Combination of antiviral drugs inhibits SARS-CoV-2 polymerase and exonuclease and demonstrates COVID-19 therapeutic potential in viral cell culture

Wang, Xuanting; Sacramento, Carolina Q.; Jockusch, Steffen; Chaves, Otávio Augusto; Tao, Chuanjuan; Fintelman-Rodrigues, Natalia; Chien, Minchen; Temerozo, Jairo R.; Li, Xiaoxu; Kumar, Shiv; Xie, Wei; Patel, Dinshaw J.; Meyer, Cindy; Garzia, Aitor; Tuschl, Thomas; Bozza, Patrícia T.; Russo, James J.; Souza, Thiago Moreno L.; Ju, Jingyue

doi:10.1038/s42003-022-03101-9

Download PDF

Article
Open access
Published: 22 February 2022

Combination of antiviral drugs inhibits SARS-CoV-2 polymerase and exonuclease and demonstrates COVID-19 therapeutic potential in viral cell culture

Communications Biology volume 5, Article number: 154 (2022) Cite this article

8204 Accesses
34 Citations
151 Altmetric
Metrics details

Subjects

Abstract

SARS-CoV-2 has an exonuclease-based proofreader, which removes nucleotide inhibitors such as Remdesivir that are incorporated into the viral RNA during replication, reducing the efficacy of these drugs for treating COVID-19. Combinations of inhibitors of both the viral RNA-dependent RNA polymerase and the exonuclease could overcome this deficiency. Here we report the identification of hepatitis C virus NS5A inhibitors Pibrentasvir and Ombitasvir as SARS-CoV-2 exonuclease inhibitors. In the presence of Pibrentasvir, RNAs terminated with the active forms of the prodrugs Sofosbuvir, Remdesivir, Favipiravir, Molnupiravir and AT-527 were largely protected from excision by the exonuclease, while in the absence of Pibrentasvir, there was rapid excision. Due to its unique structure, Tenofovir-terminated RNA was highly resistant to exonuclease excision even in the absence of Pibrentasvir. Viral cell culture studies also demonstrate significant synergy using this combination strategy. This study supports the use of combination drugs that inhibit both the SARS-CoV-2 polymerase and exonuclease for effective COVID-19 treatment.

Sofosbuvir terminated RNA is more resistant to SARS-CoV-2 proofreader than RNA terminated by Remdesivir

Article Open access 06 October 2020

Steffen Jockusch, Chuanjuan Tao, … Jingyue Ju

Discovery of SARS-CoV-2 antiviral synergy between remdesivir and approved drugs in human lung cells

Article Open access 02 November 2022

Xammy Nguyenla, Eddie Wehri, … Julia Schaletzky

A viral RNA-dependent RNA polymerase inhibitor VV116 broadly inhibits human coronaviruses and has synergistic potency with 3CLpro inhibitor nirmatrelvir

Article Open access 22 September 2023

Yumin Zhang, Yuan Sun, … Leike Zhang

Introduction

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), which is responsible for COVID-19, is a positive-sense single-stranded RNA virus^1,2. Thus it requires an RNA-dependent RNA polymerase (RdRp) to replicate and transcribe its genome. Because of its large genome (~30 kb) and error-prone RdRp, SARS-CoV-2 also possesses a 3′–5′ exonuclease for proofreading to maintain the integrity of the genome³. The replication complex of coronaviruses consists of several viral proteins, including the RdRp itself (nonstructural protein 12; nsp12) and its two accessory proteins (nsp7 and nsp8)^4,5,6, and the exonuclease (nsp14) with its accessory protein (nsp10)⁷.

While a variety of drugs targeting many of the SARS-CoV-2 proteins essential for its infectious cycle have been evaluated, to date no effective antiviral strategy for COVID-19 exists. Remdesivir (RDV), a nucleotide analogue, is the only small-molecule antiviral drug approved by the Food and Drug Administration (FDA) for COVID-19 treatment, although it was shown to have limited benefit in the World Health Organization’s Solidarity Trial. Lack of oral bioavailability and short half-life reduces RDV’s clinical effectiveness. With the appearance of new SARS-CoV-2 variants that pose a threat to public health and may escape the immune response to current vaccines, it is more critical than ever to develop antivirals that can treat COVID-19 effectively. We have investigated a library of nucleotide analogues targeting the SARS-CoV-2 RdRp, several of which have been FDA approved for other viral infections including HIV/AIDS and hepatitis B and C^8,9,10,11. Of particular interest are those that are able to be incorporated into the replicated RNA by the viral RdRp where they halt or slow further replication. These include, among several others, nucleotide analogues such as Sofosbuvir (Fig. 1a), an immediate terminator of the polymerase reaction which has since entered COVID-19 clinical trials^12,13, Remdesivir (Fig. 1b), a delayed terminator^14,15, and Tenofovir, an obligate terminator (Fig. 1d)^10,11. Recently, we demonstrated that upon the incorporation of the triphosphate forms of Sofosbuvir and Remdesivir into RNA by the SARS-CoV-2 RdRp complex, both nucleotide analogues were removed by the SARS-CoV-2 exonuclease complex, although Sofosbuvir was removed at a slower rate¹⁶. Currently, three other prodrugs related to nucleotides, Favipiravir (Fig. 1c), Molnupiravir, and AT-527 (Fig. 1e, f), are undergoing clinical trials for COVID-19.

**Fig. 1: Prodrugs and their active triphosphate forms.**

While nucleoside/nucleotide analogues show promising results against SARS-CoV-2, in vitro pharmacological parameters often exceed human plasma exposure. Most likely, nucleoside/nucleotide-based inhibitors are insufficient to block viral RNA replication, because they could be quickly excised by the SARS-CoV-2 exonuclease. A combination of RdRp inhibitors such as Sofosbuvir, Remdesivir, and others listed in Fig. 1 with exonuclease inhibitors may provide a more effective strategy for blocking SARS-CoV-2 RNA replication. We previously described the need to overcome the exonuclease proofreading function in order to completely inhibit SARS-CoV-2 replication in early 2020.¹⁰ An in silico study has proposed combining RdRp and exonuclease inhibitors as a strategy to combat COVID-19¹⁷; however, no successful demonstration of such a combined drug strategy has been reported. Hepatitis C virus (HCV) and SARS-CoV-2 are both positive-sense single-stranded RNA viruses. Viruses with small genomes that encode relatively few proteins, such as HCV, must possess multifunctional proteins¹⁸. HCV NS5A is a good example because it binds lipids, Zn⁺⁺ and RNA, as well as participates in phosphorylation and cell signaling events¹⁸. Zn⁺⁺ bound to the NS5A protein coordinates the binding of RNA. The SARS-CoV-2 genome is threefold larger than that of HCV. Although there is no counterpart of NS5A in SARS-CoV-2, the analogous NS5A functions are likely distributed among proteins nsp1 to nsp16 of the coronavirus¹⁹. We have previously shown that the NS5A inhibitors Daclatasvir and Velpatasvir inhibit both the SARS-CoV-2 polymerase and exonuclease activities^20,21. The combination of Velpatasvir with Remdesivir was shown to have a synergistic effect relative to Remdesivir alone in inhibiting SARS-CoV-2 replication²². Here, we further examined whether the NS5A inhibitors Pibrentasvir, Ombitasvir, and Daclatasvir (structures shown in Supplementary Fig. S-1), possess the anti-exonuclease activity and could synergize with RdRp inhibitors in virus replication assays. We discovered that Pibrentasvir and Ombitasvir have the highest exonuclease inhibitory activity among all the NS5A inhibitors we have tested. As an example, we show here that Pibrentasvir reduced the removal by exonuclease of immediate and delayed RNA chain terminators incorporated into the RNA. Consequently, Pibrentasvir and Ombitasvir synergistically improved the in vitro pharmacological parameters of several RdRp inhibitors, such as Sofosbuvir, Remdesivir, Tenofovir, and Favipiravir. Since all these RdRp inhibitors except Favipiravir, which is approved in Japan for influenza, are FDA approved for various viral infections, candidate combinations of the polymerase and exonuclease inhibitors identified here could be prioritized for advancement to COVID-19 clinical trials.

Results

Molecular docking study of HCV NS5A inhibitors with SARS-CoV-2 exonuclease nsp14

We performed a molecular docking study to investigate whether the HCV NS5A inhibitors (Supplementary Fig. S-1) interact with the SARS-CoV-2 exonuclease. Since a 3D structure for SARS-CoV-2 nsp14 was not yet available, we built a protein model based on the ortholog in SARS-CoV³. Superposition of the 3D structures of these two enzymes indicates that the main domains and the catalytic amino acid residues of the exonuclease active sites are structurally similar (Supplementary Fig. S-2). The clinically approved HCV NS5A inhibitors are bound to the SARS-CoV-2 nsp14 exonuclease active site with comparable docking scores (Fig. 2). The exonuclease activity requires the proper coordination of the Mg⁺⁺ ion with amino acid residues Asp-90, Glu-92, Glu-191, and Asp-273 as well as the RNA substrate. NS5A inhibitors interfere with the coordination among the Mg⁺⁺ ion, the amino acids in the nsp14 active site and the RNA 3′ terminus, likely preventing nucleotide excision from the RNA (Fig. 2).

