The association of ODF4 with AK1 and AK2 in mice is essential for fertility through its contribution to flagellar shape

Ito, Chizuru; Makino, Tsukasa; Mutoh, Tohru; Kikkawa, Masahide; Toshimori, Kiyotaka

doi:10.1038/s41598-023-28177-z

Download PDF

Article
Open access
Published: 20 February 2023

The association of ODF4 with AK1 and AK2 in mice is essential for fertility through its contribution to flagellar shape

Scientific Reports volume 13, Article number: 2969 (2023) Cite this article

1414 Accesses
5 Citations
Metrics details

Subjects

Abstract

Normal sperm flagellar shape and movement are essential for fertilization. The integral protein outer dense fiber 4 (ODF4) localizes to ODFs, but its function remains unclear. Adenylate kinase (AK) is a phosphotransferase that catalyzes the interconversion and controls the concentration equilibrium of adenine nucleotides. AK shuttles ATP to energy-consuming sites. Here, we report on the relationship of flagellar shape and movement with ODF4, AK1 and AK2 by using Odf4-deletion (Odf4^−/−) mice. Soluble ODF4 is coimmunoprecipitated with AK1 and AK2 in Odf4^+/+ spermatozoa. ODF4, AK1 and AK2 localize to whole flagella (plasmalemma, mitochondria, ODFs, and residual cytoplasmic droplets (CDs)), principal pieces, and midpieces, respectively. Odf4^−/− sperm flagella lose ODF4 and reduce AK1 and AK2 but produce ATP. The flagellum is bent (hairpin flagellum) with a large CD in the midpiece. There is no motility in the midpiece, but the principal piece is motile. Odf4^−/− spermatozoa progress backward and fail to ascend in the uterus. Thus, Odf4^−/− males are infertile owing to abnormal flagellar shape and movement caused mainly by the loss of ODF4 with AK1 and AK2. This study is supported by the rescue experiment; the abnormalities and male infertility caused by Odf4 deletion were reversed by Odf4 restoration.

CFAP45 deficiency causes situs abnormalities and asthenospermia by disrupting an axonemal adenine nucleotide homeostasis module

Article Open access 02 November 2020

The missing linker between SUN5 and PMFBP1 in sperm head-tail coupling apparatus

Article Open access 13 August 2021

DNALI1 deficiency causes male infertility with severe asthenozoospermia in humans and mice by disrupting the assembly of the flagellar inner dynein arms and fibrous sheath

Article Open access 15 February 2023

Introduction

Sperm energy is produced by the tricarboxylic acid (TCA) cycle in the midpiece (proximal flagellum) and by glycolysis in the principal piece (distal flagellum)¹ (Fig. 2C, Fig. S2A). The energy produced is consumed for flagellar shape and movement. The normal flagellum has a straight shape. A straight flagellum is critical for symmetrical forward progression; flagellar shape defects and movement failure result in male infertility (World Health Organization: WHO)². Flagellar shape and movement are supported by internal cytoskeletal proteins of the outer dense fibers (ODFs), fibrous sheath and axonemal microtubules¹. ODFs (numbers 1–9) emanate from the axoneme in the neck and are concentrically arranged in the whole flagella. They are covered by helically arranged mitochondria in the midpiece and by a fibrous sheath in the principal piece and run down the center of the flagellum, surrounding the “9 + 2” microtubular axonemes. ODF4 is one of the main elements composing the ODFs. Mouse ODF4 is composed of 290 amino acids (approximately 33 kDa) encoded by the Odf4 gene (4 exons, chromosome 11)³ (Mouse Genome Informatics: MGI). Human ODF4 (also known as cancer/testis antigen 136) is composed of 257 amino acids (30 kDa: 5 exons, 17p13.1); the deduced 257-amino acid human ODF4 protein shares 39.9% identity with its mouse protein counterpart⁴ (National Center for Biotechnology Information: NCBI). ODF4 was initially called OPPO1 (a Japanese word for tail) and thought to be one of the sperm cytoskeletal proteins³, but the function of ODF4 remains unclear¹ (NCBI). We have termed such a hardly soluble form of ODF4 localized in the ODFs an ‘integral ODF4’ in this report.

A bent flagellum is one of the most common abnormalities in sperm shape and movement in infertile male patients². A bent flagellum with an angle of 180 degrees is called a hairpin sperm flagellum (hairpin flagellum for short) and moves asymmetrically. The hairpin flagella have a large residual cytoplasm in the midpiece. Under normal conditions, most mature spermatozoa that reach the cauda epididymis have little residual cytoplasm in the flagellum, referred to as cytoplasmic droplets (CDs)^5,6; CDs are found in vertebrate species from fish to humans⁷. During mammalian sperm maturation in the epididymis, a CD is formed around the base of the head at the end of spermatogenesis and moves toward the annulus, a circular structure or cortex ring that functions as a junction between the midpiece and principal piece; eventually, the CD is found as a tiny membrane-bound vesicle in the cauda sperm flagella¹ (Fig. S2A, Fig. 8). A CD is generally shed from a spermatozoon in the distal epididymis or in the uterus soon after copulation, and then flagellar straightening occurs. Therefore, CD shedding has long been thought to be physiological. However, the mechanisms of how flagellar shape and movement are related to energy production and consumption remains unclear.

Adenine nucleotides (AMP, ADP and ATP) are essential for cellular life, including for ciliary movement and metabolism⁸, and any defect in them causes severe primary ciliary dyskinesia in humans⁹. Regarding sperm energy production, there are reports showing that most of the energy for flagellar motility is produced by glycolysis through a glycolytic enzyme, the sperm-specific isoform of glyceraldehyde 3-phosphate dehydrogenase (GAPDS), in the fibrous sheath rather than by mitochondrial oxidative phosphorylation in the midpiece^10,11. The produced ATP is consumed by cytosolic and axial dynein ATPases^10,11,12. Adenylate kinase (AK, also known as myokinase: EC 2.7.4.3) is a phosphotransferase ubiquitously distributed throughout the body that catalyzes the interconversion of adenine nucleotides. AK shuttles ATP to energy-consuming sites⁸. AK recruits two molecules of ADP and reversibly transfers phosphate groups to one molecule each of ATP and AMP (2 ADP ⇔ ATP + AMP), where the equilibrium constant is close to 1^13,14. Thus, AK controls the concentration equilibrium of adenine nucleotides to balance energy production and consumption. To date, three adenylate kinases have been reported in spermatozoa: AK1, AK2^13,15,16 and AK8¹⁷. AK1 (23 kDa) localizes to ODFs¹⁵. AK2 (30 kDa) localizes to the mitochondria¹⁵. AK8 (56 kDa) localizes to the axoneme¹⁷. One line of AK1 knockout (KO) mice produced spermatozoa with no remarkable effect on flagellar motility¹⁶. The other lines of AK1 KO mice impaired cardioprotective signaling¹⁸, blunted the vascular adenylate kinase phosphotransfer system, failed adequate coronary reflow following ischemia‒reperfusion¹⁹, and impaired skeletal myocyte energy homeostasis²⁰. There are no AK2 KO or AK8 KO mice.

