not Rem responsive, and therefore not an additional RmRE found at the 5’ end of the MMTV genome, as initially proposed^24,37.

The MMTV 5’ element is responsive to HIV-1 Tat and HTLV-1 Tax

Previous work by Dudley and colleagues has shown activation of MMTV RmRE by the HTLV Rex protein²⁴, an observation which suggested functional similarities between MMTV and other complex human retroviruses. Since HIV-1 has separate cis-acting regions and proteins dedicated to its transcription regulation (Tat/TAR) and nucleocytoplasmic export of genomic RNA (Rev/RRE), therefore, it was intriguing to hypothesize that MMTV may also be following the same route as it already harbors the Rem/RmRE regulatory system analogous to HIV-1 Rev/RRE^24,37. Such a hypothesis was in concordance with our observation that the 5’ element deletion mutants were defective for transcript elongation and its stability, supporting the assertion that the 5’ element may be analogous to the TAR element of HIV-1³⁷. Therefore, we tested whether the MMTV 5’ element could be transactivated by heterologous viral transactivators HIV-1 Tat or HTLV-1 Tax.

To address this possibility, we interrogated the ability of HIV-1 Tat to transactivate the MMTV 5’ element using another luciferase-based assay of a different design where the wild type 5’ element (WT) or its deleted version (Mut; with Δ24 bp deletion shown in Fig. 1B) along with the CMV promoter were cloned in the multiple cloning site of the reporter plasmid pGL3-Basic, creating TAK8 (WT) and TAK9 (Mut), and tested in HEK293T cells (Fig. 3A). As can be seen, transfection of the luciferase gene construct containing the WT 5’ element (TAK8) showed basal transactivation in the absence of Tat to ~2-folds above the control (Mock) lacking TAK8. This transactivation was abrogated when the 5’ element was mutated in TAK9 (Mut; Fig. 3B), revealing that the basal level transactivation of the reporter was due to the presence of the 5’ element and its interaction with potential cellular factors. Test of TAK8 (WT) in the presence of Tat led to ~12-fold increase in luciferase expression compared to Mock or an additional 6-folds over that observed without Tat, an activation that was statistically significant (p value ≤ 0.000001) (Fig. 3B). Once again, this transactivation was lost when the mutant version of the 5’ element was used (Fig. 3B). Increasing amounts of Tat expression plasmid with the same amount of WT vector led to an increase in luciferase gene expression, revealing that this effect was dose-dependent and therefore specific to Tat and not due to any specific cellular factor(s) (Fig. 3C). Tat transactivation was nearly twice in Fig. 3B when compared to the dose response experiment in Fig. 3C since the amount of TAK8 (WT) reporter vector used in Fig. 3B (100 ng) was twice the amount used in Fig. 3C (50 ng) to allow for the incremental increase in Tat expression plasmid. This observation was further confirmed by repeating the dose-response experiment with TAK9 (Mut) reporter construct that contained the mutant 5’ element (Fig. 3D). A complete lack of transactivation was clear with TAK9 mutant with increasing concentrations of Tat expression plasmid, while the WT reporter vector was clearly transactivated by 5-folds in the presence of Tat. Finally, the experiment shown in Fig. 3B was repeated in the murine mammary epithelial HC11 cells and gave similar results where the transactivation of WT vector (TAK8) in the presence of Tat was ~3 folds over the one without Tat (p value ≤ 0.000001), an activation that was completely lost when the 5’ element mutant (TAK9) was used (Fig. 3E). These data reveal that the 5’ element can be transactivated by a heterologous viral factor like HIV-1 Tat.

**Fig. 3: Transactivation potential of the 5’ element by heterologous viral transactivators.**

Since the 5’ element was responsive to HIV-1 Tat, we further investigated its response to HTLV-1 Tax. As can be seen in Fig. 3F, a comparable observation was made when the HTLV-1 Tax was used instead of HIV-1 Tat where Tax was able to transactivate the 5’ element by over 2.5- folds above that observed without Tax in a statistically significant manner (p value ≤ 0.000001). This activation was essentially lost by the deletion of the 5’ element, and therefore was specific to it (Fig. 3F). Furthermore, like Tat, the activation was dose-dependent and thus specific to Tax (Fig. 3G) which was not observed when the mutant 5’ element-containing clone, TAK9, was used (Fig. 3H). These results remained consistent in HC11 cells where a nearly 3-fold activation was observed in the presence of Tax than its absence (p value ≤ 0.00001) (Fig. 3I), similar to HIV-1 Tat (Fig. 3E). The higher level of transactivation of the 5’ element observed in HC11 cells compared to HEK293T with both Tat and Tax suggests the presence of cell type specific factor(s) involved in this process. Together, these data reveal that the 5’ element can be transactivated by two heterologous retroviral transactivators, HIV-1 Tat and HTLV-1 Tax, suggesting that the 5’ element probably functions similar to the transacting responsive region TAR of HIV-1 or TRE of HTLV-1.

Finally, we took advantage of our TAK8 vector and reconfirmed the lack of Rem responsiveness of the 5’ element by testing it in the presence of Rem. As can be seen in Supplementary Fig. 1 provided in Supplementary Information), while MMTV could transactivate TAK8 by 2-folds, Rem was unable to activate luciferase expression from TAK8 at all; in fact, presence of Rem led to a slight decrease in luciferase expression, confirming our observation that the 5’ element is not responsive to Rem.

The HIV-1 TAR can be trans-activated by MMTV

Since our results revealed that the two heterologous human retroviral transactivators could transactivate the 5’ element, in a converse experiment, we asked whether MMTV had the potential to transactivate the HIV-1 TAR element. To test this possibility, the region containing the HIV-1 TAR (from R to 280 bp of HIV-1 Gag) along with the CMV promoter, was cloned into pGL3-Basic reporter plasmid, upstream of the Firefly luciferase gene, creating TAK11 (Fig. 4A). First, the reporter plasmid was tested with the homologous Tat protein to confirm the functionality of the plasmid in HEK293T cells. As can be seen, co-transfection of TAK11 with HIV-1 Tat expression plasmid resulted in a significant ~7.5-fold induction of the luciferase activity (p value ≤ 0.000001) compared to the empty vector control (EV) that lacked HIV-1 TAR region (Fig. 4B). Since HTLV-1 Tax is known to cross transactivate HIV-1 transcription, we tested the heterologous transactivator HTLV-1 Tax in this assay to activate HIV-1 TAR and observed a ~ 2-fold transactivation above EV that was statistically significant (p value ≤ 0.000001), confirming earlier results (Fig. 4B)⁴⁵.

**Fig. 4: An MMTV-encoded viral factor can transactivate the HIV-1 TAR element.**

Finally, co-transfection of TAK11 with a molecular clone harboring the whole MMTV genome (HYB MTV)⁴⁶ resulted in transactivation of the TAK11 luciferase gene expression by ~1.75-folds, in a statistically significant manner (p value ≤ 0.000001) (Fig. 4C). Interestingly, while lower than Tat, this level of transactivation was similar to the transactivation of the 5’ element by HTLV-1 Tax (Fig. 3F). These results suggest that MMTV potentially encodes a viral factor that has the ability to transactivate the HIV-1 TAR to a level similar to HTLV-1 Tax.

