Table 2 GSTA1(var2-3) cDNA sequence

From: Golgi stress mediates redox imbalance and ferroptosis in human cells

ATG TATATAGAAGGTATAGCAGATTTGGGTGAAATGATCCTCCTTCTGCCCGTATGTCCACCTGAGGAAAAAGATGCCAAGCTTGCCTTGATCAAGGAGAAAATAAAAAATCGCTACTTCCCTGCCTTTGAAAAAGTCTTAAAGAGCCATGGACAAGACTACCTTGTTGGCAACAAGCTGAGCCGGGCTGACATTCATCTGGT GGAACTTCTCTACTACGTCGAGGAGCTTGACTCCAGTCTTATCTCCAGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGCAACCTGCCCACAGTGAAGAAGTTTCTACAGCCTGGCAGCCCAAGGAAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCAAGGAAGATTTTCAGGTTT TAA
  1. Several polymorphisms in GSTA1 exist. Shown above is the cDNA sequence cloned into our lentiviral vectors for overexpression studies (shown is only the ORF). Underlined sections indicate the start and stop codons, respectively.