Recently, the role of ODF-related proteins has become recognized as an important issue in disease. Our previous contribution to this topic indicated that the cytoskeletal protein ODF2 plays a role in fertility because Odf2-haploinsufficient males were infertile owing to unique sperm head–tail separation²¹. In this study, we report the contribution of ODF4 to fertility, where ODF4 associates with AK1 and AK2 to control energy metabolism for sperm shape (flagellar straightening) and movement.

Results

Odf4 expression and localization of ODF4, AK1 and AK2

ODF4 was expressed in the testis (Fig. 1A, Fig. S1A). It was first observed in the second week after birth (Fig. 1B, Fig. S1B), when spermatocytes first appeared. To clarify the function of ODF4 and to localize ODF4, we established the Tg(Odf4-Egfp) and double Tg(Odf2-mCherry,Odf4-Egfp) mouse lines (Fig. 1C, D and Figs. S1C, D, respectively). The width of the ODF4-EGFP green signal (800–900 nm) was larger than that of the ODF2-mCherry red signal (approximately 500 nm) of another cytoskeletal protein (Fig. 1E), suggesting some role(s) in addition to its cytoskeletal nature. The ODF4-EGFP signal was detected in the entire flagella of postcopulatory spermatozoa recovered from the uterine lumen (Fig. S2B). In cauda epididymal sperm, AK1 was mainly detected in the principal piece (Figs S2D, E and S3) and in the CD in the distal midpiece near the annulus (Figs S2C–E). In contrast, AK2 was mainly detected in the midpiece (Figs S2D, E and S3) and in the CD near the annulus (Figs S2C, D and S3) of cauda epididymal sperm. AK1 and AK2 were hardly detected in the Odf4^−/− spermatozoa (Fig. S3), and their reduced expression was also shown later by western blotting (Fig. 4, Fig. S6). These data are summarized in a table (Fig. S2E). Immunoelectron microscopy using an antibody against GFP for Tg(Odf4-Egfp) spermatozoa revealed that immunogold particles labeled ODF4-EGFP were localized to the plasmalemma, mitochondria and ODFs along the full length of the flagellum, but the CD disappeared due to repeated washings and centrifugations during sample preparation (Fig. S4).

Characterization of Odf4 ^−/− mice and spermatozoa

To investigate the physiological role of ODF4 in vivo, we deleted the Odf4 gene. Ablation at the desired region was confirmed by DNA sequence analysis (Fig. S5A) and genomic PCR analysis (Fig. S5B). Western blotting and immunofluorescence assays detected no ODF4 signals in the Odf4^−/− samples (Figs S5C, D). Nonspecific genome modifications were not observed in at least two potential off-target sequences. Odf4^−/− females were healthy and exhibited no overt abnormalities. Odf4^−/− males were healthy and normal vaginal plugs formed when they mated with females; however, they were almost completely infertile, which resulted in a severely reduced average number of pups (Fig. 2A). The Odf4^−/− testis weight was significantly reduced, but the epididymis weight was not significantly different between Odf4^+/+ and Odf4^−/− mice (Fig. 3A). The cauda epididymal sperm concentration was significantly reduced in Odf4^−/− mice compared to Odf4^+/+ mice (Fig. 3A). Odf4^−/− males exhibited all stages of germ cell differentiation from spermatogonia to spermatozoa in the seminiferous epithelium and produced normal-looking spermatozoa (Fig. 3B). However, mature spermatozoa that had reached the cauda epididymis displayed a high percentage (more than 90%) of morphological abnormalities (Fig. 3C), including hairpin-shaped flagella (Fig. 2B). The annulus architecture appeared normal, as confirmed by transmission electron microscopy (TEM) (Fig. 3D). The annulus-specific marker SEPTIN 7 was normally detected in the annulus region, as verified by both immunofluorescence (Fig. 2C) and western blotting (Fig. 4A and Fig. S7). However, the CD was retained around the annulus region, spanning from the distal midpiece to around the annulus region, whereas all other flagellar internal components, such as ODFs, fibrous sheath and axial filaments, appeared normal, as shown by TEM (Fig. 3D). A computer-assisted sperm motility analysis system (SMAS) showed that all parameters, such as the percentage (%) of sperm motility, straight line velocity (μm/sec) and average velocity (μm/sec), were significantly reduced in Odf4^−/− spermatozoa compared to that of Odf4^+/+ spermatozoa (Fig. 2D). Almost none of the Odf4^−/− spermatozoa were able to progress forward, instead progressing backward with immotile midpieces (Videos S1 and S2 for Odf4^+/+ and Odf4^−/−, respectively). This motility characteristic is further quantitatively analyzed below (Fig. 6).

AK1 and AK2 in spermatozoa and immunoprecipitation (IP)

Next, we examined what kinds of flagellar proteins are present or absent in Odf4^−/− testicular and sperm cells using western blotting. For this purpose, to pay particular attention to the readily soluble form of ODF4 localized in the cytosol (here termed ‘soluble ODF4’), we collected the sample as described in detail in the Methods section; in short, we directly placed the samples without washing them into RIPA buffer containing 1% Nonidet P40. As a result, antibodies against AK1 and AK2 detected the corresponding signals in both control Odf4^+/+ testis and cauda sperm extracts and in Odf4^−/− seminiferous tubules cell extracts, but these signals were significantly reduced in Odf4^−/− mature sperm cell extracts (Fig. 4A Left and Fig. S6). Signals for all other proteins examined were detected in both Odf4^−/− and Odf4^+/+ cell extracts as follows: ODF1, ODF2, TEKTIN4, cation channel sperm associated 3 (CATSPER3), AQP3, AQP7, AQP8, SEPTIN 4, SEPTIN 7, solute carrier family 22 member 14 (SLC22A14), GAPDS, and GAPDH (Fig. 4A Right and Fig. S7). Next, we examined whether AK1 and AK2 can be coimmunoprecipitated with ODF4 in Tg(Odf4-Egfp) mice by IP using protein-G immunobeads conjugated with an antibody against GFP. For this purpose, samples were extracted from Tg(Odf4-Egfp)Odf4^+/+ and Odf4^−/− spermatozoa (control). Both AK1 and AK2 proteins were coimmunoprecipitated with ODF4 (ODF4-EGFP) from the Tg(Odf4-Egfp)Odf4^+/+ sperm extracts but not from the negative control Odf4^−/− sperm extract (Fig. 4B).