The 5’ element can be transactivated by an MMTV-encoded factor

Encouraged by these results, we asked whether the MMTV genome itself could transactivate the 5’ element. Towards this end, we tested the potential of WT (TAK8) 5’ element or its mutant (TAK9) to be transactivated by a full-length molecular clone of MMTV, HYB MTV, using HEK293T cells (Fig. 5A, B). Transient transfection of HEK293T with HYB MTV (MMTV (+)) led to activation of luciferase gene expression with TAK8 in a statistically significant manner (p value ≤ 0.000029) over and above what was observed in the cells without MMTV (MMTV (−), TAK8 alone) (Fig. 5B). This activation was specific to the 5’ element since it was abrogated when TAK9 was used instead of TAK8 (Fig. 5B). Since the level of transactivation observed was lower than expected, we tested these constructs in HEK293T cells stably expressing MMTV where most cells should be expressing MMTV. Transfection of TAK8 & TAK9 into the HEK293T cells stably expressing MMTV (HEK293T-MMTV) revealed that the stable cell line could activate luciferase gene expression by ~two-folds compared to the HEK293T cells transfected with TAK8 alone, an activation that was statistically significant (p value = <0.0001; Fig. 5C). As in the case of transiently transfected cells, the activation was specific to the 5’ elements since it was abrogated when the mutant 5’ element clone, TAK9, was used (Fig. 5C). Although the level of transactivation observed with the MMTV genome (whether transient or stable) was lower compared to that observed by HIV-1 Tat and HTLV-1 Tax, it could be because Tat and Tax were over-expressed from expression plasmids, while in the case of MMTV, the whole genome was used where the level of the putative transactivating protein would be a lot less, especially due to the large size of the plasmid used for expressing MMTV (>16.5 kb).

**Fig. 5: Transactivation potential of 5’ element by the MMTV genome.**

Finally, we tested whether a dose response could be observed with increasing amounts of the MMTV plasmid DNA, similar to what was observed for HIV-1 Tat and HTLV-1 Tax (Fig. 3). As can be seen, while not much difference could be observed between 1:2.5 and 1:5 (similar to Tat and partly Tax), a significant activation of luciferase gene expression could be observed with a 1:10 ratio of the DNAs (with 10 representing the MMTV plasmid; p value ≤ 0.000001), confirming that the MMTV genome had the ability to transactivate the 5’ element specifically (Fig. 5D).

To ensure that these findings were relevant to the natural context, the mouse mammary epithelial HC11 cells were transiently co-transfected with both TAK8 (WT) and HYB MTV or the 5’ element mutant, TAK9 (Mut) and HYB MTV. Similar to HEK293T cells, HYB MTV was able to transactivate the 5’ element in HC11 cells, but by 4-folds when compared to the 2-fold activation observed in HEK293T cells which was statistically significant (p value ≤ 0.000001) (Fig. 5E). This activation was essentially completely abrogated when the 5’ element was mutated (Fig. 5E). Altogether, the data presented in Figs. 4 and 5 reveal that the MMTV genome encodes a yet-to-be-identified factor that can transactivate gene expression via the 5’ element. Thus, the 5’ element functions as a cis-acting region similar to the HIV-1 TAR or HTLV-1 TRE that can be transactivated by both heterologous as well as a homologous viral protein, but not Rem.

pTEFb is important for the functioning of the MMTV 5’ element similar to HIV-1 TAR and HTLV-1 TRE

As mentioned earlier, the HIV-1 TAR and HTLV-1 TRE cis-acting elements both function in the transactivation of retroviral gene expression by recruiting several cellular factors using their cognate transactivators, Tat or Tax (reviewed in Bannwarth and Gatignol et al.¹¹; Boxus et al.¹²; Das et al.⁴⁰; Currer et al.⁴⁷; Rice et al.⁴⁸). Recruitment of these factors helps the transcription initiation process and facilitates elongation of transcripts; defects we had observed in the 5’ element MMTV genomic mutants in our earlier study³⁷. One common host factor recruited by these transactivators is pTEFb, a general elongation factor in eukaryotic transcriptional elongation. To determine whether pTEFb could be involved in the transactivation of MMTV gene expression by the 5’ element, we conducted RNA immunoprecipitation (RNA IP) experiments using RNA polymerase II (Pol II)- and pTEFb-specific antibodies. RNA Pol II initiates transcription, but pauses early on after promoter clearance to allow capping of the mRNAs which is necessary for transcript elongation. The pausing of RNA Pol II is due to the recruitment of negative elongation factors till the RNA Pol II is able to recruit pTEFb which removes the pause by displacing the negative elongation factors and activating positive elongation factors (reviewed in Core & Adelman; Whelan & Pelchat)^49,50. Thus, only those mRNAs elongate properly that are able to recruit pTEFb successfully and HIV-1/HTLV-1 do that through their transactivators Tat and Tax, respectively. Keeping this rationale in mind, we used our previously-established HEK293T stable cell lines expressing either the wild type MMTV genome (WT; SQ15) or an MMTV molecular clone with the Δ24 bp 5’ element mutation (Mut; SQ5)³⁷. The MMTV-expressing stable cells were lysed and immunoprecipitated using the above-mentioned antibodies, RNA was isolated from the immunoprecipitates, and subjected to gene specific standard RT-PCRs and RT-qPCR to analyze the transcripts thus generated (Fig. 6).

**Fig. 6: The mutant 5’ element is defective for RNA elongation.**

As can be seen, the control GAPDH transcript could be amplified from the WT- and Mut- expressing cell lines efficiently when either of the two antibodies were used for immunoprecipitation (lanes 2-5; Fig. 6A). This was expected since GAPDH is an important housekeeping gene that is efficiently expressed and elongated by RNA polymerase II and pTEFb. This was not the case when the isotype-specific control IgG antibodies were used and only background level of amplification or none could be observed in these samples, resulting most likely from non-specific binding (lanes 6-9; Fig. 6A).

Real time RT-qPCR of the extracted RNAs bound to RNA Pol II using a TaqMan assay specific for MMTV gRNA revealed that the 5’ mutant had reduced levels of MMTV gRNA compared to the WT (Fig. 6B). While statistically not significant, the difference could be appreciated in a statistically significant manner in the input lysates (Fig. 6B). This was not due to differences in input material since the TaqMan assay normalized the effects of variations in inputs using the endogenous control β-actin. This observation revealed that the 5’ element mutant was defective in overall transcription of MMTV gRNA, unlike the wild type construct. Test of the extracted RNAs after immunoprecipitation using pTEFb antibodies revealed a similar observation: the transcripts purified from pTEFb-bound antibodies were reduced in the 5’ element mutant compared to the WT in a statistically significant manner (Fig. 6C), revealing that the mutants were defective in transcript elongation (Fig. 6C). Once again, this was apparent from the input samples as well (Fig. 6C). These results confirm the overall transcription defect observed in the 5’ element MMTV mutant and further show that pTEFb is involved in the transactivation process by the 5’ element.

