Capsaicin directly promotes adipocyte browning in the chemical compound-induced brown adipocytes converted from human dermal fibroblasts

Takeda, Yukimasa; Dai, Ping

doi:10.1038/s41598-022-10644-8

Download PDF

Article
Open access
Published: 22 April 2022

Capsaicin directly promotes adipocyte browning in the chemical compound-induced brown adipocytes converted from human dermal fibroblasts

Yukimasa Takeda¹ &
Ping Dai¹

Scientific Reports volume 12, Article number: 6612 (2022) Cite this article

5303 Accesses
9 Citations
5 Altmetric
Metrics details

Subjects

Abstract

Human brown fat is a potential therapeutic target for preventing obesity and related metabolic diseases by dissipating energy as heat through uncoupling protein 1 (UCP1). We have previously reported a method to obtain chemical compound-induced brown adipocytes (ciBAs) converted from human dermal fibroblasts under serum-free conditions. However, pharmacological responses to bioactive molecules have been poorly characterised in ciBAs. This study showed that the treatment with Capsaicin, an agonist of transient receptor potential vanilloid 1, directly activated adipocyte browning such as UCP1 expression, mitochondrial biogenesis, energy consumption rates, and glycerol recycling in ciBAs. Furthermore, genome-wide transcriptome analysis indicated that Capsaicin activated a broad range of metabolic genes including glycerol kinase and glycerol 3-phosphate dehydrogenase 1, which could be associated with the activation of glycerol recycling and triglyceride synthesis. Capsaicin also activated UCP1 expression in immortalised human brown adipocytes but inhibited its expression in mesenchymal stem cell-derived adipocytes. Altogether, ciBAs successfully reflected the direct effects of Capsaicin on adipocyte browning. These findings suggested that ciBAs could serve as a promising cell model for screening of small molecules and dietary bioactive compounds targeting human brown adipocytes.

A conserved complex lipid signature marks human muscle aging and responds to short-term exercise

Article 12 April 2024

Georges E. Janssens, Marte Molenaars, … Riekelt H. Houtkooper

Adipose tissue macrophages secrete small extracellular vesicles that mediate rosiglitazone-induced insulin sensitization

Article 11 April 2024

Theresa V. Rohm, Felipe Castellani Gomes Dos Reis, … Jerrold M. Olefsky

Trigonelline is an NAD+ precursor that improves muscle function during ageing and is reduced in human sarcopenia

Article Open access 19 March 2024

Mathieu Membrez, Eugenia Migliavacca, … Jerome N. Feige

Introduction

Obesity is caused by a chronic energy imbalance between energy intake and expenditure¹. It is a major risk factor for cardiovascular and metabolic diseases, including type 2 diabetes. Owing to the obesity pandemic, new therapeutic interventions that can safely enhance energy expenditure are in demand to combat it. White adipocytes are specialised for the storage of excess energy in the form of triglycerides, whereas brown adipocytes produce heat by dissipating energy to resist hypothermia^2,3,4. Uncoupling protein 1 (UCP1), a brown adipocyte-specific protein located in the mitochondrial inner membrane, uncouples fatty acid oxidation from mitochondrial production of adenosine triphosphate (ATP)⁵. The activation of human brown adipose tissue (BAT) by cold exposure reportedly improves whole body energy expenditure and systemic glucose homeostasis^6,7,8. The prevalence and activity in human BAT are associated with a lower body fat mass, decreased age, and higher plasma docosahexaenoic acid levels⁹. The clinical significance has been well studied in murine brown/beige adipocytes¹⁰. Expanded beige adipocyte population in white adipose tissue (WAT) was associated with increased energy expenditure, body weight loss, and improved insulin sensitivity. Recently, a retrospective study using ¹⁸F-fluorodeoxyglucose positron emission tomography–computed tomography scans in a large cohort suggested that brown fat improves the levels of blood glucose, triglycerides, and high-density lipoproteins¹¹. The study has also demonstrated that brown fat is associated with a lower risk of type 2 diabetes, dyslipidemia, coronary artery disease, cerebrovascular disease, congestive heart failure, and hypertension, indicating the potential of brown fat to improve cardiometabolic health in humans¹¹. Therefore, we expect that identifying drugs and dietary compounds that enhance brown fat activity and adipogenesis may foster a safe and effective nutritional intervention strategy to prevent obesity.

Several food ingredients exert anti-obesity effects through the activation of Transient-receptor potential vanilloid 1 (TRPV1)¹², a known receptor of Capsaicin, the principal pungent ingredient in chili peppers¹³. Accumulating evidence has suggested that prolonged administration of either Capsaicin or Capsinoids, non-pungent Capsaicin analogues, for several weeks resulted in beneficial effects on fat oxidation, energy expenditure, insulin sensitivity, and body fat mass in both rodents and adult humans^14,15,16,17. Although the mechanism of action of Capsaicin involves multiple tissues, its anti-obesity effects are mediated by the activation of the sympathetic nervous system via TRPV1 on sensory neurons^{18,19,20,21,22}. Norepinephrine (NE) secreted at the end of sympathetic nerves increases cellular levels of cAMP via β-adrenergic receptors, which overlaps with cold-induced thermogenesis pathway. cAMP activates CREB and ATF2, the downstream transcription factors, to activate a series of thermogenic genes including Ucp1²³. Besides Capsaicin and Capsinoids, other dietary compounds such as eicosapentaenoic acid and 10-Oxo-12(Z)-octadecenoic acid similarly exerted anti-obesity effects via the activation of TRPV1^24,25. In contrast, a limited number of studies have shown direct effects of Capsaicin in metabolic tissues such as liver, kidney, pancreas, gastrointestinal tract, WAT, and BAT, where TRPV1 is expressed^26,27. For example, treatment with Capsaicin in murine 3T3-L1 adipocytes suppressed adipogenesis and decreased triglyceride accumulation^28,29, although the high-dose regimen increased lipid accumulation³⁰. In HB2 immortalised mouse brown preadipocytes, TRPV1 expression was induced during adipocyte differentiation³¹. Capsaicin addition in the early stage of the differentiation did not affect the transcription of adipogenic genes such as Fabp4, Ppargc1a, and Pparg, whereas the treatment in the late stage slightly activated their expression. In both experimental conditions, Ucp1 expression was not changed and the induction of Ucp1 by Forskolin was decreased. In a subsequent study, the same group showed that the treatment with Capsaicin at a supra-pharmacological concentration activated the expression of Ucp1, Ppargc1a, and Elovl3 along with efficient differentiation and lipid accumulation in HB2 adipocytes³². However, the treatment with a strong TRPV1 antagonist, 5′-Iodoresiniferatoxin, did not inhibit Capsaicin-induced Ucp1 expression and lipid accumulation, suggesting that these effects were TRPV1-independent. The authors of the study suggested that endoplasmic reticulum stress caused by the supra-pharmacological concentration was responsible for Capsaicin-induced brown adipogenesis in HB2 adipocytes. Thus, the positive effects of Capsaicin have remained unclear, especially in human brown adipocytes.

