Introduction

The marbled crayfish (Procambarus virginalis) is a novel parthenogenetically reproducing freshwater crayfish species s1,2. The animals were originally introduced into Germany in 1995, as an ornamental aquarium pet from the USA2, and then became rapidly distributed through the aquarium trade1,3. Following anthropogenic releases, P. virginalis has now formed large colonies in diverse habitats across Europe4,5. In addition, the animals are widely distributed in the freshwater networks of Madagascar6,7,8 where they are increasingly exploited as a source of nutritional protein for human consumption9,10.

Microsatellite analyses suggested a genetically uniform pattern for all P. virginalis analyzed11,12. Furthermore, cytogenetic analyses uncovered a defective first meiotic division and a triploid karyotype13,14. These findings, in combination with the absence of detectable recombination5 suggested that the animals reproduce by apomictic parthenogenesis, thus generating genetically uniform offspring. The recently completed first draft assembly of the P. virginalis genome8 revealed a relatively large (3.5 Gb) genome with a triploid AAB genotype, consistent with earlier observations14,15. Comparative genome sequencing of numerous specimens from diverse sources and locations confirmed that the global P. virginalis population is largely monoclonal with only very limited genetic differences between geographically separated populations2,5,8. This monoclonality can be reasonably explained by a recent founder event involving a single animal. The identity of this foundational animal has remained largely unknown.

Based on morphological and genetic markers, the slough crayfish (Procambarus fallax) has been suggested as the parent species of P. virginalis16. Procambarus fallax are sexually reproducing diploids that are endemic to peninsular Florida and southern Georgia17. While P. virginalis appears to have diverged from P. fallax as recently as 25 years ago2,15, the genetic, phylogeographic, and mechanistic origin of the species has remained unresolved, resulting in the perception that marbled crayfish are enigmatic “mutants”. Based on genetic analyses, it has been suggested that P. virginalis may have arisen by a captive pairing of distantly related P. fallax parents, perhaps from different parts of the geographic range8. Another possibility is that P. virginalis represents a naturally occurring form of P. fallax that was isolated and propagated through the aquarium trade. Based on current knowledge, it is not possible to distinguish between these hypotheses and little effort has been made to detect P. virginalis in Florida. We have now constructed a new genome assembly for P. virginalis to support a detailed phylogeographic analysis of 92 P. fallax from 23 locations across the native range and to identify the putative parent population(s) of P. virginalis.

Results

To clarify the origin of the marbled crayfish, we collected P. fallax specimens from 23 different locations covering the entire native range of the species (Tab. S1). Samples were numbered by their sampling locations from 1 (northernmost) to 23 (southernmost). For genotyping, we used partial sequences of the mitochondrial cytochrome b (CytB), nuclear DNA methyltransferase 1 (Dnmt1), and mitochondrial cytochrome c oxidase 1 (Cox1) genes (see Methods for details). Sequencing of PCR amplicons from up to three markers and from 92 specimens showed that every analyzed P. fallax had at least one polymorphism (Fig. 1A) with the published P. virginalis reference sequence8. These findings strongly suggest that P. virginalis is not present within the native range of P. fallax.

Fig. 1: Phylo-geographic analysis of wild-caught Procambarus fallax.
figure 1

A PCR genotyping results of 92 P. fallax sampled for this study. The heatmap indicates the number of genetic polymorphisms for specific markers relative to the P. virginalis reference, on a scale from 0 (white) to 21 (blue). Grey boxes: not analyzed, asterisks denote animals that were also analyzed by whole-genome sequencing. The morphologically similar and sympatric crayfish species P. alleni (N = 4) was included as a control and showed a clearly distinct genetic profile. Sample numbers indicate individual sampling locations from 1 (northernmost) to 23 (southernmost); a and b indicates independent animals collected from the same location. B Map of Florida and southern Georgia, indicating the collection sites and the population structure. Three locations showed local sympatry of the Southwest and Everglades populations, as indicated by split coloring. C Phylogenetic tree, based on complete mitochondrial genome alignments. Colors indicate phylogeographically defined populations that were named after the corresponding water catchment areas of Florida. The blue dot indicates the P. fallax mitochondrial genome reference sequence, the red dot indicates the monoclonal P. virginalis mitochondrial genome reference sequence. Animals that are particularly closely related to P. virginalis are highlighted by red lines. Rectangles represent bootstrap values for the branches that define subpopulations (black: 100%, red: 95%).