Sperm ascension in the female reproductive tract

Because Odf4^−/− sperm motility was reduced, we investigated whether Odf4^−/− spermatozoa could ascend in the Odf4^+/+ female reproductive tract after plug formation. For this purpose, we employed Tg(Eqtn-Egfp) male mice and females treated with hormones to control the estrous cycles for copulation. As a result, the control Odf4^+/+ spermatozoa normally ascended in the uterus, entered the oviduct, reached the ampulla and fertilized eggs (Figs S8A–D). In contrast, Odf4^−/− spermatozoa stalled in the lower region of the uterine cavity, failed to ascend in the uterus and were unable to fertilize eggs (Figs S8E–H).

ATP and ADP concentrations before and after capacitation

Considering the results obtained here, we next examined how ATP and ADP were produced in Odf4^−/− spermatozoa and how Odf4^−/− sperm energy was controlled. For these purposes, ATP and ADP concentrations between Odf4^+/+ (control) and Odf4^−/− spermatozoa were compared (see Methods). When evaluating the results, it should be noted that sperm flagellar movement becomes vigorous after capacitation, as characterized by whiplash-like beating called hyperactivation¹. In Odf4^+/+ spermatozoa, both ATP and ADP were produced and consumed, where each ATP and ADP concentration before and after capacitation was almost even, showing values of 3.1 versus 2.9 nmol and 1,146.1 versus 1,066.6 RLU (arbitrary unit), respectively (Fig. 5 and Fig. S9). In contrast, in Odf4^−/− spermatozoa, both ATP and ADP were produced, but the ATP and ADP concentrations were both high and uneven before capacitation and low and uneven after capacitation, showing values of 29.4 versus 7.7 nmol and 3,662.9 versus 2,003.0 RLU, respectively (Fig. 5 and Fig. S9).

Flagellar motility analysis

Considering the result of Fig. 2D, we analyzed the details of Odf4^−/− flagellar motility by comparing the beat frequency at 3 points of the flagella (1/2, PP-2 and PP-3) in Odf4^−/− to Odf4^+/+ spermatozoa (see Methods). The results are summarized in a table shown in Fig. 6 and described here in detail. The beat frequencies of the Odf4^+/+ midpiece at 1/2 MP and the principal piece at PP-2 and PP-3 were consistently high both before and after capacitation, with values of 4.2 and 4.5 at 1/2 MP, 6.7 and 5.3 at PP-2, and 6.7 and 5.3 at PP-3, respectively. In contrast, the beat frequency of the Odf4^−/− midpiece at 1/2 MP was basically null both before and after capacitation, with values of 0 and 0, respectively. The beat frequency of the Odf4^−/− principal piece at PP-2 and PP-3 before capacitation was rather high, with values of 3.9 and 5.4, respectively, but these values were still lower than those of the Odf4^+/+ midpiece. In contrast, the beat frequency of the Odf4^−/− principal piece at PP-2 and PP-3 after capacitation was quite high, where the values were 7.8 and 10.8, respectively; these values were higher than those of the Odf4^+/+ principal piece. The raw data are shown in a table in Fig. 6 and in corresponding video clips (Videos S3 and S4 for Odf4^+/+ and Odf4^−/−, respectively).

Demembranation assay

We also examined whether Odf4^−/− flagellar axial dynein ATPase functioned normally. Before describing the results, it should be noted that the Triton X-100 treatment disrupts the plasma and mitochondrial membranes but leaves the axoneme and cytoskeletal support intact¹ and that in association with detergent treatment, cytosolic AK1 and AK2 disappear or are extracted, as shown by western blotting (Fig. 4). In addition, concomitantly with this assay, we examined how the presence or absence (disappearance) of flagellar CD affects the movement pattern, since CD disappears in response to Triton X-100 treatment. The experimental design and results are shown in a diagram (Fig. S10), also see Methods). Before demembranation, most of the control Odf4^+/+ spermatozoa had straight flagella, no CD and moved forward (Video S5), while the Odf4^−/− spermatozoa had bent flagella with a large CD and moved backward (Video S6). Next, we treated these spermatozoa with 0.1% Triton X-100, a treatment known as demembranation. As a result, soon after treatment, the demembranated spermatozoa of both Odf4^+/+ and Odf4^−/− mice stopped moving and became immotile (Videos S7 and S8, respectively). Thereafter, we placed these demembranated spermatozoa in reactivating TYH medium (a modified Krebs–Ringer bicarbonate solution)²⁹ that contains ATP to reactivate the spermatozoa; this is called reactivation. Both Odf4^+/+ and Odf4^−/− spermatozoa immediately resumed active forward progression (Videos S9 and S10, respectively). During this reactivation assay, CDs were not observed in the Triton-treated Odf4^−/− flagella, and the CD-lost flagellar shape became rather straight (Video S10). These results are summarized in a table shown in Fig. S10.

Environmental osmolarity changes do not affect Odf4 ^−/− flagellar angulation

Because it was previously reported that sperm flagellar angulation decreased as the in vitro environment osmolarity increased²², we examined how the osmolarity change in the environment of TYH medium affects Odf4^−/− flagellar angulation in an in vitro assay. For this purpose, we investigated flagellar status or angulation with increasing osmolarity—from 150 mOsm/kg, which corresponds to half the osmolarity of plasma, to 440 mOsm/kg, which is higher than uterine osmolarity (310 mOsm/kg). In Odf4^+/+ spermatozoa, the percentage (%) of flagellar angulation with hairpin flagella decreased from approximately 60% to 20% as the osmolarity increased from 150 to 440 mOsm/kg, whereas in Odf4^−/− spermatozoa, the percentage (%) of flagellar angulation with hairpin flagella was always high (approximately 70%) at all osmolarity conditions, with approximately 90% bent tail spermatozoa (Figs S11A Left and S11B Top). Next, since it has been reported that sperm flagellar angulation decreases as osmolarity increases during sperm transit in the epididymis from approximately 330 mOsm/kg in the testis and the initial segment of the caput²³ to approximately 415 mOsm/kg in the cauda epididymis²², we examined whether Odf4^−/− flagellar angulation changes when sperm passes from the caput to the cauda epididymis in vivo. As shown in Figs S11A Right and S11B Bottom, in the control Odf4^+/+ spermatozoa, the percentage (%) of bent tail (V shape and hairpin) flagellar angulation was high in the caput and corpus epididymis at nearly 80%, and then it decreased to nearly 30% as they passed toward the distal epididymis. In contrast, in Odf4^−/− spermatozoa, the percentage (%) of bent tails was consistently high (70–95%) in any region of the epididymis, where the percentage (%) of hairpin tails increased from approximately 30% to approximately 80% in the epididymis.