We have previously developed a technique for direct conversion from human dermal fibroblasts into chemical compound-induced brown adipocytes (ciBAs) under serum-containing or serum-free culture conditions^33,34,35. Furthermore, in a recent study, we have shown that ciBAs undergo a broad range of transcriptional changes that resemble adipocyte browning in adipose tissue-derived mesenchymal stem cells (AdMSCs)³⁶. One of the most characteristic differences between them is the expression pattern of major uncoupling proteins. ciBAs expressed UCP1 at a higher level than the AdMSC-derived adipocytes which predominantly expressed UCP2, indicating that ciBAs might serve as a promising model for human brown adipocytes. The availability of human primary brown fat is limited owing to its scarceness, the fragile nature, and an invasive procedure to obtain biopsies³⁷. In this context, an appropriate in vitro model for human brown/beige adipocytes is required for basic research, drug screening, and future clinical use. Therefore, in this study, we aimed to analyse the direct effects of Capsaicin as an agonist of TRPV1 on adipocyte browning in ciBAs. Furthermore, we verified whether the response in ciBAs was valid by comparing the response in the AdMSC-derived adipocytes.

Results

Capsaicin enhances UCP1 expression and efficiency of the direct conversion into ciBAs

ciBAs were converted from human dermal fibroblasts by a serum-free brown adipogenic medium (SFBAM) including the chemical cocktail (RoFB) consisting of Rosiglitazone, Forskolin, and BMP7 as previously reported³⁴. To evaluate the pharmacological response through TRPV1 in ciBAs, Capsaicin was additionally treated during the direct conversion. The expression of the brown adipocyte-specific marker, UCP1, was increased in the presence of Capsaicin at concentrations higher than 2 μM, and reached to its highest at 25 μM obviously (Fig. 1A). The expression of an adipocyte-enriched gene, FABP4, was also moderately increased at concentrations of 25 and 50 μM (Fig. 1B). The ratio of the expression of UCP1 to FABP4 was used as an indicator to evaluate the effects of Capsaicin on adipocyte browning in ciBAs (Fig. 1C). The ratio was approximately three times higher at 25 μM than that of the Capsaicin-untreated control. Immunoblotting analysis showed that UCP1 protein levels were induced at a concentration of 25 μM (Fig. 1D). Furthermore, immunocytochemical analysis indicated that cells stained with Lipi-Red expressed UCP1 in both ciBAs and Capsaicin-treated ciBAs (Fig. 1E). The increased number of UCP1-positive and adipocyte-like cells indicated that Capsaicin also enhanced the conversion efficiency (Fig. 1F). Capsaicin treatment at 5 and 25 μM for 3 weeks enhanced cell viability and reduced cytotoxicity (Fig. 1G). Transient treatment with Capsaicin for a few days before harvesting had almost no effect on the expression of UCP1 and FABP4 (Fig. 1H). Their expression was increased by the incubation for more than 7 days, suggesting that prolonged treatment was required to elicit the effects of Capsaicin to activate UCP1 in ciBAs.

Cellular mitochondrial levels and respiration in Capsaicin-treated ciBAs

Next, we assessed mitochondrial biogenesis and oxygen consumption rate (OCR) in Capsaicin-treated ciBAs. The ratio of copy numbers of mitochondrial DNA to nuclear DNA was increased in ciBAs and further increased in Capsaicin-treated ciBAs (Fig. 2A). The elevated mitochondrial levels by Capsaicin were also supported by the increased expression of mitochondria-encoded genes, MT-CYB and MT-ND5 (Fig. 2B). Immunoblotting analysis showed that mitochondrial marker proteins, COX4 and VDAC1, were more abundant in Capsaicin-treated ciBAs (Fig. 2C). The OCR in Capsaicin-treated ciBAs (RoFB + Capsaicin) was upregulated compared to that in the untreated ciBAs (RoFB) and typically varied by adding the inhibitors of the mitochondrial electron transfer chain (Fig. 2D). The OCR corresponding to basal respiration, maximal respiration, and spare respiratory capacity was significantly increased in Capsaicin-treated ciBAs (Fig. 2E). In particular, the OCR corresponding to ATP production and proton leak was also higher in Capsaicin-treated ciBAs than that in the untreated ciBAs (Fig. 2F). The energy phenotype profile displayed by a scatter plot of OCR and extracellular acidification rate (ECAR) indicated that Capsaicin-treated ciBAs had a higher metabolic potential under both basal and stressed conditions than the untreated ciBAs (Fig. 2G). These results suggested that treatment with Capsaicin activated mitochondrial respiration and glycolysis in ciBAs.

Ligands for TRPV1 and TRPV4 regulate UCP1 expression in ciBAs

To address whether TRPV1 regulates UCP1 expression in ciBAs, agonists and antagonists of TRPV1 were examined. Thermos-sensitive TRP channels, TRPV1-4, are expressed in adipose tissues and are also involved in the regulation of brown adipocytes³⁸. TRPV1 expression did not change in either Capsaicin-treated or -untreated ciBAs, but the expression of the other TRP channels was decreased in these ciBAs (Fig. 3A). Treatment with Nonivamide, a TRPV1 agonist, activated the expression of UCP1 and cell death-inducing DNA fragmentation factor-like effector A (CIDEA), a brown adipocyte-enriched gene, in a dose-dependent manner (Fig. 3B). FABP4 expression was also increased by Nonivamide, similar to the results in the treatment with Capsaicin. On the contrary, Capsazepine and AMG9810, selective TRPV1 antagonists, repressed the transcriptional activation of UCP1 and CIDEA genes by Capsaicin in a dose-dependent manner (Fig. 3C,D). However, Capsazepine at 10 μM and AMG9810 at 3 μM slightly inhibited FABP4 expression, and the expression of both UCP1 and CIDEA was more strongly repressed. TRPV4 has been reported to negatively regulate thermogenic gene expression in adipose tissues³⁹. The treatment with GSK1016790A, a synthetic agonist of TRPV4, suppressed the expression of UCP1 and CIDEA in a dose-dependent manner (Fig. 3E). These results indicated that the expression of UCP1 and CIDEA genes was properly regulated through TRPV1 and TRPV4 in ciBAs.