Full size image

For a phylogeographic analysis of the P. fallax population, we selected one representative specimen from each location (numbered 1–23) for whole-genome sequencing (Tab. S2). For five locations, where the PCR results had suggested a greater level of genetic heterogeneity, two specimens were selected (labeled “a” and “b”). Sequencing reads were subsequently mapped on the marbled crayfish mitochondrial reference genome sequence to reveal maternal haplotypes. The results showed a substantial genetic diversity of the mitochondrial genomes and defined four populations (Fig. 1B). These populations were broadly aligned with the four major water catchment areas of Florida (Fig. S1) and were named correspondingly (Fig. 1B). Our results also showed that the monoclonal P. virginalis reference sequence was deeply nested in the Everglades population (Fig. 1C). In fact, P. virginalis formed a tight cluster with two specimens (19 and 21b) that were collected from independent locations (70 km apart) in the south-eastern Everglades.

For a detailed analysis of nuclear genome relationships, we generated an improved P. virginalis genome assembly by long-read sequencing with a total length of 3.7 Gb and a weighted mean sequence length (N50) of 144.4 Kb (Tab. S3). Compared with the previously published version8, this assembly reduced the number of total scaffolds from more than 3 million to 170 thousand, and the number of unknown bases from 1663 million to 663 million (Tab. S3). Quality controls showed a negligible amount of bacterial contamination within the genome assembly (Fig. S2). Benchmarking with universally conserved single-copy orthologs18 revealed 70.5% complete (3.4% duplicated), 11.8% fragmented, and only 17.7% missing orthologs, which is similar to other published arthropod genomes and further confirms the high quality of our assembly.

Mapping of the whole-genome sequencing datasets from the 28 P. fallax specimens (Tab. S2) further clarified the P. fallax populations that provided the parents of the foundational P. virginalis specimen. Principal component analysis revealed a population structure that appeared similar to the one supported by the analysis of mitochondrial genomes and again suggested a close relationship between P. virginalis and the Everglades population of P. fallax (Figs. 2, S3). While traditional haplotype analysis was hampered by the polyploid genome structure, we could identify the majority (“A”) and minority (“B”) haplotype for every heterozygous position in the P. virginalis nuclear genome and then define the sequence of these positions for every P. fallax genome. The resulting scores were subsequently used to analyze the genetic relationships between the P. virginalis haplotypes and the complete set of P. fallax nuclear genomes. The results showed a population structure that was similar to the structure observed with mitochondrial genomes, with both P. virginalis haplotypes clearly related to the Everglades population of P. fallax (Fig. S4). This analysis also confirmed the particularly close relationships of the two specimens with the most closely related mitochondrial DNA sequence (19 and 21b, Fig. S4).

Fig. 2: Principal component analysis, based on linkage-pruned variant sites (N = 76,863) obtained from the Procambarus fallax whole-genome sequencing dataset.
figure 2

Colors indicate the four major subpopulations: Suwannee (blue), St. John’s (purple), Southwest (yellow), and Everglades (red). Closely overlapping red/yellow ovals represent independent animals collected from the same location (“a” and “b”). Animals that are particularly closely related to P. virginalis are highlighted by red ovals.

Full size image

We have previously used allele frequency distributions of heterozygous positions to demonstrate that the marbled crayfish genome is triploid8. Interestingly, the P. fallax specimens 19 and 21b, that were most closely related to P. virginalis, also showed clear allele frequency distribution peaks at 0.33 (Fig. 3A), which is similar to P. virginalis (Fig. 3A) and consistent with triploidy. In sharp contrast, all other P. fallax specimens showed allele frequency distribution peaks at 0.5 (Figs. 3A, S5), in agreement with a diploid genome. Similar to P. virginalis, the triploid P. fallax genomes showed a negligible fraction of triallelic sequence polymorphisms (Fig. 3B), suggesting that they recapitulate the AAB genotype of P. virginalis. However, both animals also showed a considerable number of genetic polymorphisms (>100,000 homozygous single nucleotide variants) towards the P. virginalis reference genome (Fig. 3C). This is more than an order of magnitude above what has been described for various other P. virginalis specimens5 and demonstrates that these animals are genetically distinct from P. virginalis. Altogether our findings thus identify a subpopulation of P. fallax that shares important genetic features with P. virginalis and likely represents the foundational population of P. virginalis.

Fig. 3: Triploidy in Procambarus fallax.
figure 3

A Heterozygous allele frequency distribution in two triploid P. fallax, in P. virginalis and a diploid P. fallax. The histograms show the frequencies of heterozygous alternative allele ratios. Numbers for allele frequencies are indicated as counts (in 105). B Distribution of biallelic (bi) and triallelic (tri) SNPs in P. virginalis and in triploid P. fallax. C Numbers of biallelic SNPs, relative to the P. virginalis reference genome.