Rescue experiments

To confirm the importance of Odf4 and ODF4 in vivo, we tested whether rescue mouse Tg(Odf4-Egfp)Odf4^−/− spermatozoa can rescue the phenotype caused by the Odf4 gene deletion (see Methods). The evidence of Tg generation was shown by genomic PCR and western blotting (Fig. S12). As a result, the rescue Tg males exhibited complete restoration of all parameters and events examined: infertility rate, percentage (%) hairpin sperm flagellum in the cauda epididymal and postcopulatory spermatozoa, reduction of AK1 and AK2, and reduction of sperm motility (Fig. 7, Fig. S12. The restored values obtained in these assays were almost equal to the levels obtained for the control Odf4^+/+ spermatozoa.

Discussion

Odf4 deletion primarily causes the loss of ODF4 in Odf4^−/− testes and secondarily reduces the amount of AK1 and AK2 in Odf4^−/− sperm flagella; eventually, Odf4^−/− males are infertile. Herein, we present our explanations and possible interplays of soluble ODF4, AK1 and AK2 in Odf4^+/+ spermatozoa based on the summary of our studies (Fig. 8). First, the result of the double Tg(Odf2-mCherry,Odf4-Egfp) expression experiment showing that ODF4 is more broadly distributed in the flagella than the cytoskeletal protein ODF2 (Fig. 1E) morphologically implies that ODF4 has some role(s) in addition to that of integral ODF4. This implication is supported by the western blotting results showing that there is a soluble form of ODF4 (soluble ODF4). Soluble ODF4 can be readily extracted by RIPA buffer containing 1% Nonidet 40; Nonidet 40 is a milder detergent than 6 M urea, which is conventionally used to extract flagellar cytoskeletal proteins, such as ODF1 and ODF2. Integral ODF4 is traditionally known as an integral structural component that associates with other ODF components¹ (NCBI). Another western blotting result showing that AK1 and AK2 in Odf4^−/− mice are detected in testicular samples but are significantly reduced in mature sperm extracts (Fig. 4A) indicates that AK1 and AK2 are produced in Odf4^−/− testes, but both AK1 and AK2 are not well mobilized in mature Odf4^−/− spermatozoa owing to the loss of ODF4. The results of Odf4^−/− sperm motility reduction (Fig. 2D) and coimmunoprecipitation assays of Odf4^+/+ sperm samples (Fig. 4B) suggest that sperm flagellar motility is achieved through ODF4 interaction with AK1 and AK2. Considering all these implications together with the results that ODF4, AK1 and AK2 are distributed to Odf4^+/+ whole flagella, including the CD, but AK1 and AK2 are hardly detected in Odf4^−/− spermatozoa (Figs. 4A and S3), soluble ODF4 can bind to AK1 and AK2 and function in the cytosol outside the ODFs. Thus, soluble ODF4 is involved in the correct positioning of AK1 and AK2 in the flagellum. It is also presumable that the ODF4-AK1-AK2 complexes shuttle ATP to the flagellar cytoplasm to control the concentration equilibrium of adenine nucleotides for CD elimination. Thus, the interaction of ODF4, AK1 and AK2 in spermatozoa will be a prerequisite for energy metabolism for sperm flagellar shape (straightening) and movement.

Regarding sperm flagellar energy metabolism, ATP and ADP assays (Fig. 5 and Fig. S9) also indicated that in Odf4^−/− spermatozoa, ATP is produced but not correctly transported to the consuming sites owing to the absence of ODF4 and the reduction of AK1 and AK2; thus, the consumption of ATP is not well controlled. In fact, the concentrations of ATP and ADP in Odf4^−/− spermatozoa were random, with high and uneven averages throughout capacitation. In contrast, in Odf4^+/+ spermatozoa, the produced ATP and ADP are normally positioned, transported, consumed and balanced under controlled conditions, owing to the normal association of ODF4 with AK1 and AK2. In fact, the concentrations of ATP and ADP were always low, with almost even averages throughout capacitation.

Regarding the Odf4^−/− flagellar movement as shown in Figs. 2, 5, 6, it is thought that the energy (ATP) produced by oxidative phosphorylation in the midpiece, where huge CD is present (not eliminated), is not enough to shed the CD and maintain powerful movement. In addition, the remaining large CD mechanically disturbs the movement and straightening of the midpiece, where the reduced integral ODF4 may also disturb the straightening of the midpiece. In contrast, the energy (ATP) produced by glycolysis in the principal piece is still enough to maintain movement, whereas the absence of CD does not disrupt movement. However, the precise mechanism of how AK1 and AK2 are involved in CD shedding and flagellar movement is currently unclear. In addition, until now, there has been no evidence about structures and molecules for CD shedding throughout spermatogenesis to sperm maturation in the epididymis¹. Although AK8 is reported to be present in sperm flagella¹⁷, whether AK8 is present in Odf4^−/− flagella is unclear because a specific antibody against AK8 is not currently available.

The reduction in Odf4^−/− midpiece motility was not caused by the disorder of axial dynein because Odf4^−/− dynein was found to be normal (Fig. 3D) and because freely available ATP in the reactivation medium was normally consumed, as shown by the demembranation assay (Fig. S10, Video S10). In addition, the demembranation assay also showed that most CD-lacking Odf4^−/− flagella became rather straight shaped and moved forward after CD loss, indicating that CD shedding is essential for flagellar straightening and forward progression. Odf4^−/− flagellar bending is induced neither by environmental osmolarity changes, as shown in Fig. S11, nor by deficiencies in other genes, such as aquaporin genes (AQP3, AQP7, and AQP8)²², solute carrier genes (SlC26A8, SlC22A14)^24,25 and annulus-related genes (SEPTIN4 and SEPTIN 7)²⁵, because all of these gene products were present in Odf4^−/− spermatozoa (Fig. 4).