Capsaicin activates a broad range of metabolic genes in ciBAs

To identify which genes other than UCP1 are regulated by Capsaicin treatment, genome-wide transcriptional analysis was performed. We have previously reported a comparison of RNA-sequencing (RNA-Seq) results between ciBAs and the control fibroblasts²⁷. A comparison between the RNA-Seq data of Capsaicin-treated ciBAs (RoFB + Capsaicin) and the control fibroblasts (NoC) detected 1657 upregulated and 1279 downregulated differentially expressed genes (DEGs) (Supplementary Fig. S1A). Gene ontology (GO) enrichment analysis showed that the up-regulated DEGs were largely categorised into functional groups such as fatty acid metabolism and mitochondria, while the down-regulated DEGs were grouped into the extracellular matrix (Supplementary Fig. S1B,C), which is similar to our previous results on ciBAs and the control²⁷.

In the comparison between ciBAs (RoFB) and Capsaicin-treated ciBAs (RoFB + Capsaicin), 987 upregulated and 600 downregulated DEGs were identified (Fig. 4A). The smear and volcano plots showed that these DEGs with over two-fold changes (FCs) were appropriately distributed with widespread CPM (counts per million) and P-values. Venn diagrams represented that 447 up- and 354 down-regulated DEGs were overlapped in these ciBAs (Fig. 4B). The GO enrichment analysis suggested that the up- and down-regulated DEGs were mainly categorised into the functional groups related to lipid metabolism and extracellular matrix, respectively (Fig. 4C). Heat maps represented that the treatment with Capsaicin more enhanced the expression of a series of genes involved in the fatty acid synthesis, β-oxidation, tricarboxylic acid (TCA) cycle, glycolysis (Fig. 4D), and adaptive thermogenesis (Supplementary Fig. S2). Representative up- and down-regulated DEGs are listed in Supplementary Tables S1 and S2. The qRT-PCR analysis confirmed that Capsaicin-treated ciBAs increased the transcription of lipid metabolic genes such as LIPG, CIDEA, CKMT1, CD36, SCD, KCNK3, SREBF1, FASN, PLIN1, LIPE, and ADIPOQ (Fig. 4E). In contrast, the expression of AEBP1, a transcriptional repressor of adipogenesis, was more suppressed in Capsaicin-treated ciBAs. The RNA-Seq results also suggested that several transcription factors and coregulators for brown adipogenesis and UCP1 transcription were increased by Capsaicin treatment (Supplementary Fig. S3A,B). Moreover, the qRT-PCR analysis confirmed that the expression of CEBPA and RXRG, but not PPARGC1 and PPARG, was activated in Capsaicin-treated ciBAs (Fig. 4F). Several other nuclear receptors such as LXRA, RORC, NR4A2, and NR4A3, which might be involved in the transcriptional regulation of UCP1 and other metabolic genes, were also activated (Supplementary Fig. S3C). In addition, the RNA-Seq results indicated the elevated expression of several brown/beige adipocyte-enriched genes (Fig. 4G). The expression of CITED1 and MTUS1 was upregulated in both ciBAs and Capsaicin-treated ciBAs, whereas the expression of TBX1, TMEM26, NRF1, and NFE2L2 (NRF2) was not increased in ciBAs and Capsaicin-treated ciBAs. PRDM16, FGF21, and CD137 genes were not detected owing to their low expression levels. Among β-adrenergic receptors, the expression of ADBR2 was the highest, and its expression was enhanced by Capsaicin treatment. The RNA-Seq results also showed the elevated expression of VEGFA and ADIPOQ. These results indicated that Capsaicin activated the transcription of not only UCP1 gene but also a broad range of metabolic genes.

Reduced glycerol release and accumulation of triglycerides in Capsaicin-treated ciBAs

Brown adipocytes possess distinct features of lipid metabolism that are different from those of white adipocytes^40,41. Glycerol secretion was increased in ciBAs compared with that in the control, however, the secretion was apparently reduced in Capsaicin-treated ciBAs (Fig. 5A). Reduced glycerol release was also observed a few days after the treatment with Capsaicin (Supplementary Fig. S4). Secreted non-esterified fatty acids (NEFAs) were not altered between Capsaicin-treated and untreated ciBAs (Fig. 5B), indicating that lipolysis was not reduced in Capsaicin-treated ciBAs. In contrast, cellular glycerol content was higher in Capsaicin-treated ciBAs than in the untreated ciBAs (Fig. 5C). These observations indicated that glycerol secreted into the medium was actively recovered in Capsaicin-treated ciBAs. A heat map obtained from the RNA-Seq results showed that a series of genes encoding enzymes involved in triglyceride metabolism were activated in Capsaicin-treated ciBAs (Fig. 5D). Reportedly, recovered glycerol is first phosphorylated by glycerol kinase (GK), then, recycled into triglycerides by GAPT, AGPAT, LPIN, and DGAT enzymes⁴². The qRT-PCR analysis confirmed that the expression of GK, GPAM, AGPAT2, LPIN3, DGAT2, and AQP7 was increased in Capsaicin-treated ciBAs (Fig. 5E). Moreover, cellular triglycerides were more accumulated in Capsaicin-treated ciBAs than in untreated ciBAs (Fig. 5F). The triglyceride accumulation was also supported by higher glycerol-3-phosphate dehydrogenase (GPDH) activity and increased expression of GPD1 gene, responsible for cytoplasmic GPDH activity (Fig. 5G). Taken together, these results suggested that Capsaicin could promote glycerol recycling in ciBAs through the transcriptional activation of related metabolic genes.