**Fig. 2: 3D representation of the best docking poses for HCV NS5A inhibitors in the nsp14 exonuclease active site.**

Inhibition of SARS-CoV-2 exonuclease activity by HCV NS5A inhibitors to prevent the excision of immediate and delayed terminators from RNA

Using the molecular assays that we have developed previously¹⁶, we evaluated if HCV NS5A inhibitors could indeed inhibit SARS-CoV-2 exonuclease activity. We identified Pibrentasvir and Ombitasvir as two strong inhibitors of the SARS-CoV-2 exonuclease. As a proof of principle, we used Pibrentasvir to demonstrate whether such drugs can prevent excision of nucleotide analogues from RNAs terminated with the active forms of prodrugs such as Remdesivir, Sofosbuvir, Tenofovir, Favipiravir, Molnupiravir, and AT-527. These nucleotide analogues are all able to be incorporated into RNA by the SARS-CoV-2 RdRp, where they either block further polymerase extension (Remdesivir, Sofosbuvir, Tenofovir, AT-527) or induce errors in the replicated RNA (Favipiravir, Molnupiravir).

Pibrentasvir and Ombitasvir inhibit the SARS-CoV-2 exonuclease in a concentration-dependent manner, as shown in Fig. 3. RNA (sequence shown at the top of the figure) was incubated with a SARS-CoV-2 pre-assembled exonuclease complex (nsp14/nsp10) at 37 °C for 15 min in the absence (b) and presence of varying amounts of Pibrentasvir (c–e). The RNA (a) and the products of the exonuclease reaction (b–e) were analyzed by MALDI-TOF MS. The peak at 8160 Da corresponds to the intact RNA. In the absence of Pibrentasvir, exonuclease activity caused nucleotide cleavage from the 3′-end of the RNA as shown by the seven shorter fragments of lower molecular weight corresponding to stepwise cleavage of 1–7 nucleotides (b), with only ~7% intact RNA remaining (peak at 8167 Da). Pibrentasvir (1, 10, and 20 μM) reduced exonuclease activity in a concentration-dependent manner as shown by the reduced intensities of the fragmentation peaks and more prominent intact RNA peak (c–e). Ombitasvir displayed similar efficiency of exonuclease activity inhibition (Fig. 3f–i) as Pibrentasvir. Daclatasvir also exhibits inhibition of exonuclease activity, but at higher concentrations than either Pibrentasvir or Ombitasvir (Supplementary Fig. S-3).

**Fig. 3: Inhibition of SARS-CoV-2 exonuclease activity by Pibrentasvir and Ombitasvir.**

We next determined if RNA terminated with the active forms of prodrugs such as Sofosbuvir, Remdesivir, Tenofovir, Favipiravir, Molnupiravir, and AT-527 were also less likely to be excised by SARS-CoV-2 exonuclease in the presence of Pibrentasvir. We generated Sofosbuvir and Remdesivir terminated RNA by single-base extension of RNA template-loop-primers with the active triphosphate forms of Sofosbuvir and Remdesivir, respectively, using the replication complex assembled from SARS-CoV-2 nsp12 (the viral RdRp) and nsp7 and nsp8 proteins (RdRp cofactors)^11,16. The Sofosbuvir (S)-terminated RNA and Remdesivir (R)-terminated RNA (sequences shown at the top of Fig. 4) were incubated with the SARS-CoV-2 nsp14/nsp10 complex at 37 °C for 15 min in the absence (Fig. 4b, e) and presence of 20 µM Pibrentasvir (c, f). MALDI-TOF MS analysis of the intact RNAs (a, d) and the products of the exonuclease reactions (b, c, e, f) was performed. In the absence of Pibrentasvir, exonuclease activity caused nucleotide cleavage from the 3′-end of the RNA as shown by the seven shorter fragments of lower molecular weight corresponding to stepwise cleavage of 1–7 nucleotides (b, e), with a comparable reduction in the intact RNA (8178 Da for S-terminated RNA or 8209 Da for R-terminated RNA). When 20 µM Pibrentasvir was added, exonuclease activity was substantially inhibited as shown by the reduced intensities of the fragmentation peaks and increased peak heights of the intact RNAs (c, f). Thus, the SARS-CoV-2 exonuclease activity is significantly inhibited by Pibrentasvir to prevent nucleotide excision from both Sofosbuvir and Remdesivir terminated RNA. Similarly, Pibrentasvir substantially reduced excision of the nucleotide analogues derived from Favipiravir (Supplementary Fig. S-4), Molnupiravir (NHC, N⁴-hydroxycytidine, Supplementary Fig. S-5) and AT-527 (Supplementary Fig. S-6) from the 3′ terminus of RNA. In terms of base pairing, Favipiravir-RTP acts like a G or A²³, NHC-TP behaves like a C or U²⁴ and AT-9010 (the active triphosphate form of AT-527) is a G analogue²⁵. As expected, Favipiravir-RTP was incorporated into RNA opposite C or U in the template strand (Supplementary Fig. S-4), NHC-TP was incorporated opposite A or G (Supplementary Fig. S-5), and AT-9010 was incorporated opposite C (Supplementary Fig. S-6) in the template by the RdRp complex (nsp12/nsp7/nsp8). In all cases, the incorporated nucleotide analogue along with the adjacent 6–7 nucleotides were efficiently removed following incubation with the exonuclease complex (nsp14/nsp10) (Supplementary Figs. S-4b, e, S-5e, h, and S-6e). However, in the presence of 20 μM Pibrentasvir, this exonuclease activity was largely abrogated (Supplementary Figs. S-4c, f, S-5f, i, and S-6f).

**Fig. 4: Inhibition of SARS-CoV-2 exonuclease activity by Pibrentasvir for Sofosbuvir (S) and Remdesivir (R) terminated RNA.**

The nucleotide inhibitor Remdesivir exhibits delayed termination during the polymerase reaction, which has been suggested as one of the possible mechanisms for inhibiting replication of SARS-CoV-2^14,15. However, if the exonuclease is able to remove the incorporated nucleotides including Remdesivir from this delayed termination RNA product, then the inhibitory activity of Remdesivir for SARS-CoV-2 will be reduced. Therefore, we investigated whether Pibrentasvir is efficient in preventing the excision of Remdesivir from delayed Remdesivir terminated RNA through inhibiting SARS-CoV-2 exonuclease activity. In Fig. 5, the RNA product displaying delayed Remdesivir (R) termination (sequence shown at the top of the figure) was incubated with the SARS-CoV-2 nsp14/nsp10 complex at 37 °C for 15 min in the absence (e) and presence of 20 µM of Pibrentasvir (f). MALDI-TOF MS analysis of the intact RNAs (d) and the products of the exonuclease reactions (e, f) was performed. In the absence of Pibrentasvir, exonuclease activity caused cleavage of 1–11 nucleotides from the 3′-end of the RNA as shown by the lower molecular weight fragments (e). When 20 µM Pibrentasvir was added, exonuclease activity was inhibited as shown by the reduced intensities of the fragmentation peaks and the increased peak of the intact RNAs (f, 9807 Da). In Fig. 5a–c, a comparison experiment was performed with natural RNA, which produced essentially identical results. Therefore, these results indicated that the SARS-CoV-2 exonuclease activity is also significantly inhibited by Pibrentasvir to prevent nucleotide excision from RNA with delayed termination by Remdesivir.

**Fig. 5: Inhibition of SARS-CoV-2 exonuclease activity by Pibrentasvir for natural RNA and RNA with delayed termination by Remdesivir (R).**

We previously showed that Tenofovir diphosphate (Tfv-DP) can be incorporated into RNA as an obligate terminator by the SARS-CoV-2 RdRp complex¹¹. As an acyclic nucleotide, Tfv-DP lacks a normal sugar ring configuration, and thus we reasoned that it is less likely to be recognized by SARS-CoV-2 exonuclease. We, therefore, investigated whether Tfv can be removed by the exonuclease from the extended RNA. As shown in Fig. 6, Tfv-DP was incorporated into an RNA loop primer to produce the Tfv-terminated RNA (d). When incubation with the SARS-CoV-2 nsp14/nsp10 complex was carried out at 37 °C for 15 min, minimal cleavage was observed for Tfv-terminated RNA (e) relative to RNA extended with a natural A nucleotide (b), where there was substantial cleavage. When 20 µM Pibrentasvir was added, exonuclease activity was almost completely eliminated as shown by almost no fragmentation peaks and the essentially intact RNA peak (f). To directly compare the exonuclease resistance activities, we incubated both the RNA terminated with Tfv-DP and the natural RNA terminated with the A nucleotide in the same reaction tube, and compared the patterns obtained by MALDI-TOF MS (Supplementary Fig. S-7). Because these two RNAs have different molecular weights, it was straightforward to determine whether the resulting cleavage products were derived from the Tfv- or the A-terminated RNA. The results shown in Fig. 6 and Supplementary Fig. S-7 demonstrate that Tenofovir, once incorporated into RNA, is mostly resistant to excision by the SARS-CoV-2 exonuclease.