Last, since all abnormalities and male infertility caused by Odf4 deletion described above were reversed by Odf4 restoration (Fig. 8), the rescue experiment confirmed the importance of ODF4, AK1, and AK2 in vivo. Thus, our study reports the contribution of the newly identified ‘soluble ODF4’ associated with AK1 and AK2 to fertility and provides its relationship with sperm flagellar shape (straightening) and movement. This report will open a new window to understanding the molecular mechanism of fertility and infertility. Our findings also bestow knowledge in the field of human diseases, since it is becoming clear that many of the etiologies of male infertility are due to inherited genetic variations²⁶.

Materials and methods

Ethical approval and animals

All procedures were performed in accordance with the institutional guidelines for animal research and approved by the Animal Care and Use Committee of Chiba University (#A30-080) for C57BL/6JJmsSlc (B6), B6D2F1 (BDF1) and ICR mice (Japan SLC). This study was carried out in compliance with the ARRIVE guidelines.

Antibodies

The antibodies and chemicals used are described in Table S1.

Generation of KO mice, B6(Cg)-Odf4 ^em1: Odf4-null (Odf4 ^−/−) mice

The CRISPR target sequence of the mouse Odf4 gene was determined in exon 1 using the online sgRNA design tool CRISPRdirect software (https://www.crisper.dbcls.jp): TGAATGAGGAAGAATCCGAGAGG (protospacer adjacent motif sequences are underlined). The sgRNA was synthesized using synthetic oligonucleotides (5’-TAATACGACTCACTATAGTGAATGAGGAAGAATC-3’ and 5’-TTCTAGCTCTAAAACCTCGGATTCTTCCTCATT-3’). The CRISPR/Cas9 mixture containing 50 ng/μl sgRNA and 100 ng/μl Cas9 nuclease (Thermo Fisher Scientific) was injected into BDF1 pronuclear stage embryos, which were cultured into two-cell embryos and transferred into the oviducts of ICR pseudopregnant female mice; 26 pups (F0) were born. Genomic DNA was used for PCR amplification with gene-specific primers for the detection of mutations (Table S2). The sequences of the clones were determined by sequencing. Three males and one female among the F0 mice exhibited frameshift mutations on both alleles. The males were infertile, but the female was fertile and produced pups (F1) after crossing with a wild-type partner. Odf4-homozygous (Odf4-null or ^−/−) mice were produced by crossing heterozygous (+ /-) mice.

Generation of Tg mice

All Tg mice were produced according to a previously reported method²⁷. Double-Tg(Odf2-mCherry,Odf4-Egfp) mice. First, we generated Tg(Odf4-Egfp)Odf4^+/+ mice and Tg(Odf2-mCherry)Odf4^+/+ mice separately (Fig. 1C). The mouse Odf4 cDNA was fused with a linearized pCM-Egfp vector containing the mouse Calmegin promoter²⁸, which was made from the pCM-Eqtn-Egfp vector²⁷. The mouse Odf2 cDNA was cloned into the pmCherry vector (Clontech), and then the Odf2-mCherry fragment was cloned into the pCM vector (pCM-Odf2-mCherry). The transgenes excised from pCM-Odf4-Egfp and pCM-Odf2-mCherry were injected into fertilized eggs of C57BL/6 mice. Incorporation of the transgene was detected via PCR analysis using primer set A for Tg(Odf4-Egfp) and primer set B for Tg(Odf2-mCherry), as shown in Table S2. Tg(Odf4-Egfp) mice were crossed with Tg(Odf2-mCherry) mice to generate double Tg(Odf2-mCherry,Odf4-Egfp) mice (Fig. 1C). Tg(Eqtn-Egfp)Odf4^+/+ mice were generated as previously reported²⁷. Tg(Eqtn-Egfp)Odf4^−/− was generated by crossing Tg(Eqtn-Egfp)Odf4^+/+ males with Odf4^−/− females. Rescue Tg males. Tg(Odf4-Egfp)Odf4^+/+ males were mated with Odf4^−/− females to obtain heterozygous Tg(Odf4-Egfp)Odf4^+/- mice. Tg(Odf4-Egfp)Odf4^+/- males and females were mated to obtain Tg(Odf4-Egfp)Odf4^−/− mice for the rescue experiment.

RT‒PCR

Total RNA was isolated from various tissues (cerebrum, heart, lung, liver, spleen, kidney, small intestine, testis, epididymis) of adult C57BL/6 mice and testes of 1-, 2-, 3-, 4- and 5-week-old ICR mice. PCR was performed using Odf4-specific primer pairs (Table S2) at 94 °C for 2 min and 30x (94 °C for 20 s, 55 °C for 30 s, and 72 °C for 60 s). Gapdh (D-glyceraldehyde-3-phosphate dehydrogenase)-specific primers (Table S2) were used as controls.

SDS‒PAGE and western blotting

These methods were performed as previously reported²⁹, with slight modifications. For ODF1, ODF2, TEKTIN4 and β-TUBULIN, spermatozoa or testes were minced and centrifuged, and the supernatants were incubated twice in a buffer including 2% Triton X-100 and 5 mM DTT containing protease inhibitor cocktail for 15 min on ice and then lysed in lysis buffer containing 6 M urea and 5 mM DTT for 20 h on ice. For ODF4, AK1 and 2, CATSPER3, SEPTIN4 and 7, GAPDH, GAPDS, AQP3,7 and 8, SLC22A14 and β-ACTIN, β-TUBULIN, samples were recovered from the epididymis by pricking out with needles or from the testicular seminiferous tubules and then directly put into RIPA buffer (50 mmol/L Tris–HCl buffer (pH 7.6), 150 mmol/L NaCl, 1% Nonidet P40 substitute, 0.5% sodium deoxycholate, 0.1% SDS) without washing to solubilize for 2 h on ice. These lysates were routinely used for experiments performed in at least triplicate (Nsample = 3).

IP

The experimental pair included Odf4^+/+ Tg(Odf4-Egfp) and Odf4^−/− (control) spermatozoa. These samples were similarly extracted in RIPA buffer, as described above for western blotting. The same amount of samples for each pair was subjected to IP, which was performed using a Dynabeads™ Protein G Immunoprecipitation Kit with a mouse monoclonal antibody against GFP (B2: IgG_2a, Santa Cruz Biotechnology Inc.). The obtained samples were subjected to SDS‒PAGE and western blotting.