Capsaicin negatively affects adipocyte browning in mesenchymal stem cell-derived adipocytes

We have previously reported that adipocytes differentiated from AdMSCs under the same culture conditions as ciBAs predominantly expressed UCP2 rather than UCP1²⁷. To verify whether Capsaicin treatment similarly induces UCP1 expression, AdMSC-derived adipocytes were tested. The treatment with Capsaicin reduced the expression of UCP1 in a dose-dependent manner without a significant change in FABP4 expression (Fig. 6A). In contrast, the treatment with GSK1016970A upregulated UCP1 expression (Fig. 6B). These responses against TRPV1 and TRPV4 agonists in AdMSC-derived adipocytes were opposite to those in ciBAs. Although glycerol secretion was reduced by Capsaicin in AdMSC-derived adipocytes, cellular glycerol content was also reduced (Fig. 6C). In addition, triglyceride accumulation and GPDH activity were reduced by Capsaicin treatment (Fig. 6D). The adipocytes decreased the expression of several metabolic genes such as CIDEA, CD36, PLIN1, and LIPE, which was activated by Capsaicin in ciBAs (Fig. 6E). In particular, reduced expression of key transcriptional factors such as CEBPA, PPARG, and RXRG suggested that Capsaicin treatment had adverse effects on lipid metabolism and metabolic gene expression in AdMSC-derived adipocytes. To further confirm the effects of Capsaicin on the regulation of UCP1 expression, two other lines of human dermal fibroblasts (HDFs), AdMSCs, and bone marrow-derived mesenchymal stem cells (BmMSCs) were examined (Fig. 6F). ciBAs converted from HDF35 and HDF54 in the presence of Capsaicin exhibited higher expression levels of both UCP1 and FABP4 genes. In contrast, UCP1 expression was either decreased or showed almost no change in MSC-derived adipocytes differentiated in the presence of Capsaicin from the two AdMSCs (AdMSC38 and AdMSC51) and BmMSCs (BmMSC70 and BmMSC71). On the contrary, Capsaicin activated the expression of UCP1 and FABP4 in adipocytes differentiated from an immortalised human brown preadipocyte cell line (hTERT A41hBAT-SVF) (Fig. 6G). Collectively, these results suggested that Capsaicin positively regulated UCP1 expression in ciBAs and the immortalised human brown adipocytes but not in MSC-derived adipocytes.

Discussion

In this study we successfully identified the direct effects of Capsaicin on adipocyte browning in ciBAs converted from human dermal fibroblasts (Fig. 7). The treatment of Capsaicin during the direct conversion induced UCP1 expression and promoted the conversion efficiency itself. The effects of TRPV1 agonists and antagonists on UCP1 expression implicated that the effects could be mediated through TRPV1 in ciBAs. The RNA-Seq analysis revealed that Capsaicin activated not only UCP1 gene but also a series of metabolic genes involved in triglyceride metabolism, fatty acid metabolism, glycolysis pathway, and adaptive thermogenesis. Many of them were overlapped with genes activated during the direct conversion into ciBAs, as shown in our previous analysis³⁶, indicating that these metabolic genes are closely associated with functions in brown adipocytes. In addition, this study revealed that Capsaicin activated mitochondrial biogenesis, oxygen consumption, glycolysis, glycerol recycling, and triglyceride accumulation. In this study, the direct effects of Capsaicin on ciBAs were observed as a result of both the enhanced populations of ciBAs and their maturation. The increased conversion efficiency likely contributes to the metabolic gene expression and the observations unique to brown adipocytes. These brown-like phenotypes activated by Capsaicin in ciBAs are likely involved in the process of their maturation and adipocyte browning. Overall, prolonged treatment with Capsaicin directly promotes the conversion efficiency and adipocyte browning in ciBAs.

Our previous report suggested that the direct conversion to ciBAs underwent genome-wide transcriptional changes similar to the adipocyte browning in AdMSCs³⁶. In contrast, one of the most characteristic differences between them was the expression pattern of major uncoupling proteins. ciBAs more expressed higher levels of UCP1, whereas the AdMSC-derived adipocytes predominantly expressed UCP2. The latter possesses a weaker uncoupling activity and is expressed in WAT rather than BAT. To further clarify the differences between these adipocyte models, in this study, we examined the effects of Capsaicin in AdMSC-derived adipocytes differentiated under the same culture conditions as ciBAs. Notably, Capsaicin rather repressed the expression of UCP1 and several metabolic genes in AdMSC-derived adipocytes (Fig. 6A,E). In contrast, the TRPV4 agonist, GSK1016790A, increased UCP1 expression (Fig. 6B), which was opposite to the response in ciBAs. In addition, Capsaicin did not similarly regulate the cellular levels of glycerol and triglycerides (Fig. 6C,D). Other reports have indicated that in 3T3-L1 white adipocytes Capsaicin inhibited adipogenesis, triglyceride accumulation, GPDH activity, and the expression of PPARG and CEBPA^28,43, suggesting that TRPV1 might play a different role in white and brown adipocytes. Furthermore, the effect of Capsaicin was validated using an immortalised brown preadipocyte cell line isolated from human neck fat that activated UCP1 expression in response to Capsaicin (Fig. 6G). Consistent with our findings, several studies in mice have shown that TRPV1 and TRPV4 positively and negatively regulate thermogenic genes and brown phenotypes^32,38,39. These findings supported that ciBAs reflected more appropriate responses to these agonists than AdMSC-derived adipocytes, at least under the culture conditions.

It has been known that secreted glycerol is not recycled in white adipocytes due to a lower activity of glycerol kinase⁴⁴. One of the characteristic metabolic changes induced by Capsaicin was the apparent reduction in glycerol release (Fig. 5A). In general, it is considered to be caused by either decreased lipolysis or increased glycerol uptake. However, it was unlikely that lipolysis was reduced because the level of NEFA secretion did not much change significantly in Capsaicin-treated ciBAs (Fig. 5B). This was also supported by the increase of the OCR and ECAR in Capsaicin-treated ciBAs (Fig. 2G), which indicated that energy expenditure was more enhanced by Capsaicin in ciBAs. In addition, the activation of GK, GPAM, AGPAT2, LPIN3, and DGAT2 genes encoding key enzymes in the triglyceride synthesis pathway likely contributed to glycerol recycling^41,42 (Fig. 5E). The triglyceride accumulation in Capsaicin-treated ciBAs was also supported by elevated GPDH activity along with GDP1 expression (Fig. 5G). It should also be noted that glycerol-3 phosphate (G3P) produced by glycerol kinase from glycerol is a key component for the NADH-G3P shuttle⁴. This shuttle allows for rapid aerobic ATP synthesis in the mitochondria, which contributes to adaptive thermogenesis in brown adipocytes⁴⁵. Taken together, ciBAs could elicit Capsaicin-induced metabolic changes unique to brown adipocytes.