Full size image

Discussion

Our study allowed us to reconstruct the genetic makeup of the foundational P. virginalis specimen from the existing populations of P. fallax. Our findings strongly suggest that the marbled crayfish is a direct descendant of P. fallax, with both parental haplotypes inherited from the Everglades population, thus contradicting our previous hypothesis for a hybrid-like speciation event8. Our genotyping of 92 total specimens from Florida detected no evidence for the presence of P. virginalis. This is consistent with a recent review of 2299 P. fallax museum specimens, which revealed a female ratio of 55.3%, similar to other freshwater crayfish species from Florida, and suggests the absence of “hidden” parthenogenetic populations19. Future work should focus on increasing the sampling across P. fallax populations in Florida, in order to more accurately determine the population frequency and geographic distribution of P. fallax triploids. Additional analyses will be required to determine the reproductive mode of triploids and to better understand their ecology.

While we did not detect any P. virginalis in Florida, we did identify triploid P. fallax in the Everglades population, which were highly similar, but not identical to P. virginalis. We currently do not know the reproductive mode of these animals. Because the combination of triploid and haploid gametes usually results in aneuploidy, abortive development, and/or sterility20, we consider it unlikely that they could reproduce sexually. Thus, triploid P. fallax should be either sterile or parthenogenetic. Triploid parthenogenetic P. fallax, similar to marbled crayfish, would be expected to show superior fitness compared with sexually reproducing diploids21 and should thus be frequently found in P. fallax populations. However, the presence of triploids among our samples was relatively rare, with only two out of 28 specimens, suggesting that these animals are likely sterile. In comparison, triploid parthenogenetic individuals in populations of the New Zealand mud snail (Potamopyrgus antipodarum) were substantially more frequent (53%, N = 860)22. It is possible that parthenogenetic triploid P. fallax occasionally arises, but is disfavored by environmental23 or competitive24 factors. These factors may be absent in the non-native habitats into which P. virginalis has been released through anthropogenic activities.

Methods

Procambarus fallax collections and PCR genotyping

Animals were collected from various wild populations (Table S1) in compliance with state and local regulations (Georgia department of natural resources scientific collection permit 115621108, state of Florida collection permits S-19-10 and S-20-04). DNA was isolated from abdominal muscle tissue using SDS-based extraction and precipitation with isopropanol. PCR genotyping of 92 specimens was performed using the following primer pairs: Cytb (FWD CAGGACGTGCTCCGATTCATG and REV GACCCAGATAACTTCATCCCAG), Dnmt1 (FWD GCTTTCTGGTCTCGTATGGTG and REV CTGCACACAGCCTAAGATGC), Cox1 (FWD CTGCTATTGCTCATGCAGGT and REV TGCCCGAGTATCTACATCCA). Amplicons were verified by agarose gel electrophoresis and cloned using the TOPO TA Cloning Kit (Invitrogen) according to the manufacturer’s instructions. The purified plasmids were sequenced by eurofins genomics and the sequences were aligned using SnapGene software.

Procambarus virginalis PacBio genome sequencing and assembly

Genomic DNA was isolated from three independent animals using SDS-based extraction and precipitation with isopropanol. PacBio large-insert library preparation was done following the recommended protocols by Pacific Biosciences. For each animal, a library was generated from 1 to 5 µg of sheared and concentrated DNA with an insert size target of ~10 kb. After library preparation, sequencing was performed on a PacBio SEQUEL platform according to the manufacturer’s instructions. Movie times were 600 for most SMRT cells with some being 240, 360, and 900. Sequencing results for animals were pooled resulting in a total of 37 SMRT cells comprising 69,074,290 reads and 242,146,920,794 bases.

Long subreads generated from the PacBio SEQUEL platform were assembled into contigs using the Canu assembler25 version 1.7. After self-error correction and trimming for reading quality estimates and SMRT cell adapters, the remaining 31,652,687 reads, comprising 91,697,556,862 bp, were used in the assembly phase. Computations were done on a high-performance cluster running the Slurm Workload Manager using up to 56 CPUs and 450 GB memory. To achieve an improved gene representation, contigs were connected using transcriptome information. Briefly, all transcripts were mapped onto the contig assembly and linkage information was extracted to connect contigs using L_RNA_SCAFFOLDER26 version 1.0. Contiguity of sequences was improved using proximity ligation based on Chicago and Hi-C methods (provided by Dovetail Genomics, Chicago, USA) using fresh frozen tissue of one additional animal. After DNA extraction and library preparation, libraries were on an Illumina HiSeq X platform using a PCR-free paired-end 150 bp sequencing protocol. Reads were processed for scaffolding and error-correcting using Dovetail’s HiRise scaffolding pipeline (Dovetail Genomics, Chicago, USA).

Automatic annotation was performed as previously described8. Briefly, sequences larger or equal 10 kb were extracted from the assembly and annotated using the MAKER pipeline27 version 3.00. Annotation data were provided by the manually curated Uniprot/Swiss-Prot database28 and the annotated marbled crayfish transcriptome8. Functional domains were predicted using InterproScan29 version 5.39–77.0.