Fertility test

Male mice were housed with females for at least 2 months to determine whether litters were obtained. The number of pups produced was checked every morning.

Morphology and motility assays

Spermatozoa were prepared by squeezing them out from the caput, corpus and cauda epididymis of Odf4^+/+ (+ / +) and various Odf4^−/− (−/−) and Tg males. They were processed as previously reported²¹. Some spermatozoa were briefly treated with 1% saponin for immunofluorescence to visualize the internal components.

Postcopulatory spermatozoa

These spermatozoa were collected from the B6D2F1 female uterus after copulation with the males and analyzed by light microscopy.

Light microscopy, immunofluorescence, and DIC

Light microscopic analyses were performed as previously reported²¹.

TEM and immunoelectron microscopy

TEM²¹ and immunoelectron microscopy³⁰ were performed as previously reported, with some modifications as follows. Spermatozoa removed from Tg(Odf4-Egfp) cauda epididymis were treated with 1% saponin in TYH followed by an antibody against GFP conjugated with 5 nm gold.

SMAS

Fresh spermatozoa were collected from the cauda epididymis. After incubation in a CO₂ incubator for 30 min, sperm motility and other characteristic parameters were quantitatively analyzed using an automated SMAS (DITECT Co. Ltd.), as previously described²⁹.

Comparative analysis of sperm ascension in the female reproductive tract

Tg(Eqtn-Egfp)Odf4^+/+ (control) and Tg(Eqtn-Egfp)Odf4^−/− males were used as experimental pairs. These Tg spermatozoa were traced and visualized by taking photographs under a Leica M165 FC fluorescence stereomicroscope, according to previously reported methods²⁹.

ATP and ADP concentration measurements

Measurements were performed for each ATP concentration (nmol/1 × 10⁴ sperm) and ADP concentration (RLU/1 × 10⁴ sperm) before and after capacitation in Odf4^+/+ (control) and Odf4^−/− spermatozoa, where RLU is an arbitrary unit (read luminescence on the luminometer) read by a luminometer with a Filter Max F5 (Molecular Device). The ATP concentration was measured using an Intracellular ATP assay kit ver. 2 (IC2-100 assay, Toyo B-Net.) with some modifications for nmol/1 × 10⁴ sperm, referring to a previously reported method¹⁰. The ADP concentration (RLU) was measured using an EnzyLight™ ADP/ATP Ratio Assay Kit (ELDT-100; BioAssay Systems).

Demembranation assay

This assay was performed according to previously reported methods³¹, with some modifications as described below and shown in Fig. S10. First, spermatozoa were allowed to swim in IVF dishes containing TYH medium in a CO2 incubator for 90 min. Then, for demembranation assays, 5 μl of the sperm suspension was transferred into 45 μl of the extraction solution containing 0.1% (v/v) Triton X-100, 200 mM sucrose, 25 mM glutamic acid, (25 mM KOH), 1 mM DTT, and 20 mM HEPES–NaOH (pH 7.4) in a test tube, transferred to 35 mm dishes and covered with mineral oil for video recordings. Then, approximately 120 min after the start of the initial incubation, a reactivation assay was performed as follows. Five microliters of the mixture containing the demembranated spermatozoa was transferred into 45 μl of the reactivation solution containing 200 mM sucrose, 25 mM glutamic acid, (25 mM KOH), 1 mM DTT, 1 mM EGTA, 4 mM MgSO4, 3 mM ATP, and 20 mM HEPES–NaOH (pH 7.4) in a test tube at 37 °C. Then, 5 μl of the incubated sperm suspension was similarly placed on a stage of DMi8 stereoscopy for video recording.

Video creation using a high-speed camera

Flagellar movement was recorded for analyses at 30 fps for 15 s under a DMi8 stereomicroscope equipped with neo PLAN × 20 or × 40 objective lenses and an MC170 HD camera (Leica). The original high-speed video (avi) was recorded at 1,027 × 1,024, Fps 1,000–1,200, SS 1/1,000 using DIPP-Motion V (ver. 1.1.35) software (DITECT) under a DMi8 stereomicroscope equipped with a HAS-U2 camera (DITECT). The videos were used to analyze movement using Premier Pro software (Adobe) and Adobe Photoshop CC 2019 (Adobe), depending on the purpose. In addition, images were taken from the video. The length of the subject was calculated in pixel mode, e.g., for a head length of approximately 7 μm. The flagellar beat frequency (F) is expressed by the following formula: F = 1 T, where F is the beat frequency (Hz) and T is the time (seconds) that were taken for videos; the raw data were recalculated as the beat frequency per second and are shown in Fig. 6.

Environmental osmolarity change effect

The osmolarity of the TYH medium for the sperm samples was adjusted to 150, 310, 380, and 440 mOsm/kg using 1 M NaCl by calculation with a digital micro osmometer (Genotec Osmomat 3000); this condition was used for the in vitro assay. Spermatozoa passing through the epididymis were recovered from each region from the caput to the cauda epididymis (Fig. S11) and immediately subjected to experiments without any treatment. Analyses (quantification) were performed after obtaining images according to the criteria of flagellar shapes shown at the top of the panel in Fig. S11.

Statistics

Data are shown as the mean ± standard error of the mean (SEM) after statistical analysis (*P < 0.05 or **P < 0.01) by the method written in each graph (Figs. 2, 3, 5, 6, 7).

Data availability

The original contributions presented in this study are publicly available. KO and Tg mice used in this study have been deposited into the Mouse Genome Informatics (MGI) [J: 327,405 (PubMed ID), MGI 7,331,638 for Odf4-null (Odf4^−/−), and MGI 7,331,643 for Tg(Odf4-Egfp) and Tg(Odf2-mCherry)]. The datasets that support the findings of this study are available here: “figshare” at https://figshare.com. All other data are available in the main text and supplementary information.