Capsaicin treatment upregulated several transcription factors and cofactors that directly regulate UCP1 transcription in ciBAs (Fig. 4F, Supplementary Fig. S3). Reportedly, CEBPA directly and indirectly regulates UCP1 transcription and adipocyte differentiation⁴⁶. Moreover, several nuclear receptors are involved in the direct regulation of UCP1 in response to steroid hormones, retinoids, and lipid metabolites^23,47. In this study, the RNA-Seq data and qRT-PCR results demonstrated that RXRG, LXRA, RORC, NR4A2, and NR4A3 were upregulated by Capsaicin. RXRG is especially important for brown adipogenesis by forming heterodimers with other nuclear receptors such as PPARs, RARs, LXRs, and TRs to activate their target genes including UCP1⁴⁸. Although cellular metabolic changes induced by Capsaicin might affect its expression, UCP1 transcription could be at least partially activated by CEBPA, RXRG, and several nuclear receptors whose expression was activated by Capsaicin. However, further studies are required to reveal the precise molecular mechanism underlying the activation of UCP1 gene by the treatment with Capsaicin. Of note, Capsaicin treatment enhanced ADRB2 transcription at a higher level than the other ADRBs (Fig. 4G). ADRB2 is known to be the main β-adrenergic receptor functional in human brown adipocytes⁴⁹. In addition, the activation of VEGFA expression by Capsaicin might be involved in the process of vascularisation during adipocyte browning in vivo¹⁰.

The manipulation of brown adipocyte population in our body by small molecules has a therapeutic potential for the treatment of obesity-associated metabolic diseases including type 2 diabetes mellitus and cardiovascular diseases. However, it is not feasible to isolate a sufficient amount of homogeneous human brown adipocytes every time the effects of bioactive molecules are evaluated³⁷. In our previous studies, we developed a technique for serum- and transgene-free direct conversion of human dermal fibroblasts into brown adipocytes^33,34. This method enables convenient and reproducible preparation for human brown adipocyte-like cells applicable to basic, pharmacological, and clinical research³⁵. In this study, we demonstrated a successful evaluation of the direct effects of Capsaicin on adipocyte browning through TRPV1 in ciBAs. In conclusion, ciBAs could serve as a promising model especially for the first screening of bioactive molecules and dietary compounds with a potential ability to directly promote adipocyte browning and brown adipogenesis. In other words, ciBAs could assist in the characterisation of dietary factors and offer novel insights into the nutritional intervention strategies aimed at preventing and managing obesity and related metabolic diseases.

Methods

Cell culture

Fibroblasts derived from a human subject aged 38 years (HDF38) were mainly used³⁶. Approximately 1.5 × 10⁵ cells were seeded on a 35-mm dish with high-glucose Dulbecco's Modified Eagle Medium (DMEM) (11995–065, Gibco, MA, USA) supplemented with 10% fetal bovine serum (FBS) (HyClone, UT, USA) and penicillin/streptomycin (Gibco). After reaching 80–90% confluence, the medium was changed to start the direct conversion into ciBAs with the serum-free brown adipogenic medium (SFBAM) prepared from high-glucose DMEM (11995–065, Gibco) supplemented with linoleic acid- and oleic acid-albumin (L9655-5ML, Sigma-Aldrich, MO, USA), 3,3’,5 triiodothyronine (T3) (Sigma-Aldrich), dexamethasone (FUJIFILM Wako, Osaka, Japan), 3-isobutyl-1-methylxanthine (IBMX) (FUJIFILM Wako), human recombinant insulin (FUJIFILM Wako), L-ascorbic acid-2-phosphate (Sigma-Aldrich), and penicillin/streptomycin (Gibco). As reported previously³⁴, the human fibroblasts were incubated with SFBAM either with or without the chemical combination RoFB, which consists of 1 μM Rosiglitazone (FUJIFILM Wako), 7.5 μM Forskolin (FUJIFILM Wako), and 20 ng/ml human recombinant BMP7 (FUJIFILM Wako) for 3 weeks unless otherwise indicated. Capsaicin (030–11353, FUJIFILM Wako) was added in combination with RoFB at a concentration of 25 μM unless otherwise indicated. The medium was changed every 3 days. Other TRPV1 and TRPV4 ligands, Nonivamide (sc-202735, Santa Cruz Biotechnology, CA, USA), Capsazepine (037–23171, FUJIFILM Wako), AMG9810 (015–25071, FUJIFILM Wako), and GSK1016790A (G0798, Sigma-Aldrich) were used at different concentrations as indicated. Other lines of human dermal fibroblasts (HDF35 and HDF54) were purchased from DS Pharma Biomedical Co. (Osaka, Japan)³⁶. The immortalised preadipocyte cell line isolated from human deep neck fat tissue (hTERT A41hBAT-SVF) was purchased from the American Type Culture Collection (CRL-3385, ATCC, VA, USA). They were maintained and differentiated in the same manner as described above.

MSCs derived from the adipose tissue of human subjects at age 46 (AdMSC46), 38 (AdMSC38), and 51 (AdMSC51) were purchased from TaKaRa Bio (C-12977, TaKaRa Bio, Shiga, Japan) and cultured in Mesenchymal Stem Cell Growth Medium 2 (TaKaRa Bio)³⁶. After reaching 80–90% confluence, AdMSCs were differentiated into mature adipocytes with SFBAM and the chemical cocktail, RoFB, in either the presence or absence of Capsaicin as described above. MSCs derived from the bone marrow of human subjects aged 70 (BmMSC70) and 71 (BmMSC71) were also purchased from TaKaRa Bio (C-12974, TaKaRa Bio). All the commercial human cells have been approved for in vitro research use only. All experimental procedures for cell cultures were conducted in accordance with the general guidelines in Kyoto Prefectural University of Medicine.

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from the control fibroblasts, ciBAs, and AdMSCs cultured in each experimental condition using FastGene RNA Basic Kit (Nippon Genetics, Tokyo, Japan). Reverse transcription was conducted using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Osaka, Japan). The qRT-PCR analysis was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, MA, USA). The reactions were carried out in triplicate and under the following conditions: 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 60 s at 60 °C. All the results were normalised to TBP mRNA levels. The ratio of UCP1 to FABP4 mRNA was calculated as an indicator for adipocyte browning. The primer sequences used for qRT-PCR are listed in Supplementary Table S3. Unless otherwise indicated, the average of the three biological replicates was calculated.

Quantification of mitochondrial DNA

Total genomic DNA was extracted with NucleoSpin Tissue (TaKaRa Bio) from the control fibroblasts and ciBAs treated either with or without Capsaicin. mtDNA copy numbers were measured by qPCR using 10 ng of total genomic DNA and Power SYBR Green PCR Master Mix. Each mtDNA was normalised to corresponding nuclear DNA level. Primer sequences for the quantification of mitochondrial and nuclear DNA were as follows: mtDNA-Fwd, ACACCCTCCTAGCCTTACTAC; mtDNA-Rev, GATATAGGGTCGAAGCCGC; nuDNA-Fwd, AGGGTATCTGGGCTCTGG; NuDNA-Rev, GGCTGAAAAGCTCCCGATTAT³⁴. The average of the three biological replicates was calculated.