**Fig. 6: Inhibition of SARS-CoV-2 exonuclease activity by Pibrentasvir for natural RNA and Tenofovir (Tfv) terminated RNA.**

SARS-CoV-2 susceptibility to inhibition by immediate/delayed RNA chain terminators and error-prone nucleotide analogues is enhanced in Calu-3 cells by HCV NS5A inhibitors that inhibit the exonuclease

The prodrugs of RdRp inhibitors are activated by cellular enzymes to the active triphosphates. Therefore, the above enzymatic results need to be further evaluated at the cellular level, as interference in any of the activation pathways may impact the synergistic inhibitory activity described in the enzymatic assays. We evaluated if SARS-CoV-2’s in vitro susceptibility to clinically approved RdRp prodrugs could be enhanced by combining them with HCV NS5A inhibitors, which were shown to inhibit the exonuclease activity above. Calu-3 cells, which recapitulate the type II pneumocytes, cells destroyed in the course of severe COVID-19^26,27, were infected at a multiplicity of infection (MOI) of 0.1 and treated with the drugs under investigation alone or in combination. After 2–3 days, culture supernatant was harvested and titered in Vero E6 cells to quantify the infectious viruses as plaque-forming units (PFU). The NS5A inhibitors Pibrentasvir, Ombitasvir, and Daclatasvir inhibited SARS-CoV-2 replication in a dose-dependent manner (Supplementary Fig. S-8), but with lower potencies than Remdesivir (RDV) (Supplementary Table S-1). Nevertheless, anti-SARS-CoV-2 potencies of the HCV NS5A inhibitors were ~10 times higher (EC₅₀ of 0.7 μM for Pibrentasvir and 0.4 μM for Ombitasvir) compared to other repurposed RdRp inhibitors, such as Sofosbuvir (6.2 μM), Tenofovir (4.3 μM) and Favipiravir (7.8 μM) (Supplementary Table S-1).

To produce clinical benefit, inhibition of SARS-CoV-2 exonuclease by NS5A inhibitors need to enhance the anti-coronavirus activity of RdRp inhibitors by orders of magnitude. Thus, Sofosbuvir and Tenofovir (immediate terminators), RDV (a delayed chain terminator), and Favipiravir (an error-prone nucleobase) were tested at various concentrations along with the EC₂₅ of Pibrentasvir (0.1 μM), Ombitasvir (0.1 μM) and Daclatasvir (0.5 μM) and the results are listed in Table 1, which shows the resulting EC₅₀, EC₉₀, and EC₉₉ values for the RdRp inhibitors in the presence and absence of the exonuclease inhibitors. Figure 7 is a log–log plot of the concentration of RdRp inhibitor alone (or in combination with exonuclease inhibitors) vs virus production in plaque-forming units. Supplementary Fig. S-9 shows the same data using a semi-log plot of inhibitor concentration vs percent viral inhibition, for easier visualization of the inhibitor effects. Pibrentasvir improved RDV’s efficacy at the 90% and 99% levels six- and threefold, respectively (Table 1). Moreover, Pibrentasvir increased the potency of Favipiravir and Tenofovir tenfold (Table 1). Importantly Favipiravir’s EC₉₀ value (8 μM) in the presence of Pibrentasvir (Table 1) becomes lower than its threshold of plasma exposure, which has been observed to be 2.9 μg/ml (18 μM) (day 10) by Wang et al.²⁸. Ombitasvir enhanced RDV’s and Tenofovir’s activity similarly to Pibrentasvir (Table 1). For Favipiravir, Ombitasvir resulted in a 2-log₁₀ inhibition of SARS-CoV-2, reducing virus replication by 99% (Table 1, Fig. 7d, and Supplementary Fig. S-9d). Daclatasvir enhanced Sofosbuvir and Tenofovir potencies tenfold at EC₅₀, but only modestly increased RDV’s efficacy at EC₉₀ (Table 1). In the presence of Daclatasvir, Favipiravir’s virus inhibitory efficacy at the 90% level was achievable (Table 1).

Table 1 In vitro pharmacological parameters of potency and efficacy of combinations of RdRp and HCV NS5A inhibitors on SARS-CoV-2 replication in Calu-3 cells.

Full size table

**Fig. 7: Antiviral activity of combinations of SARS-CoV-2 polymerase and exonuclease inhibitors.**

To further determine if the combination of RdRp and NS5A inhibitors result in synergistic or additive effects in inhibiting SARS-CoV-2 replication, we generated combined concentration curves with these two categories of antivirals under the same experimental conditions described above. The virus inhibition results were analyzed using SynergyFinder 2.0 software²⁹, which represents synergistic, additive, and antagonistic effects as scores above 10, between 10 and −10, and below −10, respectively. The results show that Ombitasvir displayed synergistic effects with RDV (Fig. 8a), Sofosbuvir (Fig. 8b), Tenofovir (Fig. 8c), and Favipiravir (Fig. 8d). Pibrentasvir was synergistic with RDV and Favipiravir (Fig. 8a, d), whereas it displayed additive effects with Sofosbuvir and Tenofovir (Fig. 8b, c). Daclatasvir displayed an additive effect with RDV (Fig. 8a) and synergistic effects with the other RdRp inhibitors tested (Fig. 8b–d). These results demonstrate that the exonuclease inhibitory effect of NS5A inhibitors consistently enhanced the potency of prodrugs of the nucleotide analogues in the cell culture system.

**Fig. 8: Synergistic effects of combinations of RdRp and NS5A inhibitors in inhibiting SARS-CoV-2 replication.**

Discussion

We previously demonstrated that the FDA-approved HCV NS5A inhibitors, Daclatasvir and Velpatasvir, and to a lesser extent the NS5A inhibitors Elbasvir and Ledipasvir, can inhibit the SARS-CoV-2 exonuclease³⁰. Of particular interest, Daclatasvir and Velpatasvir inhibit both the SARS-CoV-2 polymerase and exonuclease^20,21. Here, we showed that two additional NS5A inhibitors, Pibrentasvir and Ombitasvir, also inhibit the exonuclease, and have the highest inhibitory activity based on our molecular assay. These compounds are predicted to interfere with the binding of the Mg⁺⁺ ion with the 3′ terminus of the RNA in the active site of the exonuclease (nsp14). The Mg⁺⁺ ion coordinates with amino acid residues Asp-90, Glu-92, Glu-191, and Asp-273 and the 3′ terminus of the RNA. Because the NS5A inhibitors interfere with this coordination, they are likely to prevent nucleotide excision from the RNA (Fig. 2). A recent in silico modeling study has suggested that Ritonavir also binds to the active site of nsp14, which led the authors to the prediction that Ritonavir may inhibit exonuclease activity³¹. We have experimentally shown (Supplementary Fig. S-10) that Ritonavir and Lopinavir, HIV protease inhibitors that make up the combination drug Kaletra, inhibit the SARS-CoV-2 exonuclease in a concentration-dependent manner, but with less potency than Pibrentasvir and Ombitasvir. Kaletra has gone through extensive clinical trials for COVID-19 but shows limited efficacy by itself^32,33. Recently, using a digital drug development approach combining artificial intelligence and experimental validation to screen drug combinations for potential combination therapy against SARS-CoV-2, it was determined that one of the most effective potential combinations was Remdesivir, Ritonavir, and Lopinavir³⁴. This synergy of Ritonavir and Lopinavir with Remdesivir may be due to the exonuclease inhibitory activity of these two drugs (Supplementary Fig. S-10).

NS5A inhibitors enhance the antiviral activity of RDV, Tenofovir, Sofosbuvir, and Favipiravir, likely due to their inhibition of exonuclease activity. The combinations of drugs described here, especially the orally available antivirals, have the potential to progress to COVID-19 clinical trials. We show that by combining Pibrentasvir or Ombitasvir with Remdesivir, Sofosbuvir, Tenofovir, or Favipiravir, higher inhibitory activity for SARS-CoV-2 was achievable at lower doses, bringing the nucleotides’ pharmacological parameters more in line with their pharmacokinetic exposures (https://pdf.hres.ca/dpd_pm/00040336.PDF)^28,35. The nucleotide inhibitors Remdesivir and Sofosbuvir are incorporated into the replicating RNA to inhibit further polymerase reaction, but they are rapidly removed by the exonuclease in the absence of exonuclease inhibitors such as Pibrentasvir and Ombitasvir. However, in the presence of these inhibitors, any nucleotide inhibitors incorporated into the RNA will not be rapidly excised by the exonuclease and their inhibitory effect on overall viral RNA replication will be substantially enhanced. Recently, the coronavirus exonuclease has also been shown to promote viral recombination which can increase the emergence of novel strains³⁶, providing additional incentive for targeting this enzyme with antivirals.

Previously, Baddock et al. screened a series of molecules for SARS-CoV-2 exonuclease activity, including Ebselen and Disulfiram, with Ebselen having the higher inhibitory activity³⁷. Ebselen and Disulfiram have multiple additional SARS-CoV-2 protein targets and Chen et al. used a combination of Ebselen/Disulfiram with Remdesivir to demonstrate a small synergistic inhibitory effect on viral replication³⁸. Recently, it has been reported that HCV nsp3/4A protease inhibitors that inhibit the SARS-CoV-2 papain-like protease synergize with Remdesivir to suppress viral replication in cell culture³⁹. In our investigation, by focusing on combinations of clinically approved drugs used during routine treatment of HIV/HCV/influenza-infected individuals, we discovered significant synergistic combinations of some of these drugs that inhibit both the SARS-CoV-2 polymerase and exonuclease activities.