References

Toshimori, K. & Eddy, E. M. in Knobil and Neill's Physiology of Reproduction Vol. 1 (eds T.M. Plant & A.J. Zeleznik) Ch. 3, 99–148 (Academic Press, 2014).
WHO. WHO laboratory manual for the Examination and processing of human semen. Fifth EDITION (2010).
Nakamura, Y. et al. Molecular cloning and characterization of oppo 1: A haploid germ cell-specific complementary DNA encoding sperm tail protein. Biol. Reprod. 67, 1–7. https://doi.org/10.1095/biolreprod67.1.1 (2002).
Article CAS PubMed Google Scholar
Kitamura, K. et al. Molecular cloning and characterization of the human orthologue of the oppo 1 gene encoding a sperm tail protein. Mol. Hum. Reprod. 9, 237–243 (2003).
Article CAS PubMed Google Scholar
Cooper, T. G. The epididymis, cytoplasmic droplets and male fertility. Asian J. Androl. 13, 130–138. https://doi.org/10.1038/aja.2010.97 (2011).
Article PubMed Google Scholar
Hermo, L., Oliveira, R. L., Smith, C. E., Au, C. E. & Bergeron, J. J. M. Dark side of the epididymis: Tails of sperm maturation. Andrology 7, 566–580. https://doi.org/10.1111/andr.12641 (2019).
Article CAS PubMed Google Scholar
Yuan, S., Zheng, H., Zheng, Z. & Yan, W. Proteomic analyses reveal a role of cytoplasmic droplets as an energy source during epididymal sperm maturation. PLoS ONE 8, e77466. https://doi.org/10.1371/journal.pone.0077466 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
Dzeja, P. & Terzic, A. Adenylate kinase and AMP signaling networks: metabolic monitoring, signal communication and body energy sensing. Int. J. Mol. Sci. 10, 1729–1772. https://doi.org/10.3390/ijms10041729 (2009).
Article CAS PubMed PubMed Central Google Scholar
Leigh, M. W. et al. Clinical and genetic aspects of primary ciliary dyskinesia/Kartagener syndrome. Genet. Med. 11, 473–487. https://doi.org/10.1097/GIM.0b013e3181a53562 (2009).
Article PubMed PubMed Central Google Scholar
Miki, K. et al. Glyceraldehyde 3-phosphate dehydrogenase-S, a sperm-specific glycolytic enzyme, is required for sperm motility and male fertility. Proc. Natl. Acad. Sci. U S A 101, 16501–16506. https://doi.org/10.1073/pnas.0407708101 (2004).
Article ADS CAS PubMed PubMed Central Google Scholar
Mukai, C. & Okuno, M. Glycolysis plays a major role for adenosine triphosphate supplementation in mouse sperm flagellar movement. Biol. Reprod. 71, 540–547. https://doi.org/10.1095/biolreprod.103.026054 (2004).
Article CAS PubMed Google Scholar
Krisfalusi, M., Miki, K., Magyar, P. L. & O’Brien, D. A. Multiple glycolytic enzymes are tightly bound to the fibrous sheath of mouse spermatozoa. Biol. Reprod. 75, 270–278. https://doi.org/10.1095/biolreprod.105.049684 (2006).
Article CAS PubMed Google Scholar
Atkinson, D. E. The energy charge of the adenylate pool as a regulatory parameter. Interaction with feedback modifiers. Biochemistry (Mosc) 7, 4030–4034. https://doi.org/10.1021/bi00851a033 (1968).
Article CAS Google Scholar
Goldberg, R. N., Tewari, Y. B. & Bhat, T. N. Thermodynamics of enzyme-catalyzed reactions–a database for quantitative biochemistry. Bioinformatics 20, 2874–2877. https://doi.org/10.1093/bioinformatics/bth314 (2004).
Article CAS PubMed Google Scholar
Cao, W., Haig-Ladewig, L., Gerton, G. L. & Moss, S. B. Adenylate kinases 1 and 2 are part of the accessory structures in the mouse sperm flagellum. Biol. Reprod. 75, 492–500. https://doi.org/10.1095/biolreprod.106.053512 (2006).
Article CAS PubMed Google Scholar
Xie, M. et al. Adenylate kinase 1 deficiency disrupts mouse sperm motility under conditions of energy stress. Biol. Reprod. https://doi.org/10.1093/biolre/ioaa134 (2020).
Article PubMed PubMed Central Google Scholar
Vadnais, M. L. et al. Adenine nucleotide metabolism and a role for AMP in modulating flagellar waveforms in mouse sperm. Biol. Reprod. 90, 128. https://doi.org/10.1095/biolreprod.113.114447 (2014).
Article CAS PubMed PubMed Central Google Scholar
Pucar, D. et al. Compromised energetics in the adenylate kinase AK1 gene knockout heart under metabolic stress. J. Biol. Chem. 275, 41424–41429. https://doi.org/10.1074/jbc.M007903200 (2000).
Article CAS PubMed Google Scholar
Dzeja, P. P., Bast, P., Pucar, D., Wieringa, B. & Terzic, A. Defective metabolic signaling in adenylate kinase AK1 gene knock-out hearts compromises post-ischemic coronary reflow. J. Biol. Chem. 282, 31366–31372. https://doi.org/10.1074/jbc.M705268200 (2007).
Article CAS PubMed Google Scholar
Janssen, E. M., van Oosterhout, A. J., Nijkamp, F. P., van Eden, W. & Wauben, M. H. The efficacy of immunotherapy in an experimental murine model of allergic asthma is related to the strength and site of T cell activation during immunotherapy. J. Immunol. 165, 7207–7214. https://doi.org/10.4049/jimmunol.165.12.7207 (2000).
Article CAS PubMed Google Scholar
Ito, C. et al. Odf2 haploinsufficiency causes a new type of decapitated and decaudated spermatozoa, Odf2-DDS, in mice. Sci. Rep. 9, 14249. https://doi.org/10.1038/s41598-019-50516-2 (2019).
Article ADS CAS PubMed PubMed Central Google Scholar
Chen, Q. et al. Aquaporin3 is a sperm water channel essential for postcopulatory sperm osmoadaptation and migration. Cell Res. 21, 922–933. https://doi.org/10.1038/cr.2010.169 (2011).
Article CAS PubMed Google Scholar
Tuck, R. R., Setchell, B. P., Waites, G. M. & Young, J. A. The composition of fluid collected by micropuncture and catheterization from the seminiferous tubules and rete testis of rats. Pflugers Arch. 318, 225–243. https://doi.org/10.1007/bf00593663 (1970).
Article CAS PubMed Google Scholar
Touré, A. et al. The testis anion transporter 1 (Slc26a8) is required for sperm terminal differentiation and male fertility in the mouse. Hum. Mol. Genet. 16, 1783–1793. https://doi.org/10.1093/hmg/ddm117 (2007).
Article CAS PubMed Google Scholar
Maruyama, S. Y. et al. A critical role of solute carrier 22a14 in sperm motility and male fertility in mice. Sci. Rep. 6, 36468. https://doi.org/10.1038/srep36468 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Lores, P. et al. Homozygous missense mutation L673P in adenylate kinase 7 (AK7) leads to primary male infertility and multiple morphological anomalies of the flagella but not to primary ciliary dyskinesia. Hum. Mol. Genet. 27, 1196–1211. https://doi.org/10.1093/hmg/ddy034 (2018).
Article CAS PubMed Google Scholar
Ito, C. et al. Integration of the mouse sperm fertilization-related protein equatorin into the acrosome during spermatogenesis as revealed by super-resolution and immunoelectron microscopy. Cell Tissue Res. 352, 739–750. https://doi.org/10.1007/s00441-013-1605-y (2013).
Article CAS PubMed Google Scholar
Watanabe, D. et al. Characterization of the testis-specific gene “calmegin” promoter sequence and its activity defined by transgenic mouse experiments. FEBS Lett. 368, 509–512 (1995).
Article CAS PubMed Google Scholar
Ito, C. et al. Deletion of Eqtn in mice reduces male fertility and sperm-egg adhesion. Reproduction https://doi.org/10.1530/REP-18-0394 (2018).
Article PubMed Google Scholar
Ito, C. et al. Tetraspanin family protein CD9 in the mouse sperm: unique localization, appearance, behavior and fate during fertilization. Cell Tissue Res. 340, 583–594. https://doi.org/10.1007/s00441-010-0967-7 (2010).
Article CAS PubMed Google Scholar
Gibbons, B. H. & Gibbons, I. R. The effect of partial extraction of dynein arms on the movement of reactivated sea-urchin sperm. J. Cell Sci. 13, 337–357 (1973).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank Drs J Takeda and T Ijiri for providing the targeting vector. We thank Dr. Lisa Fujimura (Biomedical Research Center, Chiba University) and Dr. Masahiko Hatano (Department of Biomedical Science, Graduate School of Medicine, Chiba University) for their technical support in generating Tg(Odf2-mCherry) mice. We thank AJE (www.aje.com/jp) for English language editing.