Immunoblotting

For immunoblot analysis, total proteins were extracted from the control fibroblasts, ciBAs, and Capsaicin-treated ciBAs with RIPA buffer (FUJIFILM Wako) including phosphatase inhibitor cocktail (FUJIFILM Wako) and protease inhibitor cocktail (FUJIFILM Wako). The extracted proteins were subjected to sodium dodecyl sulfate–polyacrylamide gel electrophoresis using a 10% gel concentration and transferred to a polyvinylidene fluoride membrane (Thermo Fisher Scientific, MA, USA). The membranes were blocked with 3% skim milk followed by incubation with antibodies against UCP1 (MAB6158, R&D Systems, MN, USA), COX4 (#4850, Cell Signalling Technology, MA, USA), VDAC1 (ab14734, Abcam, Cambridge, UK), or β-Actin (A5316, Sigma-Aldrich) at 4 ˚C overnight. The membranes were incubated with either HRP-conjugated anti-rabbit or anti-mouse secondary antibodies (Santa Cruz Biotechnology, CA, USA) for 1 h at room temperature. Immunoreactive bands were detected by Immobilon Western Chemiluminescent HRP Substrate (Merck Millipore, Darmstadt, Germany). The intensity of each band was quantified by densitometry using ImageJ software (National Institutes of Health). The experiments were performed independently at least twice.

Immunocytochemistry

The cells were incubated with 1 µM Lipi-Red (Dojindo, Kumamoto, Japan) for 30 min at 37 °C in 5% CO₂, according to the manufacturer’s instructions. Then the cells were fixed with 4% paraformaldehyde for 10 min. After washing with phosphate-buffered saline (PBS), the cells were incubated with PBS containing 0.1% Triton X-100 for 5 min. After incubation, they were blocked with PBS containing 3% skim milk for 1 h at room temperature and incubated again with UCP1 antibody (ab10983, Abcam) at 1/1000 dilution overnight at 4 °C. After washing with PBS, the cells were incubated with Alexa Fluor 488 donkey anti-rabbit IgG (Invitrogen, CA, USA) for 1 h at room temperature. Subsequently, the cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) solution (Dojindo). All images were obtained using a BZ-X710-All-in-One Fluorescence Microscope (Keyence, Osaka, Japan) with a 20X objective lens (CFI Plan Fluor 20X, Nikon, Tokyo, Japan). All the scale bars represent 100 μm. To evaluate the direct conversion efficiency, the number of DAPI-positive cells, Lipi-Red positive cells, and UCP1-positive cells were counted from at least three different optical sections. The range of the number of cells was from 110 to 200 in each optical section. The experiments were performed independently at least twice.

Measurement of OCR

For measurement of OCR by mitochondria, human dermal fibroblasts were seeded on a 96-well plate and converted to ciBAs by either RoFB or RoFB + Capsaicin in SFBAM for 3 weeks. As a control, the fibroblasts were cultured in parallel with the medium. Before the measurement, the cells were washed and incubated with non-buffered DMEM supplemented with 25 mM glucose, 2 mM glutamine, and 1 mM pyruvate at 37 °C in a non-CO₂ incubator for 1 h. Then, OCR was measured by the Seahorse XF96 Extracellular Flux Analyzer (Seahorse Bioscience Inc., MA, USA) according to the manufacturer’s instructions. During the analysis, oligomycin, FCCP, and antimycin A/rotenone were added into each well via an injection apparatus to final concentrations at 2 μM, 0.3 μM, and 0.5 μM, respectively. Extracellular acidification rate (ECAR) was simultaneously measured. The experiments were performed twice independently.

Cell viability and cytotoxicity assays

Cell viability was measured by using Cell Counting Kit-8 (Dojindo), according to the manufacturer’s instructions. The human fibroblasts were seeded on a 96 well plate and ciBAs were induced for 3 weeks either with or without Capsaicin as indicated. The cell viability was presented as a percentage of the control cells cultured in the medium only in parallel. To assess cytotoxicity, the activity of lactate dehydrogenase (LDH) released into the culture supernatants was measured by Cytotoxicity LDH Assay Kit-WST (Dojindo) according to the manufacturer’s instructions. The average of three biological replicates was calculated.

Measurement of glycerol, NEFAs, triglycerides, and GPDH activity

Cell culture supernatants and extracted cell lysates were collected from the control fibroblasts and Capsaicin-treated and -untreated ciBAs. The amount of free glycerol and non-esterified fatty acids (NEFAs) was measured by Free Glycerol Assay Kit (ab65337, Abcam) and Free Fatty Acid Assay Kit (ab65341, Abcam), respectively, according to the manufacturer’s instructions. For measurement of cellular triglyceride content, lipids were extracted from the control fibroblasts and ciBAs by Folch method. Triglycerides in each extract were determined by LabAssay Triglyceride kit (FUJIFILM Wako). In addition, glycerol-3-phosphate dehydrogenase (GPDH) activity was measured in cell lysates extracted from the control fibroblasts and ciBAs by GPDH Assay kit (AK01, Cosmo Bio Co., Ltd., Tokyo, Japan) according to the manufacturer’s instructions. All the experiments were performed in triplicates. The levels of glycerol, NEFAs, triglycerides, and GPDH activity were normalised to protein amounts in each cell culture. The experiments were performed independently at least twice.

RNA-Sequencing (RNA-Seq)

RNA-Seq results in the control fibroblasts (NoC) and ciBAs (RoFB) have been previously reported³⁶. In this study, total RNA was prepared from Capsaicin-treated ciBAs (RoFB + Capsaicin) derived from HDF38 by FastGene RNA Premium Kit (Nippon Genetics, Tokyo, Japan). RNA integrity number (RIN) values were over 9 in all the RNA samples. The library was prepared by TruSeq stranded mRNA LT Sample Prep Kit (Illumina, CA, USA), following the manufacturer’s low sample (LS) protocol. A 100 bp paired-end sequencing was performed by NovaSeq 6000 System (Illumina). Trimmed reads were mapped to a reference genome (NCBI GRCh37) with HISAT2. After the read mapping, StringTie was used for transcript assembly. After the assembly, the abundance of gene/transcript was calculated from the read counts and normalised as fragments per kilobase of transcript per million mapped sequence reads (FPKM). For identification of DEGs, statistical analysis was performed by FC and exact test using edgeR per comparison pair. Significant results satisfying the conditions of |FC|≥ 2 and the exact test p value < 0.05 were selected. If more than one read count value was zero, it was not included in the analysis.