Favipiravir (6-fluoro-3-hydroxy-2-pyrazinecarboxamide, Fig. 1c), a drug used to treat influenza, has been investigated for the treatment of COVID-19^40,41. It has a modified nucleobase that can base pair with both C and U. Favipiravir is converted to the active triphosphate form, Favipiravir-ribofuranosyl-5’-triphosphate (Favipiravir-RTP), by a cellular enzyme, hypoxanthine guanine phosphoribosyltransferase, and cellular kinases (Supplementary Fig. S-11). Favipiravir-RTP acts as a viral RNA polymerase inhibitor, with great potential in the treatment of a wide variety of RNA virus infections, including different strains of influenza^42,43. Favipiravir-RTP is incorporated into the growing RNA chain by the SARS-CoV-2 RdRp complex and causes C-to-U and G-to-A transitions. In a more recent study, Favipiravir was found to exhibit antiviral activity against SARS-CoV-2 via a combination of mechanisms, including slowing RNA synthesis, initiation of delayed chain termination, and lethal mutagenesis^23,40. The 3D structure of the SARS-CoV-2 RdRp complex (nsp12, nsp7, and nsp8) with the RNA substrate and Favipiravir-RTP was determined, providing insight into the mode of action of this drug^44,45. Here, we demonstrated that the excision of Favipiravir nucleotide from the 3′ end of RNA by the SARS-CoV-2 exonuclease complex is greatly reduced in the presence of Pibrentasvir (Supplementary Fig. S-4). Since Pibrentasvir and Ombitasvir inhibited the SARS-CoV-2 exonuclease proofreading activity, when these drugs are combined with Favipiravir, it is more likely that Favipiravir-induced mutations will persist and jeopardize viral replication. This is supported by our cell culture virus inhibition data indicating that the combination of Favipiravir with Ombitasvir resulted in a 2-log₁₀ inhibition, reducing virus replication by 99% (Table 1) and that NS5A inhibitors synergized with Favipiravir (Fig. 8).

N⁴-hydroxycytidine (NHC, Fig. 1e) has been shown to inhibit SARS-CoV-2 and other coronaviruses in mice and human airway epithelial cells²⁴. NHC is incorporated opposite either A or G in the template strand. Molnupiravir, which is activated to the triphosphate form (NHC-TP) by cellular enzymes, is currently in a COVID-19 clinical trial⁴⁶. Here, we showed that the excision of NHC from the 3′ end of RNA by the SARS-CoV-2 exonuclease complex is substantially reduced in the presence of Pibrentasvir (Supplementary Fig. S-5).

AT-527 (Fig. 1f), a prodrug of a guanosine nucleotide analogue with both the base and phosphate group masked, is converted by cellular enzymes to the active triphosphate form, 2’-fluoro-2’-methyl guanosine-5’-triphosphate (AT-9010, G_fm-triphosphate)²⁵. The active triphosphate form of AT-527 is structurally similar to that of Sofosbuvir with the only difference being that it has a guanine base in place of uracil. AT-527 inhibits SARS-CoV-2 by targeting both the RdRp activity and the Nidovirus RdRp-associated nucleotidyltransferase (NiRAN) activity of nsp12, which are essential for viral RNA replication and transcription⁴⁷. AT-527 is currently in COVID-19 clinical trials. Here, we demonstrated that the excision of AT-527 from the 3′ end of RNA by the SARS-CoV-2 exonuclease is largely abrogated by the exonuclease inhibitor Pibrentasvir (Supplementary Fig. S-6).

In addition, we have shown that when Tenofovir is incorporated into RNA, it is mostly resistant to excision by the SARS-CoV-2 exonuclease, which might be explained by the fact that it is an acyclic nucleotide analogue, interfering with its recognition by the exonuclease. The addition of Pibrentasvir almost completely protected the Tenofovir-terminated RNA from excision by exonuclease. The combination of NS5A inhibitors with Tenofovir also substantially increased the virus inhibition efficiency in cell culture (Table 1 and Fig. 8).

Our results from the molecular enzymatic assays and the virus cell culture inhibitory data both indicate that the use of inhibitors of the viral RdRp and the exonuclease proofreader as a combination therapy is expected to have enhanced efficacy in treating COVID-19. This combination approach may allow two-log₁₀ reduction of virus replication using concentrations consistent with approved plasma exposure. We anticipate that the various nucleotide analogue inhibitors of the SARS-CoV-2 RdRp that are in clinical trials for COVID-19 will benefit from the addition of exonuclease inhibitors.

Methods

The RdRp of SARS-CoV-2, referred to as nsp12, and its two protein cofactors, nsp7 and nsp8, shown to be required for the processive polymerase activity of nsp12, were cloned and purified as described^11,20. The 3′-exonuclease, referred to as nsp14, and its protein cofactor, nsp10, were cloned and expressed based on the SARS-CoV-2 genome sequence. Remdesivir triphosphate (RDV-TP) and NHC triphosphate were purchased from MedChemExpress (Monmouth Junction, NJ), Sofosbuvir triphosphate (SOF-TP) was purchased from Sierra Bioresearch (Tucson, AZ), Tenofovir diphosphate (Tfv-DP) was purchased from Alfa Chemistry (Ronkonkoma, NY), and Favipiravir triphosphate and AT-9010 were purchased from NuBlocks LLC (Oceanside, CA). Pibrentasvir was purchased from Cayman Chemical Company (Ann Arbor, MI) and Ombitasvir, Daclatasvir, Ritonavir and Lopinavir were purchased from Selleckchem (Houston, TX). UTP, GTP and ATP were purchased from Fisher Scientific. The RNA oligonucleotides (template-loop-primers) were purchased from Dharmacon (Horizon Discovery, Lafayette, CO).

Expression and purification of the SARS-CoV-2 exonuclease nsp14/nsp10 complex

The 3′-exonuclease, referred to as nsp14, and its protein cofactor, nsp10, were cloned and expressed based on the SARS-CoV-2 genome sequence. The pRSFDuet-1 plasmids (Novagen) encoding SARS-CoV-2 nsp14 or nsp10 engineered with an N-terminal His-SUMO tag were prepared as follows: SARS-CoV-2 RNA isolated from the supernatant of SARS-CoV-2-infected Vero E6 cells was provided by Benjamin R. tenOever⁴⁸. The portion of the RNA encoding nsp10 and nsp14 was reverse transcribed into cDNA using gene-specific primers (see below) and SuperScript III Reverse Transcriptase (Thermo Fisher). The nsp10 and nsp14 coding sequences were PCR amplified using forward and reverse gene-specific primers flanked by BamHI and XhoI recombination sites, respectively. PCR products were digested with BamHI and XhoI and subsequently ligated into BamHI and XhoI-digested pRSFDuet-His6-sumo vector and sequence verified. pRSFDuet-His6-sumo is a modified pRSFDuet-1 vector (Novagen) bearing an N-terminal His6-SUMO-tag cleavable by the ubiquitin-like protease (ULP1).

List of PCR primers used:

NSP14_pRSF_BamHI_fw

CGCGGATCCGCTGAAAATGTAACAGGACTCTTTAAA

NSP14_pRSF_XhoI_rev

CCCGCTCGAGCGGTCACTGAAGTCTTGTAAAAGTGTTCCAGAGG

RT_primer_NSP14

TTCTTGGCTATGTCAGTCATAGAACAAAC

NSP10_pRSF_BamHI_fw

CGCGGATCCGCTGGTAATGCAACAGAAGTGCCTGCC

NSP10_pRSF_XhoI_rev

CCCGCTCGAGCGGTCACTGAAGCATGGGTTCGCGGAGTTGATC

RT_primer_NSP10

GATGTTGATATGACATGGTCGTAACAGC

The nsp14 and nsp10 proteins were expressed in Escherichia coli BL21-CodonPlus(DE3)-RIL (Stratagene). The bacteria were grown in Luria–Bertani medium supplemented with 50 mg/mL kanamycin at 37 °C to an OD₆₀₀ of 0.6, and induced with 0.4 mM isopropyl β-d-1-thiogalactopyranoside and 50 μM ZnCl₂ overnight at 18 °C. Cells were collected via centrifugation at 5000×g and equal volumes of the nsp14 and nsp10 bacterial cells were then mixed for nsp14-nsp10 protein complex purification. The cells were lysed via sonication in Lysis Buffer (500 mM NaCl, 20 mM imidazole, 20 mM Tris-HCl, pH 8.0, 1 mM phenylmethylsulfonyl fluoride). After centrifugation at 40,000×g, the supernatant was loaded onto 5 mL Nickel Sepharose 6 fast flow resins (GE Healthcare) in a gravity flow column. The target protein was eluted using Lysis Buffer supplemented with 500 mM imidazole. The eluted protein was incubated with ULP1 (lab stock) during dialysis at 4 °C overnight against a buffer containing 20 mM Tris-HCl, pH 7.5, 20 mM imidazole, 150 mM NaCl, 100 µM ZnCl₂, and 5 mM β-mercaptoethanol. Then the sample was loaded onto the HisTrap FF column (GE Healthcare) to remove the His-SUMO tag, and the flow-through was collected. The target proteins were further purified through a Superdex200 10/300 gel filtration column (GE Healthcare) in a buffer containing 20 mM HEPES, pH 7.4, 150 mM NaCl, 1 mM MgCl₂, and 1 mM dithiothreitol. The fractions corresponding to the nsp14/nsp10 complex were detected by SDS-PAGE and collected. The protein sample was flash-frozen in liquid nitrogen and stored at −80 °C.