In order to assess the assembly quality, a defined set of single-copy ortholog arthropod genes were searched within all sequences using BUSCO18 version 4.1.4. BUSCO was run using default parameters in genome mode with the supplied arthropod sequence database, containing a total of 1066 orthologs from the arthropoda_odb10 database. Taxonomic interrogation was performed by using blobtools30 version 1.1.1, the P. virginalis Petshop 1 WGS dataset8, and the blast nucleotide database as a hit database. Blobtools was run according to the provided workflow by first creating a BlobDB database using standard parameters, followed by visualization.

Procambarus fallax whole-genome sequencing

Illumina libraries for 28 specimens were prepared by the DKFZ Genomics and Proteomics Core Facility using standard procedures and sequenced on an Illumina HiSeq X platform (PE150 protocol). Raw reads were trimmed and filtered using Trimmomatic31 version 0.32.

Whole-genome sequencing data analysis

Trimmed and processed reads were mapped on the P. virginalis mitochondrial genome sequence (Genbank KT074364.1) or on the V1.0 genome assembly using bowtie232 version 2.1.0. Alignment files were converted to BAM format and duplicates were removed with SAMtools33, version 1.9. Furthermore, alignment files were filtered for reference sequences longer than 10 kbp. Multi-sample SNV profiles were calculated for batches of P. fallax animals using freebayes (https://arxiv.org/abs/1207.3907, version v0.9.21-7-g7dd41db) with a ploidy setting for diploid organisms. The obtained variant sites from vcf files were subjected to linkage pruning using PLINK34 version 1.9 and specific parameter settings for windows (50 Kb), window step sizes (10 bp), and R2 threshold (>0.1). The resulting set of variants was used for a Principal Component Analysis (PCA) using default parameter settings in PLINK and plotted using the ggplot2 package in R (version 3.2.1). Alignment files for the mitochondrial genomes were used for consensus calling by the bcftools package from SAMtools. The obtained consensus sequences of P. fallax mitochondrial genomes together with the P. virginalis reference mitochondrial genome were aligned using Clustal Omega with default parameters. For the resulting multiple sequence alignment, a phylogenetic tree was constructed by the maximum likelihood method implemented in PhyML35 (v3.1/3.0). The tree in Newick format was visualised via the Interactive Tree of Life online tool36, with statistical branch support assessed by the bootstrap method37.

To detect parental nuclear alleles of P. virginalis, SNV profiles from all P. fallax animals were compared with the set of marbled crayfish-specific heterozygous positions. A matrix was built for each marbled crayfish allele (majority and minority allele) containing either 0 or 1, representing either the presence or absence of the respective alleles in P. fallax animals. A neighbor-joining distance matrix was calculated for each allele and an unrooted tree was plotted using APE38 version 5.3. To identify triploid genomes, biallelic heterozygous variants were extracted from SNV profiles. Focusing only on reference alleles, homozygous single nucleotide polymorphisms in P. fallax were discarded. For each variant position, alternative allele frequencies were calculated as the number of alternative allele read observations divided by the total read depth. Finally, frequencies were plotted using the histogram routine in R (version 3.6.1).

Statistics and reproducibility

All statistical methods and visualizations were performed using publicly available tools and packages from the statistical computing framework R. Individual packages, parameter settings, and version numbers are mentioned in the respective sections. Linkage pruning was performed using PLINK34 (v1.9) and an internal r2 statistic threshold of >0.1 for squared correlation of raw inter-variant allele counts. Principal component analysis was performed using the default internal R function with standard parameters. Phylogenetic tree reconstruction was performed by the maximum likelihood method implemented in PhyML35 (v3.1/3.0) with default parameters. Here, statistical support for each branch was assessed using the bootstrap method37. Histogram plots for heterozygous allele frequencies were generated using the default internal R (v3.6.1) histogram function.

This study includes data for PCR genotyping of N = 92 P. fallax specimens. For each animal, the total number of genetic polymorphisms on 3 gene fragments was extracted and plotted on a scale from 0 (minimum) to 21 (maximum) using the internal R (v3.5.0) heatmap function with default parameters. Additionally, data from N = 4 specimens of P. alleni were sequenced and integrated. Replicates were defined as a group of individuals with distinct animals from one species (i.e., N = 92 for P. fallax and N = 4 for P. alleni). Analysis of whole-genome sequencing data was performed on N = 28 P. fallax animals collected from 23 independent collection sites in Florida and southern Georgia. Additionally, N = 2 publicly available WGS datasets of P. virginalis samples were considered for this study. Here, replicates were also defined as the number of individual animals from one species.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.