Discussion

The current study was undertaken to characterize the role of the novel cis-acting element identified at the 5’ end of the MMTV (Fig. 1) and determine whether it could function as a putative second 5’ RmRE similar to HIV-1^38,39 or whether it could act as a transacting responsive region similar to HIV-1 TAR/ HTLV-1 TRE (reviewed in Bannwarth and Gatignol et al.¹¹; Boxus et al.¹²; Das et al.⁴⁰; Currer et al.⁴⁷; Rice et al.⁴⁸; Liu et al.⁵¹). Results presented in this study reveal that the MMTV 5’ element does not function as a second RmRE (Fig. 2), as had been speculated earlier^24,37. Instead, it functions as a transacting responsive region analogous to HIV-1 TAR or HTLV-1 TRE since it can activate gene expression in response to well-known heterologous retroviral transactivators like the HIV-1 Tat and HTLV-1 Tax (Fig. 3). Furthermore, similar to the ability of Rev and Rex proteins of complex human retroviruses to cross interact with MMTV RmRE²⁴, we show that reciprocally, the HIV-1-TAR element can be cross transactivated by not only HTLV-1 Tax, but also an MMTV-encoded factor (Fig. 4). The level of this reciprocal transactivation was similar to that induced by HTLV-1 Tax (Fig. 4). Finally, we also provide preliminary evidence that the MMTV 5’ element can also be transactivated by a yet-to-be identified factor within the MMTV genome (Fig. 5). Similar to HIV-1 TAR and HTLV-1 TRE, successful transcript elongation by the 5’ element involves pTEFb recruitment (Fig. 6). Together, these results not only show that the 5’ element functions independent of the MMTV Rem/RRE pathway, but reveals that it actually belongs to the transcription pathways identified in complex human retroviruses like HIV-1 Tat/TAR or HTLV-1 Tax/TRE that play critical roles in activating viral gene expression early on in the viral life cycle^11,51. Thus, while the MMTV RmRE is primarily responsible for post transcriptional steps regulating MMTV gene expression, such as nucleocytoplasmic export of unspliced retroviral RNAs, the 5’ element in MMTV is crucial for transcription elongation. Considering that HIV-1 Tat^52,53 as well HTLV-1 Tax⁵⁴ interact with the cellular helicase XPB which is part of TFIIH that regulates initiation of transcription, a viral MMTV protein could also be involved in initiation of transcription.

Phylogenetically, MMTV is closer to HTLV-1 than HIV-1

If one compares MMTV with other retroviruses that contain the equivalent of Rev/RRE regulatory system of post transcriptional gene regulation, it becomes apparent that these retroviruses belong primarily to the genera lentiviruses that includes human, simian, feline, and bovine immunodeficiency viruses (HIV, SIV, FIV, and BIV), the equine infectious anemia virus (EIAV), caprine arthritis–encephalitis virus (CAEV), and maedi-visna virus (MVV) or the deltaretroviruses that includes HTLV-1, 2, and bovine leukemia virus (BLV)^26,55. In addition to Rev/RRE, all of these viruses invariably contain virally-encoded Tat/TAR or its equivalent Tax/TRE trans-activation pathways⁷. In fact, the first endogenous lentivirus discovered so far, the rabbit endogenous lentivirus type K (RELIK), dated to be at least 7 million years old and thought to be the ancestor of the exogenous lentiviruses, also contains not only the Rev/RRE, but also Tat/TAR transcription activating pathway⁵⁶.

Since MMTV already has a Rem/RRE system, it is not surprising that it should contain a TAR/TRE-like cis-acting responsive element and the potential to encode for a transacting factor similar to HIV-1 and HTLV-1 Tat or Tax, respectively. Based on the level of transactivation of a common heterologous responsive element like HIV-1-TAR (Fig. 4), our preliminary data suggests that compared to the HIV-1 Tat/TAR, the transactivation mechanism in MMTV may be more similar to HTLV-1 Tax/TRE. This is further supported by mutational analysis of the 5’ element in which specific deletion and substitution mutations were introduced in the background of the viral genome³⁷. These 6-24 bp deletions/substitutions revealed that only specific mutations abrogated the function of the 5’ element, with others not affecting the function of the 5’ element at all despite their large size³⁷. Considering that even single or double base pair mutations disrupt the structure of the SL4 bifurcated stem loop RNA completely⁴³, these results suggest that the 5’ element functions at the DNA element. This speculation is supported by the observation that phylogenetically, the deltaviruses to whom HTLV-1 belong, are closer to the betaretroviruses than the lentiviruses⁵⁶.

To confirm this hypothesis, we conducted our own phylogenetic analysis using sequences from the highly conserved reverse transcriptase domain of Pol, but only from the MMTV, HIV-1, and HTLV-1 strains of viruses within each genus (see Supplementary Data 1 for sequences used and the associated accession numbers). As can be seen, a distinct clustering of the MMTV sequences (shown in blue) could be observed with those from HTLV-1 (shown in green), and sequences from both these viral strains grouped far away from those of HIV-1 sequences (shown in red) that were all clustered together (Fig. 7), clearly showing that MMTV is closer to HTLV-1 than HIV-1. Furthermore, we compared the genome structure of MMTV with HIV-1 and HTLV-1 and observed that the genome structure of MMTV is closer to that of HTLV-1 than HIV-1, especially within the Gag/Pro/Pol reading frame (Fig. 8). Thus, similar to MMTV, the HTLV-1 has two ribosomal frameshifts (RFs) that separate the Gag reading frame from that of Pro and Pol, while the HIV-1 has only one RF, separating Gag from Pro-Pol^7,15,26,57. These observations lend support to our hypothesis that MMTV may be closer to HTLV-1 than HIV-1; therefore, the MMTV transactivation system identified in this study may be closer to the HTLV-1 Tax/TRE system than that of HIV-1, a speculation that remains to be experimentally tested. Interestingly, the same may be true for the human endogenous virus K (HERV-K), a member of the betaretroviruses that has the closest homology to MMTV⁵⁸. Its genome structure in terms of the Gag/Pro/Pol reading frame is similar to MMTV and it also contains Rec/RcRE, the equivalent of the Rm/RmRE pathway (Fig. 8 and Dervan et al.⁵⁹). However, so far, the equivalent of the Tat/TAR system has not been observed in HERV-K which could be due to the introduction of mutations into its genome post integration to render it defective for replication⁵⁹. Therefore, based on this study, we predict that the betaretrovirus HERV-K may also have the potential to encode for a transactivation system similar to HIV Tat/TAR or HTLV Tax/TRE.

**Fig. 7: Phylogenetically MMTV sequences are closer to those of HTLV-1 than HIV-1.**

**Fig. 8: Comparison of the proviral genomes of HIV-1, HTLV-1, MMTV, and HERV-K and location of their genes within the genome.**

Retroviral transactivators and regulation of viral gene expression

HIV-1 Tat and HTLV-1 Tax belong to the group of viral transactivators that use cellular proteins to activate and regulate virus gene expression (reviewed in Liu et al. ⁵¹). Tat initially binds to the RNA structural element TAR present at the 5’ end of all HIV-1 transcripts for transcription activation and elongation (reviewed in Bannwarth and Gatignol et al.⁴⁰; Das et al.⁴⁷; Rice, et al.⁴⁸). Basal transcription in HIV-1 commences with the help of transcription factors like NFAT, NF-κB and Sp1 that help recruit RNA Pol II to the HIV-1 promoter in the 5′ LTR, leading to the generation of a minimal quantity of viral transcripts and formation of the TAR element at their 5’ ends. Some of these transcripts undergo splicing and translation, producing Tat. In the absence of Tat, transcription from the HIV LTR remains at basal level due to the presence of NELF (Negative Transcription Elongation Factor) and DSIF (DRB Sensitivity Inducing Factor) that associate with the RNA Pol II to impede elongation⁶⁰. TAR RNA stem loop itself acts as a termination sequence without Tat so that only basal level of transcription can take place, generating primarily short transcripts ~ 60 nucleotides long from the transcription initiation site.