Extension reactions with SARS-CoV-2 RNA-dependent RNA polymerase complex to produce Remdesivir (RDV) and Sofosbuvir (SOF) terminated RNAs

In total, 10 µL of 10 µM RNA template-loop-primers (5′-UUUUCAUCGCGUAGUUUUCUACGCG-3′ for RDV-TP extension; 5′-UUUUCUACGCGUAGUUUUCUACGCG-3′ for SOF-TP extension) in 1 × RdRp reaction buffer was annealed by heating to 75 °C for 3 min and cooling to room temperature. In all, 5 µL of 8 µM RdRp complex (nsp12/nsp7/nsp8)^11,20 in 1× reaction buffer was added to the annealed RNA template-loop-primer solution and incubated for an additional 10 min at room temperature. Finally, 5 µL of a solution containing 0.2 mM RDV-TP or 2 mM SOF-TP in 1× reaction buffer was added, and incubation was carried out for 2 h at 30 °C. The final concentrations of reagents in the 20 µL extension reactions were 2 µM nsp12/nsp7/nsp8, 5 µM RNA template-loop-primer, 50 µM RDV-TP, and 500 µM SOF-TP. The 1× reaction buffer contains the following reagents: 10 mM Tris-HCl pH 8, 10 mM KCl, 2 mM MgCl₂ and 1 mM β-mercaptoethanol. Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ~10 µL purified aqueous RNA solutions. 1 µL of each solution was subjected to MALDI-TOF MS (Bruker ultrafleXtreme) analysis. The remaining ~9 µL extended template-loop-primer solutions were used to test exonuclease activity.

Extension reactions with Therminator II polymerase to produce AT-9010 terminated RNA

The RNA template-loop primer (5′-UUUUCUCCGCGUAGUUUUCUACGCG-3′) was annealed at 75 °C for 3 min and cooled to room temperature for 25 min in 1× ThermoPol buffer before adding the other ingredients. The final 20 µL mixture containing 5 µM of the RNA template-loop primer, 250 µM, 500 µM or 1 mM AT-9010, 2 mM MnCl₂ and 0.2 unit Therminator II in 1× ThermoPol buffer was incubated in a thermal cycler using the following protocol (28 cycles of 45 °C for 30 s, 55 °C for 30 s, 65 °C for 30 s). Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ~10 µL purified aqueous RNA solutions. 1 µL of each solution was subjected to MALDI-TOF MS (Bruker ultrafleXtreme) analysis. The remaining ~9 µL extended template-loop-primer solutions were used to test exonuclease activity.

Extension reactions with SARS-CoV-2 RNA-dependent RNA polymerase to produce Favipiravir or NHC terminated RNAs

In all, 10 µL of 10 µM RNA template-loop-primers (5′-UUUUCAUCGCGUAGUUUUCUACGCG-3′ for Fav-RTP extension opposite U; 5′-UUUUCACCGCGUAGUUUUCUACGCG-3′ for Fav-RTP extension opposite C; 5′-UUUUCUACGCGUAGUUUUCUACGCG-3′ for NHC-TP extension opposite A; 5′-UUUUCUGCGCGUAGUUUUCUACGCG-3′ for NHC-TP extension opposite G) in 1 × RdRp reaction buffer was annealed by heating to 75 °C for 3 min and cooling to room temperature. 5 µL of 12 µM RdRp complex (nsp12/nsp7/nsp8)^11,20 in 1× reaction buffer was added to the annealed RNA template-loop-primer solution and incubated for an additional 10 min at room temperature. Finally, 5 µL of a solution containing ~2 mM Fav-RTP or 0.4 mM NHC in 1× reaction buffer was added and incubation was carried out for 3 h at 30 °C. The final concentrations of reagents in the 20 µL extension reactions were 3 µM nsp12/nsp7/nsp8, 5 µM RNA template-loop-primer and ~500 µM Fav-RTP or 100 µM NHC-TP. The 1× reaction buffer contains the following reagents: 10 mM Tris-HCl pH 8, 10 mM KCl, 2 mM MgCl₂, and 1 mM β-mercaptoethanol. Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ~10 µL purified aqueous RNA solutions. In all, 1 µL of each solution was subjected to MALDI-TOF MS (Bruker ultrafleXtreme) analysis. The remaining ~9 µL extended template-loop-primer solutions were used to test exonuclease activity.

Extension reactions with reverse transcriptase to produce Tenofovir (Tfv) terminated RNAs

The RNA template-loop primer (5′-UUUUCAUCGCGUAGUUUUCUACGCG-3′) was annealed at 75 °C for 3 min and cooled to room temperature for 25 min before adding the remaining ingredients. The final 20 µL mixture containing 5 µM of the RNA template-loop primer, 500 µM Tenofovir-DP and 200 units Superscript IV Reverse Transcriptase in 1× reaction buffer (50 mM Tris-HCl (pH 8.3), 4 mM MgCl₂, 10 mM DTT, 50 mM KCl) was incubated at 45 °C for 3 h. Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ~10 µL purified aqueous RNA solutions. In total, 1 µL of each solution was subjected to MALDI-TOF MS (Bruker ultrafleXtreme) analysis. The remaining ~9 µL extended template-loop-primer solutions were used to test exonuclease activity.

Extension reactions with SARS-CoV-2 RNA-dependent RNA polymerase to produce Remdesivir (RDV) delayed terminated RNA

In all, 10 µL of 10 µM RNA template-loop-primers (5′-UUUUUACAUCGCGUAGUUUUCUACGCG-3′ for RDV-TP + UTP extension) in 1 × RdRp reaction buffer was first annealed by heating to 75 °C for 3 min and cooling to room temperature. In total, 5 µL of 8 µM RdRp complex (nsp12/nsp7/nsp8)^11,20 in 1 × reaction buffer was added to the annealed RNA template-loop-primer solution and incubated for an additional 10 min at room temperature. In all, 5 µL of a solution containing 0.2 mM RDV-TP and 0.2 mM UTP in 1× reaction buffer was added and incubation was carried out for 1 h at 30 °C. The final concentrations of reagents in the 20 µL extension reactions were 2 µM nsp12/nsp7/nsp8, 5 µM RNA template-loop-primer, 50 µM RDV-TP, and 50 µM UTP. The composition of 1× reaction buffer was as described above. Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ~10 µL purified aqueous RNA solutions. In all, 1 µL of each solution was subjected to MALDI-TOF MS (Bruker ultrafleXtreme) analysis. The remaining ~9 µL extended template-loop-primer solutions were used for the second extension reaction.

Then, 10 µL of ~16 µM Remdesivir (R) and uridine extended RNA template-loop-primers (5′-UUUUUACAUCGCGUAGUUUUCUACGCGRU-3′ for second extension) in 1× RdRp reaction buffer was annealed by heating to 75 °C for 3 min and cooling to room temperature. 5 µL of 8 µM RdRp complex (nsp12/nsp7/nsp8)^11,20 in 1× reaction buffer was added to the annealed RNA template-loop-primer solution and incubated for an additional 10 min at room temperature. In all, 5 µL of a solution containing 80 µM GTP and 80 µM UTP in 1× reaction buffer was added and incubation was carried out for 1 h at 30 °C. The final concentrations of reagents in the 20 µL extension reactions were 2 µM nsp12/nsp7/nsp8, ~4 µM RNA template-loop-primer, 20 µM GTP, and 20 µM UTP. The composition of 1 × reaction buffer was as described above. Desalting of the reaction mixture was performed with an Oligo Clean & Concentrator kit (Zymo Research) resulting in ~10 µL purified aqueous RNA solutions. 1 µL of each solution was subjected to MALDI-TOF MS (Bruker ultrafleXtreme) analysis. The remaining ~9 µL extended template-loop-primer solutions were used to test exonuclease activity.

SARS-CoV-2 exonuclease reactions in the presence and absence of Pibrentasvir, Ombitasvir, Daclatasvir, Ritonavir, and Lopinavir

The U-terminated RNA, A-terminated RNA, G-terminated RNA, the Remdesivir (RDV), Sofosbuvir (SOF), Favipiravir (Fav), N⁴-hydroxycytidine (Nhc), AT-9010 and Tenofovir (Tfv) terminated RNAs, as well as the RDV delayed terminated RNA products from above, were annealed by heating to 75 °C for 3 min and cooling to room temperature in 1× exonuclease reaction buffer. To a 14 µL solution of 71.4 nM exonuclease complex (nsp14/nsp10) in 1× exonuclease reaction buffer, 1 µL of DMSO with or without various concentrations of Pibrentasvir was added and incubated for 15 min at room temperature. Then, 5 µL of the annealed RNA (2 µM) in 1× exonuclease reaction buffer was added to the exonuclease/Pibrentasvir mixture and incubated at 37 °C for 15 min. The final concentrations of reagents in the 20 µL reactions were 50 nM nsp14/nsp10, 500 nM RNA, 0-20 µM Pibrentasvir and 5% DMSO. The 1× exonuclease reaction buffer contains the following reagents: 40 mM Tris-HCl pH 8, 1.5 mM MgCl₂, and 5 mM DTT. After incubation for 15 min, each reaction was quenched by adding 2.2 µL of an aqueous solution of EDTA (100 mM). Following desalting using an Oligo Clean & Concentrator (Zymo Research), the samples were subjected to MALDI-TOF MS (Bruker ultrafleXtreme) analysis. SARS-CoV-2 exonuclease reactions in the presence of Ombitasvir, Daclatasvir, Ritonavir, and Lopinavir were conducted analogously to the experiments with Pibrentasvir.