Funding

This study was supported by the Core Research for Evolutional Science and Technology of the Japan Science and Technology Agency, CREST/JST to K.T. through M.K. (JPMJCR14M1) and in part by a Grant-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan to C.I. (19K0665).

Author information

These authors contributed equally: Chizuru Ito and Kiyotaka Toshimori.

Authors and Affiliations

Department of Functional Anatomy, Reproductive Biology and Medicine, Graduate School of Medicine, Chiba University, Chiba, 260-8670, Japan
Chizuru Ito, Tohru Mutoh & Kiyotaka Toshimori
Department of Cell Biology and Anatomy, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan
Tsukasa Makino & Masahide Kikkawa
Future Medicine Research Center, Chiba University, Chiba, 260-8670, Japan
Kiyotaka Toshimori

Authors

Chizuru Ito
View author publications
You can also search for this author in PubMed Google Scholar
Tsukasa Makino
View author publications
You can also search for this author in PubMed Google Scholar
Tohru Mutoh
View author publications
You can also search for this author in PubMed Google Scholar
Masahide Kikkawa
View author publications
You can also search for this author in PubMed Google Scholar
Kiyotaka Toshimori
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

C.I. and K.T. designed the research, performed all experiments, and analyzed the data with the help of T.Mu., T.Ma., and M.K., C.I., T.Mu. and K.T. generated Odf4 KO and Tg mice. C.I. and K.T. wrote the manuscript with the help of T.Ma. and M.K.

Corresponding authors

Correspondence to Chizuru Ito or Kiyotaka Toshimori.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary Information 1.

Supplementary Information 2.

Supplementary Information 3.

Supplementary Video 1.

Supplementary Video 2.

Supplementary Video 3.

Supplementary Video 4.

Supplementary Video 5.

Supplementary Video 6.

Supplementary Video 7.

Supplementary Video 8.

Supplementary Video 9.

Supplementary Video 10.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Ito, C., Makino, T., Mutoh, T. et al. The association of ODF4 with AK1 and AK2 in mice is essential for fertility through its contribution to flagellar shape. Sci Rep 13, 2969 (2023). https://doi.org/10.1038/s41598-023-28177-z

Download citation

Received: 12 March 2022
Accepted: 12 January 2023
Published: 20 February 2023
DOI: https://doi.org/10.1038/s41598-023-28177-z

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Subjects

Abstract

Similar content being viewed by others

CFAP45 deficiency causes situs abnormalities and asthenospermia by disrupting an axonemal adenine nucleotide homeostasis module

The missing linker between SUN5 and PMFBP1 in sperm head-tail coupling apparatus

DNALI1 deficiency causes male infertility with severe asthenozoospermia in humans and mice by disrupting the assembly of the flagellar inner dynein arms and fibrous sheath

Introduction

Results

Odf4 expression and localization of ODF4, AK1 and AK2

Characterization of Odf4 −/− mice and spermatozoa

AK1 and AK2 in spermatozoa and immunoprecipitation (IP)

Sperm ascension in the female reproductive tract

ATP and ADP concentrations before and after capacitation

Flagellar motility analysis

Demembranation assay

Environmental osmolarity changes do not affect Odf4 −/− flagellar angulation

Rescue experiments

Discussion

Materials and methods

Ethical approval and animals

Antibodies

Generation of KO mice, B6(Cg)-Odf4 em1: Odf4-null (Odf4 −/−) mice

Generation of Tg mice

RT‒PCR

SDS‒PAGE and western blotting

IP

Fertility test

Morphology and motility assays

Postcopulatory spermatozoa

Light microscopy, immunofluorescence, and DIC

TEM and immunoelectron microscopy

SMAS

Comparative analysis of sperm ascension in the female reproductive tract

ATP and ADP concentration measurements

Demembranation assay

Video creation using a high-speed camera

Environmental osmolarity change effect

Statistics

Data availability

References

Acknowledgements

Funding

Author information

Authors and Affiliations

Contributions

Corresponding authors

Ethics declarations

Competing interests

Additional information

Publisher's note

Supplementary Information

Supplementary Information 1.

Supplementary Information 2.

Supplementary Information 3.

Rights and permissions

About this article

Cite this article

Share this article

Comments

Search

Quick links

Characterization of Odf4 ^−/− mice and spermatozoa

Environmental osmolarity changes do not affect Odf4 ^−/− flagellar angulation

Generation of KO mice, B6(Cg)-Odf4 ^em1: Odf4-null (Odf4 ^−/−) mice