Tat functions by recruiting the active form of pTEFb composed of the cyclin T1 and CDK9 subunits, from the cellular snRNA, 7SK, to the TAR element, leading to the creation of the Super Elongation Complex, that in addition contains several other factors^48,61. The kinase activity of pTEFb (CDK9) phosphorylates NELF, DSIF and the C-terminal domain of RNA Pol II, displacing NELF from the promoter, leading to release of the RNA Pol II and robust activation of transcription elongation by activating DSIF^62,63. Tat has also been shown to induce chromatin remodeling of genes in proviral DNA by recruiting histone acetyltransferases (HATs), such as PCAF (P300/CBP-associated factor), and others, to activate gene expression from silenced regions of the host genome^40,47,48.

Similar to Tat, the HTLV-1 Tax is a highly versatile transactivator of HTLV-1 gene expression and regulation that hijacks cellular pathways important for cell growth to aid virus replication (reviewed in refs. ^11,12. It enhances basal gene expression from the HTLV-1 LTR by initially displacing inhibitory histone modifiers like deacetylases (HDACs) and methyltransferases (HMTs) from the TRE and recruiting various chromatin remodelers like SWI/SNF, PCAF and CBP/p300 followed by basal transcription factors to the TATA box. However, unlike Tat, it achieves this by interacting indirectly with three 21-nucleotides long imperfect repeats within the U3 region designated TRE to recruit cAMP response element binding protein (CREB) and CREB-activating transcription factor (ATF) family of proteins. This complex in turn is used to further recruit the CREB-binding protein (CBP)/p300 to the promoter, leading to transcription activation. Once transcription is activated, similar to HIV-1 Tat, Tax recruits pTEFb to the promoter via interacting with its cyclin T1 subunit and the chromatin remodeler SWI/SNF. Thus, both Tat and Tax are able to activate basal viral gene expression and enable transcript elongation via recruiting pTEFb and same seems to be the case with the 5’ element (Fig. 6).

In addition to pTEFb, it is well-known that both HIV-1 Tat and HTLV-1 Tax can dysregulate the NF-ƙB pathway via protein-protein interactions. HIV-1 Tat activates NF-ƙB by interacting with TRAF6, an upstream activator of NF-ƙB signaling pathway⁶⁴, HTLV-1 Tax also can directly interact with multiple cellular factors, such as p105, p50, p65, p100, and IKK, preventing the inhibitors of the NF-ƙB pathway from regulating the pathway (reviewed in Currer et al.¹²). While at the moment we do not know which viral factor may be involved in the transactivation of the MMTV 5’ element, we have compared its sequence (GTAGGTTACGGTGAGCCATTGGAA) with the sequence of the NF-ƙB binding site (GGGRNYYYCC: where R represents purines, N any nucleotide and Y, pyrimidines) to determine if any similarity could be observed. We were able to find two partially-matching regions with one matching the consensus to 50% while the other matching the consensus by 60% (see Supplementary Fig. 2 provided in Supplementary Information). Whether this is sufficient to allow direct NF-ƙB binding remains to be determined experimentally.

Similar to the HIV and HTLV LTRs, the MMTV LTR on its own has a weak basal activity which needs to be activated. This is accomplished via hormonal stimulation since the MMTV promoter contains several glucocorticoid hormone responsive sites in hormone responsive cells^1,2. However, MMTV has a complex life cycle in mice and successful transmission of the virus from the gut-associated lymphoid cells to the mammary gland and eventually to the nursing pups requires infection of diverse cell types, including dendritic cell, B cells, T cell, and mammary epithelial cells in which virus expression is controlled by both enhancers and negative regulators in a cell-specific manner^1,2. Thus, it is reasonable to suggest that other than hormone stimulation, MMTV may possess an additional pathway to activate and regulate its basal gene expression, especially early in infection in cells that are not responsive to hormones.

Comparison of the MMTV 5’ element with HIV-1 TAR and HTLV-1 TRE sequences

Since we observed functional parallels between the MMTV 5’ element, the HIV-1 TAR, and HTLV-1 TRE, we compared these elements at the sequence and secondary RNA structural levels to determine if any similarities could be observed. Pairwise comparison of the 5’ element with the HTLV TRE either the Water or Matcher tool revealed that overall, there was no significant similarity with the three 21-bp triple TRE repeats, but interestingly a 65% homology/similarity was found with a region in between HTLV-1 TRE repeats 2 and 3, a region known as TRE2 (see Supplementary Fig. 3 provided in Supplementary Information). TRE2 is known to bind several transcription factors, including NF-ƙb, Sp1, c-Ets-1, THP-1, THP-2, and others (reviewed in Nyborg et al.⁶⁵; Barnhart et al.⁶⁶). TRE2 also contains a serum response element, SRE, that allows HTLV to regulate genes controlled by serum response factors^12,67. On the other hand, pairwise comparison of the 5’ element with the HIV-1 TAR sequences revealed that while there were small regions of matches, they were interspersed with frequent gaps. Considering the RNA structure of TAR is critical for its function, we compared the structure of the 5’ element with TAR and observed no significant similarity at the structural level either (see Supplementary Figs. 4 and 5 provided in Supplementary Information). These results further reinforce our conclusion that the MMTV 5’ element most likely functions at the DNA level and is closer to the HTLV-1 TRE than HIV-1 TAR element functionally.

Conclusions and significance

Overall, the data presented in this study clearly shows for the first time that MMTV encodes the equivalent of the Tat-TAR/Tax-TRE transcription activation system present in complex human retroviruses, in addition to the previously identified Rem/RmRE post transcriptional regulatory system. This makes MMTV the first example of a betaretrovirus with both these capabilities. These findings are critical since the MMTV/mouse model is the most suitable mammalian animal system to study breast cancer and leukemia/lymphoma development. Furthermore, being a rodent retrovirus phylogenetically distant from primate retroviruses, MMTV-based vectors are being pursued as a non-human retroviral vector for human gene therapy. In particular, similar to lentiviruses, MMTV has been shown to infect not only dividing but also non-dividing cells, the main targets of gene therapy, such as those of the muscles, brain, and heart. Thus, understanding how MMTV regulates its gene expression is not only vital to the development of such vectors, but should also contribute to a better understanding of virally-induced cancers as well as their possible treatment/prevention.

Methods

Nucleotide numbers

Nucleotide numbers in the MMTV clones refer to genome positions in HYB MTV, a molecular clone created by Shackleford and Varmus, 1988⁴⁶.

Cell lines and cell culture

The HEK293T are human embryonic kidney cells (ATCC, USA) that were maintained in Dulbecco’s modified Eagle’s medium (Hyclone, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific, USA) and appropriate antibiotics. HC11 are normal mouse mammary epithelial cells of BALB/c origin that were a gift from Prof. Jeffery M. Rosen, Baylor College of Medicine, Houston, TX USA. These cells were maintained in Roswell Park Memorial Institute (RPMI) medium (Hyclone, USA) containing 10% FBS, 0.5 μg/ml insulin (Merck, USA), 0.5 μg/ml epidermal growth factor (Thermo Fisher Scientific), 1% penicillin and streptomycin (10,000 µg/ml: Thermo Fisher Scientific) and 0.1% gentamycin (50 mg/ml w/v solution, Thermo Fisher Scientific). Both cell lines were maintained at 37 °C in a water-jacketed, 5% CO₂ atmosphere (Forma Series 3, Thermo Fisher Scientific).