Comparison of SARS-CoV-2 exonuclease reaction for Tenofovir-terminated RNA with natural RNA

The A-terminated RNA (2 µM) and Tenofovir extended RNA (2 µM) (sequences shown in Supplementary Fig. S-4) were annealed by heating to 75 °C for 3 min and cooling to room temperature in 1× exonuclease reaction buffer. After annealing, the two RNAs were mixed in equal volumes. To a 10 µL solution of 100 nM exonuclease complex (nsp14/nsp10) in 1× exonuclease reaction buffer, 10 µL annealed RNA mixture (1 µM each) was added and incubated at 37 °C for 15 min. The final concentrations of reagents in the 20 µL reactions were 50 nM nsp14/nsp10, ~500 nM A-terminated RNA and ~500 nM Tenofovir-terminated RNA. After incubation for 15 min, each reaction was quenched by adding 2.2 µL of an aqueous solution of EDTA (100 mM). Following desalting using an Oligo Clean & Concentrator (Zymo Research), the samples were subjected to MALDI-TOF MS (Bruker ultrafleXtreme) analysis.

Molecular docking procedure

The chemical structures for Pibrentasvir, Ombitasvir, Elbasvir, Daclatasvir, Ledipasvir, and Velpatasvir (Supplementary Fig. S-1) were obtained from PubChem (https://pubchem.ncbi.nlm.nih.gov/) and minimized in terms of energy by Density Functional Theory (DFT), with the Becke-3-Lee Yang Parr (B3LYP) method and the standard 6-31 G* basis set, available in Spartan’18 software (Wavefunction, Inc., Irvine, USA) (https://www.wavefun.com/). Since the 3D structure for the SARS-CoV-2 nsp14 exonuclease was not available, a structural model was built via the online tool Swiss Model software (University of Basel, Basel, Switzerland) (https://swissmodel.expasy.org/) using the crystallographic structure of SARS-CoV nsp14 as a template (Protein Data Bank (PDB) code: 5C8T)⁴⁹ and the following SARS-CoV-2 nsp14 amino acid sequence:

AENVTGLFKDCSKVITGLHPTQAPTHLSVDTKFKTEGLCVDIPGIPKDMTYRRLISMMGFKMNYQVNGYPNMFITREEAIRHVRAWIGFDVEGCHATREAVGTNLPLQLGFSTGVNLVAVPTGYVDTPNNTDFSRVSAKPPPGDQFKHLIPLMYKGLPWNVVRIKIVQMLSDTLKNLSDRVVFVLWAHGFELTSMKYFVKIGPERTCCLCDRRATCFSTASDTYACWHHSIGFDYVYNPFMIDVQQWGFTGNLQSNHDLYCQVHGNAHVASCDAIMTRCLAVHECFVKRVDWTIEYPIIGDELKINAACRKVQHMVVKAALLADKFPVLHDIGNPKAIKCVPQADVEWKFYDAQPCSDKAYKIEELFYSYATHSDKFTDGVCLFWNCNVDRYPANSIVCRFDTRVLSNLNLPGCDGGSLYVNKHAFHTPAFDKSAFVNLKQLPFFYYSDSPCESHGKQVVSDIDYVPLKSATCITRCNLGGAVCRHHANEYRLYLDAYNMMISAGFSLWVYKQFDTYNLWNTFTRLQ(NCBI RefSeq YP_009725309.1)⁵⁰. About five models were generated based on the standard “auto model” routine of Swiss Model software. The best-modeled structure was chosen according to the Qualitative Model Energy Analysis (QMEAN) and Global Model Quality Estimation (GMQE) values.

The molecular docking calculations were performed using GOLD 2020.2 software (Cambridge Crystallographic Data Centre, Cambridge, UK) (https://www.ccdc.cam.ac.uk/solutions/csd-discovery/components/gold/). Hydrogen atoms were added to the protein structure according to the data inferred by software on the ionization and tautomeric states. Since there are no crystallographic structures for drugs associated with SARS-CoV-2 nsp14 exonuclease, the standard function ChemPLP was used for the molecular docking calculations, selecting an 8 and 10 Å radius spherical cavity around the active binding site. The figures for the docking poses of the largest docking score value were generated with PyMOL Delano Scientific LLC software (Schrödinger, New York, USA) (https://www.pymol.org/2/).

Cells and virus

African green monkey kidney cells (Vero, subtype E6) and the human lung epithelial cell line (Calu-3 cells) were cultured in high glucose DMEM and low glucose DMEM medium, both complemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in a humidified atmosphere with 5% CO₂. SARS-CoV-2 was prepared in Vero E6 cells at a MOI of 0.01. Originally, the isolate was obtained from a nasopharyngeal swab from a confirmed case in Rio de Janeiro, Brazil (GenBank #MT710714; Institutional Review Broad approval, 30650420.4.1001.0008). All procedures related to virus culture were handled in a Biosafety Level 3 (BSL3) multiuser facility according to WHO guidelines. Virus titers were determined as PFU/mL. Virus stocks were kept in −80 °C freezers.

Cytotoxicity assay

Monolayers of 1.5 × 10⁴ cells in 96-well plates were treated for 3 days with various concentrations (semi-log dilutions from 1000 to 10 µM) of the antiviral drugs. Then, 5 mg/ml 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) in DMEM was added to the cells in the presence of 0.01% N-methyl dibenzopyrazine methyl sulfate (PMS). After incubating for 4 h at 37 °C, the cells were measured in a spectrophotometer at 492 nm and 620 nm. The 50% cytotoxic concentration (CC₅₀) was calculated by a nonlinear regression analysis of the dose-response curves.

Yield-reduction assay

Calu-3 cells (5 × 10⁵ cells/well) in 48-well plates were infected at a MOI of 0.1 for 1 h at 37 °C. The cells were washed, and various concentrations of compounds were added to DMEM with 10% FBS. Forty-eight to seventy-two hours supernatants were collected and the harvested virus was quantified as PFU/mL by titering in Vero E6 cells. A variable slope nonlinear regression analysis of the dose-response curves was performed to calculate the concentration at which each drug inhibited the virus production by 50% (EC₅₀), 90% (EC₉₀), and 99% (EC₉₉). Analysis of drug combinations were performed using SynergyFinder 2.0 software²⁹ with the HSA method, in which the percentage of inhibition was plotted for curves of drugs alone and in combination.

Virus titration

Monolayers of Vero E6 cells (2 × 10⁴ cells/well) in 96-well plates were infected with serial dilutions of supernatants containing SARS-CoV-2 for 1 h at 37 °C. Fresh semi-solid medium containing 2.4% CMC was added and the culture was maintained for 72 h at 37 °C. Cells were fixed with 10% formalin for 2 h at room temperature and then stained with crystal violet (0.4%). Plaque numbers were scored in at least three replicates per dilution by independent readers, who were blinded with respect to the source of the supernatant. The virus titers were determined as PFU/mL.

Statistical analysis

The assays were performed blinded by one professional, codified, and then read by another professional. All experiments were carried out at least three independent times, including a minimum of two technical replicates in each assay. The dose-response curves used to calculate pharmacological parameters were generated by variable slope plot from Prism GraphPad software 8.0. The equations to fit the best curve were generated based on R² values ≥0.9. Statistical significance differences, with P values <0.05, were assessed using Student’s t tests to compare the pharmacological parameter values in the presence of RNA polymerase inhibitors alone and combined with HCV NS5A inhibitors.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availability

All data associated with graphs and tables are available in Supplementary Data 1 and 2.