Data analysis

Heat maps were generated using Heatmapper (http://www.heatmapper.ca/)⁵⁰. Hierarchical clustering analysis was based on Euclidean distance. Each row represents a gene, and each column represents z-scored FPKM of each sample. The green and magenta gradients represent lower and higher gene expression, respectively. Gene ontology (GO) enrichment analysis was performed by DAVID Bioinformatics Resources 6.8 (https://david.ncifcrf.gov/)⁵¹.

Statistical Analyses

All the results are presented as the mean ± SD or SEM. Statistical analyses were performed by a two-tailed Student’s t-test in the Excel (Microsoft) program. Statistical significance was defined as p < 0.05.

Data availability

The datasets generated or analysed in the present study are available from the corresponding authors upon reasonable request.

References

Cohen, P. & Spiegelman, B. M. Cell biology of fat storage. Mol. Biol. Cell 27, 2523–2527 (2016).
Article CAS PubMed PubMed Central Google Scholar
Kajimura, S., Spiegelman, B. M. & Seale, P. Brown and beige fat: Physiological roles beyond heat generation. Cell Metab. 22, 546–559 (2015).
Article CAS PubMed PubMed Central Google Scholar
Shapira, S. N. & Seale, P. Transcriptional control of brown and beige fat development and function. Obesity (Silver Spring) 27, 13–21 (2019).
Article CAS Google Scholar
Cohen, P. & Kajimura, S. The cellular and functional complexity of thermogenic fat. Nat. Rev. Mol. Cell Biol. 22, 393–409 (2021).
Article CAS PubMed PubMed Central Google Scholar
Chouchani, E. T., Kazak, L. & Spiegelman, B. M. New advances in adaptive thermogenesis: UCP1 and beyond. Cell Metab. 29, 27–37 (2019).
Article CAS PubMed Google Scholar
Yoneshiro, T. et al. Recruited brown adipose tissue as an antiobesity agent in humans. J. Clin. Invest. 123, 3404–3408 (2013).
Article CAS PubMed PubMed Central Google Scholar
Min, S. Y. et al. Human ‘brite/beige’ adipocytes develop from capillary networks, and their implantation improves metabolic homeostasis in mice. Nat. Med. 22, 312–318 (2016).
Article CAS PubMed PubMed Central Google Scholar
Chondronikola, M. et al. Brown adipose tissue improves whole-body glucose homeostasis and insulin sensitivity in humans. Diabetes 63, 4089–4099 (2014).
Article CAS PubMed PubMed Central Google Scholar
Zhuang, P. et al. Differential anti-adipogenic effects of eicosapentaenoic and docosahexaenoic acids in obesity. Mol. Nutr. Food Res. 63, e1801135 (2019).
Article PubMed CAS Google Scholar
Wiśniewski, O. W., Malinowska, M. & Gibas-Dorna, M. Physiologically-induced adipocyte browning. Postepy Hig. Med. Dosw 72, 499–511 (2018).
Article Google Scholar
Becher, T. et al. Brown adipose tissue is associated with cardiometabolic health. Nat. Med. 27, 58–65 (2021).
Article CAS PubMed PubMed Central Google Scholar
Panchal, S. K., Bliss, E. & Brown, L. Capsaicin in metabolic syndrome. Nutrients 10, 14–18 (2018).
Article CAS Google Scholar
Baskaran, P., Nazminia, K., Frantz, J., O’Neal, J. & Thyagarajan, B. Mice lacking endogenous TRPV1 express reduced levels of thermogenic proteins and are susceptible to diet-induced obesity and metabolic dysfunction. FEBS Lett. 595, 1768–1781 (2021).
Article CAS PubMed Google Scholar
Inoue, N., Matsunaga, Y., Satoh, H. & Takahashi, M. Enhanced energy expenditure and fat oxidation in humans with high BMI scores by the ingestion of novel and non-pungent capsaicin analogues (capsinoids). Biosci. Biotechnol. Biochem. 71, 380–389 (2007).
Article CAS PubMed Google Scholar
Snitker, S. et al. Effects of novel capsinoid treatment on fatness and energy metabolism in humans: possible pharmacogenetic implications. Am. J. Clin. Nutr. 89, 45–50 (2009).
Article CAS PubMed Google Scholar
Nirengi, S. et al. Assessment of human brown adipose tissue density during daily ingestion of thermogenic capsinoids using near-infrared time-resolved spectroscopy. J. Biomed. Opt. 21, 091305 (2016).
Article ADS PubMed Google Scholar
Baskaran, P., Krishnan, V., Ren, J. & Thyagarajan, B. Capsaicin induces browning of white adipose tissue and counters obesity by activating TRPV1 channel-dependent mechanisms. Br. J. Pharmacol. 173, 2369–2389 (2016).
Article CAS PubMed PubMed Central Google Scholar
Yoneshiro, T., Aita, S., Kawai, Y., Iwanaga, T. & Saito, M. Nonpungent capsaicin analogs (capsinoids) increase energy expenditure through the activation of brown adipose tissue in humans. Am. J. Clin. Nutr. 95, 845–850 (2012).
Article CAS PubMed Google Scholar
Saito, M. & Yoneshiro, T. Capsinoids and related food ingredients activating brown fat thermogenesis and reducing body fat in humans. Curr. Opin. Lipidol. 24, 71–77 (2013).
Article CAS PubMed Google Scholar
Uchida, K. et al. Involvement of thermosensitive TRP channels in energy metabolism. J. Physiol. Sci. 67, 549–560 (2017).
Article CAS PubMed Google Scholar
Saito, M., Yoneshiro, T. & Matsushita, M. Food ingredients as anti-obesity agents. Trends Endocrinol. Metab. 26, 585–587 (2015).
Article CAS PubMed Google Scholar
Zheng, J., Zheng, S., Feng, Q., Zhang, Q. & Xiao, X. Dietary capsaicin and its anti-obesity potency: From mechanism to clinical implications. Biosci. Rep. 37, BSR20170286 (2017).
Article CAS PubMed PubMed Central Google Scholar
Villarroya, F., Peyrou, M. & Giralt, M. Transcriptional regulation of the uncoupling protein-1 gene. Biochimie 134, 86–92 (2017).
Article CAS PubMed Google Scholar