MMTV molecular clones and expression plasmids

The wild type MMTV molecular clone SQ15 and the 5’ element deletion mutant clones, SQ5, have been described previously³⁷. These clones contain a CMV promoter in place of the U3 region in the 5’ LTR to allow expression of the virus in human cells, obviating the need of any hormone induction⁶⁸. The WT (TAK8) and mutant (TAK9) luciferase clones were constructed by inserting PCR amplified fragments of the CMV promoter to the first 400 nt of gag either with the 5’ element in TAK8 or without it in TAK9, into the multiple cloning sites of pGL3-Basic (Promega, USA) using restriction sites KpnI and SmaI. Finally, TAK11 was constructed by PCR amplifying the R to 280 bp of HIV-1 NL4-3⁶⁹ gag containing the HIV-1 TAR element into pGL3-Basic using the same restriction sites. All mutant clones were confirmed by sequencing and details of the cloning can be provided to the readers upon request. The HIV-1 Tat expression plasmid, SV2 Tat, was a kind gift from Prof. Andrew Rice (Baylor College of Medicine, Houston, TX, USA). The HTLV-1 Tax expression plasmid, pCMV4-Tax WT was obtained from Addgene, USA (plasmid # 23284).

Transfections

The HEK293T or HC11 cells were transfected with the desired plasmids using Lipofectamine 3000 (Thermo Fisher Scientific) according to manufacturer’s instruction. Briefly, 5 ×10⁵ cells per well were plated in a 6- well plate 24 h prior to transfection. Forty-eight hours post transfection, the transiently transfected cells were washed and harvested for subcellular fractionation, RNA, and protein isolation. For the dual luciferase assays, each construct was tested in triplicates and the transfections were repeated at least two to three times. Either pCDNA3, pGL3-Control or RL-TK (Promega) plasmids expressing firefly (FF) or renilla (R) luciferase (LUC) genes were used as transfection efficiency control, depending upon which reporter gene was present on the test vectors.

Dual luciferase assay

Luciferase values in the transiently transfected cells were estimated using the Dual-Luciferase® Reporter Assay System from Promega, as per manufacturer’s directions. Briefly, cells were lysed into 50 µl of 1X Passive Lysis Buffer (PLB) using three freeze-thaw cycles in dry ice and 37 °C water bath. The lysates were clarified of cellular debris by centrifugation at 13,000 rpm for 5 min at 4 °C and 5 µl lysate was used for dual luciferase readings using the Promega Glomax 20/20 Luminometer. The Promega Dual Glo protocol with an integration time of 10 s was used for the firefly (FF) and Renilla (R) luciferase (LUC) readings. Protein concentrations in the lysates were estimated using the BioRad (USA) Bradford reagent. The average FFLUC to RLUC (FFLUC/RLUC) values were normalized per µg protein and reported as relative light units (RLU) with respect to the values obtained for the wild type construct set as 1. All dual luciferase assays were conducted at least three times as biological replicates in triplicates except for data shown in Supplementary Fig. 1 which was conducted twice in triplicates. See Supplementary Data 2 for the source data used in Figs. 2–6 and Supplementary Fig. 1.

RNA extraction and RT-PCR

RNA was extracted from cells using the TRIzol reagent (Thermo Fisher Scientific), and frozen at -80°C until further processing as per manufacturer’s protocols. The RNA carrier Polyacryl (Thermo Fisher Scientific) was used as a carrier to ensure complete RNA isolation. RNA concentrations were determined using the Nanodrop Spectrophotometer (Thermo Fisher Scientific). Extracted RNA (2.5–5 μg was DNase I-treated (with 2 units of Turbo DNase l; Thermo Fisher Scientific) in the presence of 40 units of Recombinant RNasin (Promega) for 30 min at 37°C to ensure complete elimination of any contaminating DNA. The DNased RNA was subjected to 30 cycles PCR using GAPDH primers (OFM24/OFM25; Table 1) to check for the presence of any residual DNA. The DNase-treated RNAs were subsequently used for cDNA synthesis using 200 units of Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Promega), 40 units of RNasin, 2.5 mM dNTPs, and 1.5 μg of poly dT17 primer, as described before³⁷. The resulting cDNAs (1-2 μl) were tested with desired genes using primer pairs listed in Table 1. All primers used in the study, whether for cloning or in PCRs, were synthesized commercially from Macrogen, South Korea, using their in-house, cartridge-based, MOPC purification system that has purity similar to that observed with standard methods, such as high-performance liquid chromatography (HPLC) and gel purification. PCR amplifications were performed using an initial denaturation temperature of 94°C for 2 minutes, followed by 30 cycles of denaturation at 94 °C for 45 s, annealing between 50–60 °C for 45 s as per the primer melting temperature, and a final extension of 72 °C for 45 s to 5 min, depending upon amplicon size. The PCR products in regular RT-PCRs were analyzed on agarose gels (0.8–2%) stained with ethidium bromide that were viewed using the UVP BioSpectrum 610 Imaging system.

Table 1 Description of the primers used in this study

Full size table

Phylogenetic analysis

Phylogenetic analysis of HIV-1, HTLV-1, and MMTV pol gene was conducted by using sequences from its reverse transcriptase domain. CLUSTAL Omega was used for alignments and FigTree v1.44 (http://tree.bio.ed.ac.uk/software/figtree/) was used for viewing the phylogenetic tree using default settings. The accession numbers and the sequences used are provided in Supplementary Data 1.

Real-time qPCR assays

Real-time qPCR assays for all MMTV mRNAs and the genomic unspliced gRNA were conducted using two different custom made TaqMan assays described before³⁷ and the human β-actin endogenous control assay that detects actin in cDNA samples (Cat. no. 401846; Applied Biosystems, USA). The TaqMan assay that detects all MMTV mRNAs produced from the promoter employed a FAM-labeled probe (nt 1214–1230) along with a forward (nt 1192–1213) and reverse (nt 1256–1235) primers. The TaqMan assay that detects only the unspliced genomic RNA binds within a region removed from spliced viral RNAs within gag and employed a FAM-labeled probe (nt 1752–1769) along with a forward (nt 1729–1750) and reverse (nt 1791–1771) primers. The qPCRs were performed using 2 µl cDNA/sample in QuantStudio™ 7 Flex Real-Time PCR System under standard PCR conditions that consisted of a 2-min initial incubation at 50 °C to inactivate the uracil N-glycosylase enzyme present in the universal master mix to prevent contamination from previous amplicons. This was followed by 94 °C for 10 min to denature the template, followed by 50 cycles of denaturation at 94 °C for 15 s and annealing/extension at 60 °C for 1 min. The 2^-ΔΔCt method was used to obtain the relative quantification (RQ) values which were further normalized to the firefly luciferase expression per µg protein to compensate for differences in transfection efficiencies across the WT as well as the mutant constructs.

Western blot analysis

Protein lysates from transfected cells were prepared using RIPA buffer [50 mM NaF, 1X PBS, 1% IGEPAL, 0.1%SDS, 0.5% sodium deoxycholate (w/v), 1 mM PMSF (Merck)] supplemented with 1X Halt Protease and Phosphatase Inhibitor Cocktail, (Thermo Fisher Scientific) at 4 °C. One hundred µg of total protein per sample was separated on premade 4–12% gradient SDS polyacrylamide gels (GenScript ExpressPlus PAGE, USA) and transferred onto nitrocellulose membranes (GE Healthcare, USA) at 100 V for 1 h at 4 °C. After blocking in 5% non-fat milk, the membranes were incubated with primary antibodies (1:3000 dilution of mouse monoclonal anti-GFP antibody, SAB2702197, Merck, or mouse monoclonal anti β-actin, sc-47778, Santa Cruz Biotechnology Inc., USA) followed by the corresponding HRP-conjugated secondary antibodies. ECL Plus western blotting substrate (Thermo Fisher Scientific) was used to detect the chemiluminescent signals and captured using Sapphire Biomolecular Imager (Azure Biosystems, USA). Uncropped, full gel images of the western blots are available in Supplementary Fig. 6 provided in Supplementary Information.