References

Zhu, N. et al. A novel coronavirus from patients with pneumonia in China, 2019. N. Eng. J. Med. 382, 727–733 (2020).
Article CAS Google Scholar
V’kovski, P. et al. Coronavirus biology and replication: implications for SARS-CoV-2. Nat. Rev. Microbiol. 19, 155–170 (2021).
Article PubMed Google Scholar
Shannon, A. et al. Remdesivir and SARS-CoV-2: structural requirements at both nsp12 RdRp and nsp14 exonuclease active-sites. Antivir. Res. 178, 104793 (2020).
Article CAS PubMed Google Scholar
Kirchdoerfer, R. N. & Ward, A. B. Structure of the SARS-CoV nsp12 polymerase bound to nsp7 and nsp8 co-factors. Nat. Commun. 10, 2342 (2019).
Article PubMed PubMed Central Google Scholar
Gao, Y. et al. Structure of the RNA-dependent RNA polymerase from COVID-19 virus. Science 368, 779–782 (2020).
Article CAS PubMed PubMed Central Google Scholar
Hillen, H. S. et al. Structure of replicating SARS-CoV-2 polymerase. Nature 584, 154–156 (2020).
Article CAS PubMed Google Scholar
Bouvet, M. et al. RNA 3′-end mismatch excision by the severe acute respiratory syndrome coronavirus nonstructural protein nsp10/nsp14 exoribonuclease complex. Proc. Natl Acad. Sci. USA 109, 9372–9377 (2012).
Article CAS PubMed PubMed Central Google Scholar
Ju, J. et al. Nucleotide analogues as inhibitors of viral polymerases. Preprint at bioRXiv https://doi.org/10.1101/2020.01.30.927574 (2020).
Ju, J. et al. Nucleotide analogues as inhibitors of SARS-CoV polymerase. Pharmacol. Res. Perspect. 8, e00674 (2020).
Article CAS PubMed PubMed Central Google Scholar
Jockusch, S. et al. A library of nucleotide analogues terminate RNA synthesis catalyzed by polymerases of coronaviruses that cause SARS and COVID-19. Antivir. Res. 180, 104857 (2020).
Article CAS PubMed Google Scholar
Chien, M. et al. Nucleotide analogues as inhibitors of SARS-CoV-2 polymerase, a key drug target for COVID-19. J. Proteome Res. 19, 4690–4697 (2020).
Article CAS PubMed PubMed Central Google Scholar
Sadeghi, A. et al. Sofosbuvir and daclatasvir compared with standard of care in the treatment of patients admitted to hospital with moderate or severe coronavirus infection (COVID-19): a randomized controlled trial. J. Antimicrob. Chemother. 75, 3379–3385 (2020).
Article CAS PubMed Google Scholar
Vicenti, I., Zazzi, M. & Saladini, F. SARS-CoV-2 RNA-dependent RNA polymerase as a therapeutic target for COVID-19. Expert Opin. Ther. Pat. 31, 325–337 (2021).
Article CAS PubMed Google Scholar
Gordon, C. J. et al. Remdesivir is a direct-acting antiviral that inhibits RNA-dependent RNA polymerase from severe acute respiratory syndrome coronavirus 2 with high potency. J. Biol. Chem. 295, 6785–6797 (2020).
Article CAS PubMed PubMed Central Google Scholar
Bravo, J. P. K., Dangerfield, T. L., Taylor, D. W. & Johnson, K. A. Remdesivir is a delayed translocation inhibitor of SARS-CoV-2 replication. Molec. Cell 81, 1548–1552 (2021).
Article CAS PubMed Google Scholar
Jockusch, S. et al. Sofosbuvir terminated RNA is more resistant to SARS-CoV-2 proofreader than RNA terminated by remdesivir. Sci. Rep. 10, 16577 (2020).
Article CAS PubMed PubMed Central Google Scholar
Khater, S. et al. Combining SARS-CoV-2 proofreading exonuclease and RNA-dependent RNA polymerase inhibitors as a strategy to combat COVID-19: a high-throughput in silico screen. Front. Microbiol. 12, 647693 (2021).
Article PubMed PubMed Central Google Scholar
Smith, M. A., Regal, R. E. & Mohammad, R. A. Daclatasvir: a NS5A replication complex inhibitor for hepatitis C infection. Ann. Pharmacother. 50, 39–46 (2016).
Article CAS PubMed Google Scholar
Gordon, D. E. et al. A SARS-CoV-2 protein- interaction map reveals targets for drug repurposing. Nature 583, 459–468 (2020).
Article CAS PubMed PubMed Central Google Scholar
Sacramento, C. et al. In vitro antiviral activity of the anti-HCV drugs daclatasvir and sofosbuvir against SARS-CoV-2, the aetiological agent of COVID-19. J. Antimicrob. Chemother. 76, 1874–1885 (2021).
Article CAS PubMed Google Scholar
Sanders, R. Can hepatitis C drugs help remdesivir fight COVID-19? https://news.berkeley.edu/2021/02/03/can-hepatitis-c-drugs-help-remdesiver-fight-covid-19/ (2021).
Nguyenla, X. et al. Discovery of SARS-CoV-2 antiviral synergy between remdesivir and approved drugs in human lung cells. Preprint at bioRxiv https://doi.org/10.1101/2020.09.18.302398 (2020).
Shannon, A. et al. Rapid incorporation of favipiravir by the fast and permissive viral RNA polymerase complex results in SARS-CoV-2 lethal mutagenesis. Nat. Commun. 11, 4682 (2020).
Article PubMed PubMed Central Google Scholar
Sheahan, T. R. et al. An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice. Sci. Transl. Med. 12, eabb5883 (2020).
Article CAS PubMed Google Scholar
Good, S. S. et al. AT-527, a double prodrug of a guanosine nucleotide analog, is a potent inhibitor of SARS-CoV-2 in vitro and a promising oral antiviral for treatment of COVID-19. Antimicrob. Agents Chemother. 65, e02479–20 (2021).
Article CAS PubMed PubMed Central Google Scholar
Chu, H. et al. Comparative replication and immune activation profiles of SARS-CoV-2 and SARS-CoV in human lungs: an ex vivo study with implications for the pathogenesis of COVID-19. Clin. Infect. Dis. 71, 1400–1409 (2020).
Article CAS PubMed Google Scholar
Chu, H. et al. Comparative tropism, replication kinetics, and cell damage profiling of SARS-CoV-2 and SARS-CoV with implications for clinical manifestations, transmissibility, and laboratory studies of COVID-19: an observational study. Lancet Microbe 1, e14–e23 (2020).
Article CAS PubMed PubMed Central Google Scholar
Wang, Y. et al. Phase 2a, open-label, dose-escalating, multi-center pharmacokinetic study of favipiravir (T-705) in combination with oseltamivir in patients with severe influenza. EBioMedicine 62, 103125 (2020).
Article PubMed PubMed Central Google Scholar
Ianevski, A., Giri, A. K. & Aittokallio, T. SynergyFinder 2.0: visual analytics of multi-drug combination synergies. Nucl. Acids Res. 48, W488–W493 (2020).
Article CAS PubMed PubMed Central Google Scholar
Ju, J. et al. Therapeutics for COVID-19. PCT patent application WO 2021155119 (A2). (2021).
Narayanan, N. & Nair, D. T. Ritonavir may inhibit exoribonuclease activity of nsp14 from the SARS-CoV-2 virus and potentiate the activity of chain terminating drugs. Int. J. Biol. Macromol. 168, 272–278 (2021).
Article CAS PubMed Google Scholar
Cao, B. et al. A trial of Lopinavir–Ritonavir in adults hospitalized with severe Covid-19. N. Engl. J. Med. 382, 1787–1799 (2020).
Article PubMed Google Scholar
Essam, A. Comparison of remdesivir versus lopinavir/ritonavir and remdesivir combination in COVID-19 patients. https://clinicaltrials.gov/ct2/show/NCT04738045 (2021).
Blasiak, A. et al. IDentif.AI: rapidly optimizing combination therapy design against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) with digital drug development. Bioeng. Transl. Med. 6, e10196 (2020).
PubMed PubMed Central Google Scholar
Humeniuk, R. Safety tolerability, and pharmacokinetics of Remdesivir, an antiviral for treatment of COVID-19, in healthy subjects. Clin. Transl. Sci. 13, 896–906 (2020).
CAS PubMed PubMed Central Google Scholar
Gribble, J. et al. The coronavirus proofreading exoribonuclease mediates extensive viral recombination. PLoS Pathog. 17, e1009226 (2021).
Article CAS PubMed PubMed Central Google Scholar
Baddock, H. T. et al. Characterization of the SARS-CoV-2 ExoN (nsp14^ExoN-nsp10) complex: implications for its role in viral genome stability and inhibitor identification. Nucl. Acids Res. https://doi.org/10.1093/nar/gkab1303 (2022).
Chen, T. et al. Synergistic inhibition of SARS-CoV-2 replication using disulfiram/ebselen and remdesivir. ACS Pharmacol. Transl. Sci. 4, 898–907 (2021).
Article CAS PubMed PubMed Central Google Scholar
Bafna, K. et al. Hepatitis C virus drugs that inhibit the SARS-CoV-2 papain-like protease synergize with Remdesivir to suppress viral replication in cell culture. Cell Rep. 35, 109133 (2021).
Article CAS PubMed PubMed Central Google Scholar
Driouich, J. S. et al. Favipiravir antiviral efficacy against SARS-CoV-2 in a hamster model. Nat. Comm. 12, 1735 (2021).
Article CAS Google Scholar
Agrawal, U., Raju, R. & Udwadia, Z. F. Favipiravir: a new and emerging antiviral option in COVID-19. Med. J. Armed Forces India 76, 370–376 (2020).
Article Google Scholar
Furuta, Y. et al. Favipiravir (T-705), a novel viral polymerase inhibitor. Antivir. Res. 100, 446–454 (2013).
Article CAS PubMed Google Scholar
Furuta, Y. et al. Favipiravir (T-705), a broad-spectrum inhibitor of viral RNA polymerase. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 93, 449–463 (2017).
Article CAS PubMed PubMed Central Google Scholar
Naydenova, K. et al. Structure of the SARS-CoV-2 RNA-dependent RNA polymerase in the presence of favipiravir-RTP. Proc. Natl. Acad. Sci. USA. 118, e2021946118 (2021).
Article CAS PubMed PubMed Central Google Scholar
Peng, Q. et al. Structural basis of SARS-CoV-2 polymerase inhibition by favipiravir. Innov. N. Y. 2, 100080 (2021).
Google Scholar
Jayk Bernal, A. et al. Molnupiravir for Oral Treatment of Covid-19 in Nonhospitalized Patients. N. Engl. J. Med. 386, 509–520 (2022).
Article PubMed Google Scholar
Shannon, A. et al. A dual mechanism of action of AT-527 against SARS-CoV-2 polymerase. Nat. Commun. 13, 621 (2022).
Article CAS PubMed PubMed Central Google Scholar
Blanco-Melo, D. et al. Imbalanced host response to SARS-CoV-2 drives development of COVID-19. Cell 181, 1036–1045 (2020).
Article CAS PubMed PubMed Central Google Scholar
Ma, Y. et al. Structural basis and functional analysis of the SARS coronavirus nsp14–nsp10 complex. Proc. Natl. Acad. Sci. USA. 112, 9436–9441 (2015).
Article CAS PubMed PubMed Central Google Scholar
Brister, J., Ako-Adjei, D., Bao, Y. & Blinkova, O. NCBI viral genomes resource. Nucl. Acids Res. 43, D571–D577 (2015).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