RNA immunoprecipitation assays

The previously-described wild type (SQ15) and 5’ mutant (SQ5) HEK293T stable cell lines were used for the RNA immunoprecipitation experiment using the miRNA Target IP kit from Active Motif, USA; Cat No. 25500). The manufacturer’s directions were followed with 5 µg of each specific antibody (anti-Cyclin T1 rabbit mAb clone D1B6G from Cell Signaling Technology, USA (Cat. No. 81464; Lot No. 1)) and anti-RNA polymerase II RBP1 clone 8WG16 from BioLegend, USA (Cat. No. 664906; (Lot No. B232736)), as well as their corresponding IgG negative controls. Subsequently, RNA was isolated from the eluate using 500 µl of TRIzol reagent. The RNA samples were DNase-treated followed by cDNA preparation and tested for MMTV genomic RNA using TaqMan assays, as described above. The TaqMan assays were conducted once in triplicates.

Statistics and reproducibility

Statistical significance between the various constructs was determined using the Student’s paired two-sided t test. A threshold p value of 0.05 was considered least significant and given a one star. Any p value lower than that was given two, three or four stars, depending upon the values obtained (*p < 0.05; **p < 0.01 but >0.001; ***p < 0.001 but >0.0001; ****p < 0.0001). Graphpad Prism software v7 was used for the statistical analysis. The reproducibility of the data can be assessed by the fact that all dual luciferase assays presented in Figs. 2–5 were conducted in triplicates and tested at least three times as biological replicates with highly reproducible results, as observed with p values in mostly four stars.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The datasets supporting this article have been uploaded as part of the supplementary material as follows:

References

Ross, S. R. Mouse mammary tumor virus molecular biology and oncogenesis. Viruses 2, 2000–2012 (2010).
Article PubMed PubMed Central CAS Google Scholar
Dudley, J. P., Golovkina, T. V. & Ross, S. R. Lessons learned from mouse mammary tumor virus in animal models. ILAR J. 57, 12–23 (2016).
Article PubMed PubMed Central CAS Google Scholar
Bittner, J. J. Some possible effects of nursing on the mammary gland tumor incidence in mice. Science 84, 162 (1936).
Article PubMed CAS Google Scholar
Indik, S., Günzburg, W. H., Salmons, B. & Rouault, F. A novel, mouse mammary tumor virus encoded protein with Rev-like properties. Virology 337, 1–6 (2005).
Article PubMed CAS Google Scholar
Konstantoulas, C. J. & Indik, S. Mouse mammary tumor virus-based vector transduces non-dividing cells, enters the nucleus via a TNPO3-independent pathway and integrates in a less biased fashion than other retroviruses. Retrovirology 11, 34 (2014).
Article PubMed PubMed Central Google Scholar
Mertz, J. A., Simper, M. S., Lozano, M. M., Payne, S. M. & Dudley, J. P. Mouse Mammary Tumor Virus Encodes a Self-Regulatory RNA Export Protein and Is a Complex Retrovirus. J. Virol. 79, 14737 (2005).
Article PubMed PubMed Central CAS Google Scholar
Chameettachal, A., Mustafa, F. & Rizvi, T. A. Understanding Retroviral Life Cycle and its Genomic RNA Packaging. J. Mol. Biol. 435, 167924 (2023).
Article PubMed CAS Google Scholar
Ramdas, P., Sahu, A. K., Mishra, T., Bhardwaj, V. & Chande, A. From Entry to Egress: Strategic Exploitation of the Cellular Processes by HIV-1. Front Microbiol 11, 559792 (2020).
Article PubMed PubMed Central Google Scholar
Deeks, S. G., Overbaugh, J., Phillips, A. & Buchbinder, S. HIV infection. Nat. Rev. Dis. Prim. 1, 15035 (2015).
Article PubMed Google Scholar
Kannian, P. & Green, P. L. Human T Lymphotropic Virus Type 1 (HTLV-1): Molecular Biology and Oncogenesis. Viruses 2, 2037–2077 (2010).
Article PubMed PubMed Central CAS Google Scholar
Boxus, M. et al. The HTLV-1 Tax interactome. Retrovirology 5, 76–76 (2008).
Article PubMed PubMed Central Google Scholar
Currer, R. et al. HTLV tax: a fascinating multifunctional co-regulator of viral and cellular pathways. Front. Microbiol. 3, 406 (2012).
Article PubMed PubMed Central CAS Google Scholar
Ernzen, K. J. & Panfil, A. R. Regulation of HTLV-1 transformation. Biosci. Rep. 42, https://doi.org/10.1042/BSR20211921 (2022).
Bergman, A. C., Bjornberg, O., Nord, J., Nyman, P. O. & Rosengren, A. M. The protein p30, encoded at the gag-pro junction of mouse mammary tumor virus, is a dUTPase fused with a nucleocapsid protein. Virology 204, 420–424, (1994).
Article PubMed CAS Google Scholar
Hizi, A. et al. Characterization of mouse mammary tumor virus gag-pro gene products and the ribosomal frameshift site by protein sequencing. Proc. Natl Acad. Sci. 84, 7041–7045 (1987).
Article PubMed PubMed Central CAS Google Scholar
Hizi, A. et al. Analysis of gag proteins from mouse mammary tumor virus. J. Virol. 63, 2543–2549 (1989).
Article PubMed PubMed Central CAS Google Scholar
Choi, Y., Kappler, J. W. & Marrack, P. A superantigen encoded in the open reading frame of the 3’ long terminal repeat of mouse mammary tumour virus. Nature 350, 203–207 (1991).
Article PubMed CAS Google Scholar
Okeoma, C. M., Lovsin, N., Peterlin, B. M. & Ross, S. R. APOBEC3 inhibits mouse mammary tumour virus replication. Nature 445, 927–930 (2007).
Article PubMed CAS Google Scholar
Okeoma, C. M., Petersen, J. & Ross, S. R. Expression of murine APOBEC3 alleles in different mouse strains and their effect on mouse mammary tumor virus infection. J. Virol. 83, 3029–3038 (2009).
Article PubMed PubMed Central CAS Google Scholar
Hizi, A. & Herzig, E. dUTPase: the frequently overlooked enzyme encoded by many retroviruses. Retrovirology 12, 70 (2015).
Article PubMed PubMed Central Google Scholar
Finke, D. & Acha-Orbea, H. Differential migration of in vivo primed B and T lymphocytes to lymphoid and non-lymphoid organs. Eur. J. Immunol. 31, 2603–2611 (2001).
Article PubMed CAS Google Scholar
Golovkina, T. V., Chervonsky, A., Dudley, J. P. & Ross, S. R. Transgenic mouse mammary tumor virus superantigen expression prevents viral infection. Cell 69, 637–645 (1992).
Article PubMed CAS Google Scholar
Golovkina, T. V., Dudley, J. P. & Ross, S. R. B and T cells are required for mouse mammary tumor virus spread within the mammary gland. J. Immunol. 161, 2375–2382 (1998).
Article PubMed CAS Google Scholar
Mertz, J. A., Lozano, M. M. & Dudley, J. P. Rev and Rex proteins of human complex retroviruses function with the MMTV Rem-responsive element. Retrovirology 6, 10 (2009).
Article PubMed PubMed Central Google Scholar
Mullner, M., Salmons, B., Gunzburg, W. H. & Indik, S. Identification of the Rem-responsive element of mouse mammary tumor virus. Nucleic Acids Res 36, 6284–6294 (2008).
Article PubMed PubMed Central Google Scholar
Coffin, J. M., Hughes, S. H. & Varmus, H. E. Retroviral Virions and Genomes--Retroviruses (Cold Spring Harbor Laboratory Press, 1997).
Günzburg, W. H. & Salmons, B. Factors controlling the expression of mouse mammary tumour virus. Biochem J. 283, 625–632 (1992).
Article PubMed PubMed Central Google Scholar
Dudley, J. P. in Encyclopedia of Virology (eds B. W. J. Mahy & M. H. V. Van Regenmortel) 334–341 (2008).
Bramblett, D. et al. A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat. J. Virol. 69, 7868–7876 (1995).
Article PubMed PubMed Central CAS Google Scholar
Liu, J., Barnett, A., Neufeld, E. J. & Dudley, J. P. Homeoproteins CDP and SATB1 interact: potential for tissue-specific regulation. Mol. Cell. Biol. 19, 4918–4926 (1999).
Article PubMed PubMed Central CAS Google Scholar
Zhu, Q., Maitra, U., Johnston, D., Lozano, M. & Dudley, J. P. The homeodomain protein CDP regulates mammary-specific gene transcription and tumorigenesis. Mol. Cell. Biol. 24, 4810–4823 (2004).
Article PubMed PubMed Central CAS Google Scholar
Zhu, Q., Gregg, K., Lozano, M., Liu, J. & Dudley, J. P. CDP is a repressor of mouse mammary tumor virus expression in the mammary gland. J. Virol. 74, 6348–6357 (2000).
Article PubMed PubMed Central CAS Google Scholar
Cordingley, M. G., Riegel, A. T. & Hager, G. L. Steroid-dependent interaction of transcription factors with the inducible promoter of mouse mammary tumor virus in vivo. Cell 48, 261–270 (1987).
Article PubMed CAS Google Scholar
Truss, M., Bartsch, J., Schelbert, A., Haché, R. J. & Beato, M. Hormone induces binding of receptors and transcription factors to a rearranged nucleosome on the MMTV promoter in vivo. EMBO J. 14, 1737–1751 (1995).
Article PubMed PubMed Central CAS Google Scholar
Majors, J. & Varmus, H. E. A small region of the mouse mammary tumor virus long terminal repeat confers glucocorticoid hormone regulation on a linked heterologous gene. Proc. Natl Acad. Sci. USA 80, 5866–5870 (1983).
Article PubMed PubMed Central CAS Google Scholar
Mok, E., Golovkina, T. V. & Ross, S. R. A mouse mammary tumor virus mammary gland enhancer confers tissue-specific but not lactation-dependent expression in transgenic mice. J. Virol. 66, 7529–7532 (1992).
Article PubMed PubMed Central CAS Google Scholar
Akhlaq, S. et al. A cis-Acting Element Downstream of the Mouse Mammary Tumor Virus Major Splice Donor Critical for RNA Elongation and Stability. J. Mol. Biol. 430, 4307–4324 (2018).
Article PubMed PubMed Central CAS Google Scholar
Greatorex, J. S., Palmer, E. A., Pomerantz, R. J., Dangerfield, J. A. & Lever, A. M. L. Mutation of the Rev-binding loop in the human immunodeficiency virus 1 leader causes a replication defect characterized by altered RNA trafficking and packaging. J. Gen. Virol. 87, 3039–3044 (2006).
Article PubMed CAS Google Scholar
Gallego, J. et al. Rev binds specifically to a purine loop in the SL1 region of the HIV-1 leader RNA. J. Biol. Chem. 278, 40385–40391 (2003).
Article PubMed CAS Google Scholar
Bannwarth, S. & Gatignol, A. HIV-1 TAR RNA: the target of molecular interactions between the virus and its host. Curr. HIV Res. 3, 61–71 (2005).
Article PubMed CAS Google Scholar
Kashanchi, F. & Brady, J. N. Transcriptional and post-transcriptional gene regulation of HTLV-1. Oncogene 24, 5938–5951 (2005).
Article PubMed CAS Google Scholar
Aktar, S. J. et al. Structural basis of genomic RNA (gRNA) dimerization and packaging determinants of mouse mammary tumor virus (MMTV). Retrovirology 11, 1–21 (2014).
Article Google Scholar
Mustafa, F. et al. The bifurcated stem loop 4 (SL4) is crucial for efficient packaging of mouse mammary tumor virus (MMTV) genomic RNA. RNA Biol. 15, 1047–1059 (2018).
PubMed PubMed Central Google Scholar
Chameettachal, A. et al. A purine loop and the primer binding site are critical for the selective encapsidation of mouse mammary tumor virus genomic RNA by Pr77Gag. Nucleic Acids Res. 49, 4668–4688 (2021).
Article PubMed PubMed Central CAS Google Scholar
Geddes, V. E. V. et al. HTLV-1 Tax activates HIV-1 transcription in latency models. Virology 504, 45–51 (2017).
Article PubMed CAS Google Scholar
Shackleford, G. M. & Varmus, H. E. Construction of a clonable, infectious, and tumorigenic mouse mammary tumor virus provirus and a derivative genetic vector. Proc. Natl Acad. Sci. 85, 9655–9659 (1988).
Article PubMed PubMed Central CAS Google Scholar
Das, A. T., Harwig, A. & Berkhout, B. The HIV-1 Tat protein has a versatile role in activating viral transcription. J. Virol. 85, 9506–9516 (2011).
Article PubMed PubMed Central CAS Google Scholar
Rice, A. P. The HIV-1 Tat Protein: Mechanism of Action and Target for HIV-1 Cure Strategies. Curr. Pharm. Des. 23, 4098–4102 (2017).
Article PubMed PubMed Central CAS Google Scholar
Core, L. & Adelman, K. Promoter-proximal pausing of RNA polymerase II: a nexus of gene regulation. Genes Dev. 33, 960–982 (2019).
Article PubMed PubMed Central CAS Google Scholar
Whelan, M. & Pelchat, M. Role of RNA Polymerase II Promoter-Proximal Pausing in Viral Transcription. Viruses 14, 2029 (2022).
Liu, X. et al. Human Virus Transcriptional Regulators. Cell 182, 24–37 (2020).
Article PubMed PubMed Central CAS Google Scholar
Lacombe, B., Morel, M., Margottin-Goguet, F. & Ramirez, B. C. Specific Inhibition of HIV Infection by the Action of Spironolactone in T Cells. J. Virol. 90, 10972–10980 (2016).
Article PubMed PubMed Central CAS Google Scholar
Mori, L. et al. The XPB Subunit of the TFIIH Complex Plays a Critical Role in HIV-1 Transcription and XPB Inhibition by Spironolactone Prevents HIV-1 Reactivation from Latency. J Virol 95, https://doi.org/10.1128/JVI.01247-20 (2021).
Martella, C. et al. Human T-Cell Lymphotropic Virus Type 1 Transactivator Tax Exploits the XPB Subunit of TFIIH during Viral Transcription. J. Virol. 94, https://doi.org/10.1128/JVI.02171-19 (2020).
Carstens, E. Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses (2009). Arch. Virol. 155, 133–146 (2010).
Article PubMed CAS Google Scholar
Katzourakis, A., Tristem, M., Pybus, O. G. & Gifford, R. J. Discovery and analysis of the first endogenous lentivirus. Proc. Natl Acad. Sci. USA 104, 6261–6265 (2007).
Article PubMed PubMed Central CAS Google Scholar
Jacks, T., Townsley, K., Varmus, H. E. & Majors, J. Two efficient ribosomal frameshifting events are required for synthesis of mouse mammary tumor virus gag-related polyproteins. Proc. Natl Acad. Sci. USA 84, 4298–4302 (1987).
Article PubMed PubMed Central CAS Google Scholar
Medstrand, P. & Blomberg, J. Characterization of novel reverse transcriptase encoding human endogenous retroviral sequences similar to type A and type B retroviruses: differential transcription in normal human tissues. J. Virol. 67, 6778–6787 (1993).
Article PubMed PubMed Central CAS Google Scholar
Dervan, E., Bhattacharyya, D. D., McAuliffe, J. D., Khan, F. H. & Glynn, S. A. Ancient Adversary - HERV-K (HML-2) in Cancer. Front Oncol. 11, 658489 (2021).
Article PubMed PubMed Central CAS Google Scholar
Zhou, Q., Li, T. & Price, D. H. RNA polymerase II elongation control. Annu Rev. Biochem 81, 119–143 (2012).
Article PubMed PubMed Central CAS Google Scholar
McNamara, R. P. & Bacon, C. W. & D’Orso, I. Transcription elongation control by the 7SK snRNP complex: Releasing the pause. Cell Cycle 15, 2115–2123 (2016).
Article PubMed PubMed Central CAS Google Scholar
Fujinaga, K. et al. Dynamics of human immunodeficiency virus transcription: P-TEFb phosphorylates RD and dissociates negative effectors from the transactivation response element. Mol. Cell. Biol. 24, 787–795 (2004).
Article PubMed PubMed Central CAS Google Scholar
Yamada, T. et al. P-TEFb-mediated phosphorylation of hSpt5 C-terminal repeats is critical for processive transcription elongation. Mol. Cell 21, 227–237 (2006).
Article PubMed CAS Google Scholar
Li, Y., Liu, X., Fujinaga, K., Gross, J. D. & Frankel, A. D. Enhanced NF-kappaB activation via HIV-1 Tat-TRAF6 cross-talk. Sci. Adv. 10, eadi4162 (2024).
Article PubMed PubMed Central CAS Google Scholar
Nyborg, J. K. et al. Interaction of host cell proteins with the human T-cell leukemia virus type I transcriptional control region. II. A comprehensive map of protein-binding sites facilitates construction of a simple chimeric promoter responsive to the viral tax2 gene product. J. Biol. Chem. 265, 8237–8242 (1990).
Article PubMed CAS Google Scholar
Barnhart, M. K., Connor, L. M. & Marriott, S. J. Function of the human T-cell leukemia virus type 1 21-base-pair repeats in basal transcription. J. Virol. 71, 337–344 (1997).
Article PubMed PubMed Central CAS Google Scholar
Winter, H. Y. & Marriott, S. J. Human T-cell leukemia virus type 1 Tax enhances serum response factor DNA binding and alters site selection. J. Virol. 81, 6089–6098 (2007).
Article PubMed PubMed Central CAS Google Scholar
Rizvi, T. A. et al. Role of a heterologous retroviral transport element in the development of genetic complementation assay for mouse mammary tumor virus (MMTV) replication. Virology 385, 464–472 (2009).
Article PubMed CAS Google Scholar
Adachi, A. et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 59, 284–291 (1986).
Article PubMed PubMed Central CAS Google Scholar