This work was supported by the Jack Ma Foundation, a gift from Columbia Engineering Member of the Board of Visitors Dr. Bing Zhao, and Fast Grants (to Jingyue Ju), the Maloris Foundation and the Memorial Sloan-Kettering Core Grant (P30CA008748) (to Dinshaw J. Patel), a grant from The JPB Foundation to Rockefeller University (to Thomas Tuschl). Funding was also provided by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq, 441019/2020-0, 307162/2017-6), Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ, E-26/210.182/2020, E-26/201.067/2021, E-26/210.112/2020) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior - Brasil (CAPES) - Finance Code 001 (to Thiago Moreno L. Souza and Patricia T. Bozza). CNPq, CAPES and FAPERJ also support the National Institutes of Science and Technology Program (INCT-IDPN, 465313/2014-0). Oswaldo Cruz Foundation/FIOCRUZ supports this study under the auspices of the Inova Program (B3-Bovespa funding, VGPDI-032-ARVC-20) (to Thiago Moreno L. Souza). Dr. Andre Sampaio from Farmanguinhos, platform RPT11M, is acknowledged for kindly donating the Calu-3 cells. We thank Dr. Andrew Owen from the University of Liverpool for insightful discussions.

Author information

These authors contributed equally: Xuanting Wang, Carolina Q. Sacramento, Steffen Jockusch.
These authors jointly supervised this work: Thiago Moreno L. Souza, Jingyue Ju.

Authors and Affiliations

Center for Genome Technology and Biomolecular Engineering, Columbia University, New York, NY, 10027, USA
Xuanting Wang, Steffen Jockusch, Chuanjuan Tao, Minchen Chien, Xiaoxu Li, Shiv Kumar, James J. Russo & Jingyue Ju
Department of Chemical Engineering, Columbia University, New York, NY, 10027, USA
Xuanting Wang, Chuanjuan Tao, Minchen Chien, Xiaoxu Li, Shiv Kumar, James J. Russo & Jingyue Ju
Laboratory of Immunopharmacology, Oswaldo Cruz Institute (IOC), Oswaldo Cruz Foundation (Fiocruz), Rio de Janeiro, RJ, Brazil
Carolina Q. Sacramento, Otávio Augusto Chaves, Natalia Fintelman-Rodrigues, Patrícia T. Bozza & Thiago Moreno L. Souza
National Institute for Science and Technology for Innovation on Diseases of Neglected Population (INCT/IDPN), Center for Technological Development in Health (CDTS), Oswaldo Cruz Foundation (Fiocruz), Rio de Janeiro, RJ, Brazil
Carolina Q. Sacramento, Otávio Augusto Chaves, Natalia Fintelman-Rodrigues & Thiago Moreno L. Souza
Department of Chemistry, Columbia University, New York, NY, 10027, USA
Steffen Jockusch
Laboratory on Thymus Research, Oswaldo Cruz Institute (IOC), Oswaldo Cruz Foundation (Fiocruz), Rio de Janeiro, RJ, Brazil
Jairo R. Temerozo
National Institute for Science and Technology on Neuroimmunomodulation (INCT/NIM), Oswaldo Cruz Institute (IOC), Oswaldo Cruz Foundation (Fiocruz), Rio de Janeiro, RJ, Brazil
Jairo R. Temerozo
Laboratory of Structural Biology, Memorial Sloan-Kettering Cancer Center, New York, NY, 10065, USA
Wei Xie & Dinshaw J. Patel
Laboratory of RNA Molecular Biology, Rockefeller University, New York, NY, 10065, USA
Cindy Meyer, Aitor Garzia & Thomas Tuschl
Department of Molecular Pharmacology and Therapeutics, Columbia University, New York, NY, 10032, USA
Jingyue Ju

Authors

Xuanting Wang
View author publications
You can also search for this author in PubMed Google Scholar
Carolina Q. Sacramento
View author publications
You can also search for this author in PubMed Google Scholar
Steffen Jockusch
View author publications
You can also search for this author in PubMed Google Scholar
Otávio Augusto Chaves
View author publications
You can also search for this author in PubMed Google Scholar
Chuanjuan Tao
View author publications
You can also search for this author in PubMed Google Scholar
Natalia Fintelman-Rodrigues
View author publications
You can also search for this author in PubMed Google Scholar
Minchen Chien
View author publications
You can also search for this author in PubMed Google Scholar
Jairo R. Temerozo
View author publications
You can also search for this author in PubMed Google Scholar
Xiaoxu Li
View author publications
You can also search for this author in PubMed Google Scholar
Shiv Kumar
View author publications
You can also search for this author in PubMed Google Scholar
Wei Xie
View author publications
You can also search for this author in PubMed Google Scholar
Dinshaw J. Patel
View author publications
You can also search for this author in PubMed Google Scholar
Cindy Meyer
View author publications
You can also search for this author in PubMed Google Scholar
Aitor Garzia
View author publications
You can also search for this author in PubMed Google Scholar
Thomas Tuschl
View author publications
You can also search for this author in PubMed Google Scholar
Patrícia T. Bozza
View author publications
You can also search for this author in PubMed Google Scholar
James J. Russo
View author publications
You can also search for this author in PubMed Google Scholar
Thiago Moreno L. Souza
View author publications
You can also search for this author in PubMed Google Scholar
Jingyue Ju
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

X.W., C.Q.S., S.J., O.A.C, C.T., N. F.-R., M.C., J.R.T., W.X., C.M., and A.G. performed the experiments. X.W., C.Q.S., S.J., C.T., N.F.-R., M.C., J.R.T., P.T.B., X.L., S.K., J.J.R., T.M.L.S., and J.J. analyzed the data. X.W., C.Q.S., S.J., C.T., M.C., J.R.T., X.L., S.K., P.T.B., J.J.R., T.M.L.S., and J.J. prepared the manuscript. C.Q.S., D.J.P., T.T., T.M.L.S., and J.J. conceptualized the experiments.

Corresponding authors

Correspondence to Thiago Moreno L. Souza or Jingyue Ju.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Communications Biology thanks Steve Polyak and Rashed Noor for their contribution to the peer review of this work. Primary Handling Editors: Deborah Fuller, Karli Montague-Cardoso and Brooke LaFlamme.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data 1

Supplementary Data 2

Reporting Summary

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Wang, X., Sacramento, C.Q., Jockusch, S. et al. Combination of antiviral drugs inhibits SARS-CoV-2 polymerase and exonuclease and demonstrates COVID-19 therapeutic potential in viral cell culture. Commun Biol 5, 154 (2022). https://doi.org/10.1038/s42003-022-03101-9

Download citation

Received: 04 August 2021
Accepted: 02 February 2022
Published: 22 February 2022
DOI: https://doi.org/10.1038/s42003-022-03101-9

This article is cited by

COVID-19 drug discovery and treatment options
- Jasper Fuk-Woo Chan
- Shuofeng Yuan
- Kwok-Yung Yuen
Nature Reviews Microbiology (2024)
In Vitro Study of the Cytotoxic and Immunotropic Effects of Molnupiravir and Favipiravir
- E. P. Brodovskaya
- K. Ya. Zaslavskaya
- N. A. Pyataev
Pharmaceutical Chemistry Journal (2024)
Synthesis of indole-based ferulic acid derivatives and in vitro evaluation of antiviral activity against SARS-CoV-2
- Marina Mol S. A. Verzola
- Daisymara Priscila de Almeida Marques
- Renata Barbosa de Oliveira
Medicinal Chemistry Research (2023)
Preclinical development of kinetin as a safe error-prone SARS-CoV-2 antiviral able to attenuate virus-induced inflammation
- Thiago Moreno L. Souza
- Vagner D. Pinho
- Jaime A. Rabi
Nature Communications (2023)
Seven classes of antiviral agents
- Aleksandr Ianevski
- Shahzaib Ahmad
- Denis E. Kainov
Cellular and Molecular Life Sciences (2022)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.