Download references

Acknowledgements

We would like to thank Prof. Jeffery M. Rosen, Baylor College of Medicine, Houston, TX USA for the gift of HC11 cells, and Prof. Jaquelin P. Dudley, The University of Texas at Austin, TX USA for the gift of the Rem expression vector, GFPRem and the Rem reporter construct, pHMΔeLTRluc. The HEK293T cells were purchased from ATCC. The HIV-1 Tat expression plasmid, SV2 Tat, was a kind gift from Prof. Andrew Rice (Baylor College of Medicine, Houston, TX, USA). The HTLV-1 Tax expression plasmid, pCMV4-Tax WT was obtained from Addgene, USA (plasmid # 23284). This research is supported by ASPIRE, the technology program management pillar of Abu Dhabi’s Advanced Technology Research Council (ATRC), via the ASPIRE Precision Medicine Research Institute Abu Dhabi (ASPIREPMRIAD) award grant number VRI-20-10 and in part by funds from the United Arab Emirates University (UAEU) Zayed Center for Health Sciences (ZCHS) grant 31R140, and the UAEU Program for Advanced Research grants 12M136 and 12M103. TAK is supported by ASPIREPMRIAD award grant number VRI-20-10.

Author information

These authors jointly supervised this work: Tahir A. Rizvi, Farah Mustafa.

Authors and Affiliations

Department of Biochemistry and Molecular Biology, College of Medicine & Health Sciences (CMHS), United Arab Emirates (UAE) University, Al Ain, UAE
Thanumol Abdul Khader, Waqar Ahmad, Shaima Akhlaq, Neena Gopinathan Panicker, Bushra Gull, Jasmin Baby & Farah Mustafa
ASPIRE Research Institute in Precision Medicine, Abu Dhabi, UAE
Thanumol Abdul Khader, Tahir A. Rizvi & Farah Mustafa
Department of Microbiology and Immunology, CMHS, UAE University, Al Ain, UAE
Tahir A. Rizvi
Zayed Center for Health Sciences (ZCHS), UAE University, Al Ain, UAE
Tahir A. Rizvi & Farah Mustafa

Authors

Thanumol Abdul Khader
View author publications
Search author on:PubMed Google Scholar
Waqar Ahmad
View author publications
Search author on:PubMed Google Scholar
Shaima Akhlaq
View author publications
Search author on:PubMed Google Scholar
Neena Gopinathan Panicker
View author publications
Search author on:PubMed Google Scholar
Bushra Gull
View author publications
Search author on:PubMed Google Scholar
Jasmin Baby
View author publications
Search author on:PubMed Google Scholar
Tahir A. Rizvi
View author publications
Search author on:PubMed Google Scholar
Farah Mustafa
View author publications
Search author on:PubMed Google Scholar

Contributions

Conceptualization: F.M., T.A.R.; Data curation: T.A.K., W.A., S.A.; Formal analysis: T.A.K., W.A., N.G.P., S.A., B.G., J.B.; Funding acquisition: T.A.R., F.M.; Investigation: T.A.K., W.A., S.A.; Methodology: T.A.K., W.A., S.A.; Project administration: F.M.; Resources: F.M.; T.A.R.; Software: T.A.K., S.A.; Supervision: F.M.; Validation: T.A.K.; W.A.; Visualization: T.A.K., W.A., F.M.; Writing-original draft: T.A.K.; Writing-review & editing: T.A.K., T.A.R., F.M.

Corresponding authors

Correspondence to Tahir A. Rizvi or Farah Mustafa.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Communications Biology thanks Bertha Ramirez, and the other, anonymous, reviewer for their contribution to the peer review of this work. Primary Handling Editors: Harry Taylor and Johannes Stortz. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Description of Additional Supplementary File

Supplementary Data 1.

Supplementary Data 2.

Reporting Summary

Transparent Peer Review file

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Khader, T.A., Ahmad, W., Akhlaq, S. et al. Transactivation of the novel 5’ cis-acting element of mouse mammary tumor virus (MMTV) by human retroviral transactivators Tat and Tax. Commun Biol 7, 1521 (2024). https://doi.org/10.1038/s42003-024-07139-9

Download citation

Received: 03 December 2023
Accepted: 24 October 2024
Published: 16 November 2024
DOI: https://doi.org/10.1038/s42003-024-07139-9