Kim, M. et al. 10-oxo-12(Z)-octadecenoic acid, a linoleic acid metabolite produced by gut lactic acid bacteria, enhances energy metabolism by activation of TRPV1. FASEB J. 31, 5036–5048 (2017).
Article CAS PubMed Google Scholar
Kim, M. et al. Fish oil intake induces UCP1 upregulation in brown and white adipose tissue via the sympathetic nervous system. Sci. Rep. 5, 1–12 (2016).
Google Scholar
Ward, S. M., Bayguinov, J., Won, K. J., Grundy, D. & Berthoud, H. R. Distribution of the vanilloid receptor (VR1) in the gastrointestinal tract. J. Comp. Neurol. 465, 121–135 (2003).
Article PubMed Google Scholar
Jang, Y. et al. Quantitative analysis of TRP channel genes in mouse organs. Arch. Pharm. Res. 35, 1823–1830 (2012).
Article CAS PubMed Google Scholar
Zhang, L. L. et al. Activation of transient receptor potential vanilloid type-1 channel prevents adipogenesis and obesity. Circ. Res. 100, 1063–1070 (2007).
Article CAS PubMed Google Scholar
Hsu, C. L. & Yen, G. C. Effects of capsaicin on induction of apoptosis and inhibition of adipogenesis in 3T3-L1 cells. J. Agric. Food Chem. 55, 1730–1736 (2007).
Article CAS PubMed Google Scholar
Baboota, R. K. et al. Capsaicin induces ‘Brite’ phenotype in differentiating 3T3-L1 preadipocytes. PLoS ONE 9, e103093 (2014).
Article ADS PubMed PubMed Central CAS Google Scholar
Kida, R. et al. Direct action of capsaicin in brown adipogenesis and activation of brown adipocytes. Cell Biochem. Funct. 34, 34–41 (2016).
Article CAS PubMed Google Scholar
Kida, R. et al. Supra-pharmacological concentration of capsaicin stimulates brown adipogenesis through induction of endoplasmic reticulum stress. Sci. Rep. 8, 845 (2018).
Article ADS PubMed PubMed Central CAS Google Scholar
Takeda, Y., Harada, Y., Yoshikawa, T. & Dai, P. Direct conversion of human fibroblasts to brown adipocytes by small chemical compounds. Sci. Rep. 7, 4304 (2017).
Article ADS PubMed PubMed Central CAS Google Scholar
Takeda, Y. & Dai, P. A developed serum-free medium and an optimized chemical cocktail for direct conversion of human dermal fibroblasts into brown adipocytes. Sci. Rep. 10, 3775 (2020).
Article ADS CAS PubMed PubMed Central Google Scholar
Takeda, Y., Harada, Y., Yoshikawa, T. & Dai, P. Chemical compound-based direct reprogramming for future clinical applications. Biosci. Rep. 38, BSR20171650 (2018).
Article CAS PubMed PubMed Central Google Scholar
Takeda, Y., Yoshikawa, T. & Dai, P. Transcriptome analysis reveals brown adipogenic reprogramming in chemical compound-induced brown adipocytes converted from human dermal fibroblasts. Sci. Rep. 11, 5061 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Samuelson, I. & Vidal-Puig, A. Studying brown adipose tissue in a human in vitro context. Front. Endocrinol. (Lausanne) 11, 629 (2020).
Article Google Scholar
Uchida, K., Sun, W., Yamazaki, J. & Tominaga, M. Role of thermo-sensitive transient receptor potential channels in brown adipose tissue. Biol. Pharm. Bull. 41, 1135–1144 (2018).
Article CAS PubMed Google Scholar
Ye, L. et al. TRPV4 is a regulator of adipose oxidative metabolism, inflammation, and energy homeostasis. Cell 151, 96–110 (2012).
Article CAS PubMed PubMed Central Google Scholar
Braun, K., Oeckl, J., Westermeier, J., Li, Y. & Klingenspor, M. Non-adrenergic control of lipolysis and thermogenesis in adipose tissues. J. Exp. Biol. 221, jeb65381 (2018).
Article Google Scholar
Weir, G. et al. Substantial metabolic activity of human brown adipose tissue during warm conditions and cold-induced lipolysis of local triglycerides. Cell Metab. 27, 1348-1355.e4 (2018).
Article CAS PubMed PubMed Central Google Scholar
Schweiger, M. et al. Measurement of lipolysis. Methods Enzymol. 538, 171–193 (2014).
Article CAS PubMed PubMed Central Google Scholar
Chin-Lin, H. & Gow-Chin, Y. Effects of capsaicin on induction of apoptosis and inhibition of adipogenesis in 3T3-L1 cells. J. Agric. Food Chem. 55, 1730–1736 (2007).
Article CAS Google Scholar
Chakrabarty, K., Chaudhuri, B. & Jeffay, H. Glycerokinase activity in human brown adipose tissue. J. Lipid Res. 24, 381–390 (1983).
Article CAS PubMed Google Scholar
Silva, J. E. Thermogenic mechanisms and their hormonal regulation. Physiol. Rev. 86, 435–464 (2006).
Article CAS PubMed Google Scholar
Giralt, M. & Villarroya, F. White, brown, beige/brite: Different adipose cells for different functions?. Endocrinology 154, 2992–3000 (2013).
Article CAS PubMed Google Scholar
Liu, J., Wang, Y. & Lin, L. Small molecules for fat combustion: targeting obesity. Acta Pharm. Sin. B 9, 220–236 (2019).
Article PubMed Google Scholar
Nie, B. et al. Brown adipogenic reprogramming induced by a small molecule. Cell Rep. 18, 624–635 (2017).
Article CAS PubMed Google Scholar
Blondin, D. P. et al. Human brown adipocyte thermogenesis is driven by β2-AR stimulation. Cell Metab. 32, 287–300 (2020).
Article CAS PubMed Google Scholar
Babicki, S. et al. Heatmapper: Web-enabled heat mapping for all. Nucleic Acids Res. 44, W147–W153 (2016).
Article CAS PubMed PubMed Central Google Scholar
da Huang, W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44–57 (2009).
Article CAS Google Scholar

Download references

Acknowledgements

This research was supported by Kataoka Corporation (Kyoto, Japan), JSPS KAKENHI Grant Number JP21K12669, Takeda Science Foundation, and ONO Medical Research Foundation.

Author information

Authors and Affiliations

Department of Cellular Regenerative Medicine, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kawaramachi-Hirokoji, Kamigyo-ku, Kyoto, 602-8566, Japan
Yukimasa Takeda & Ping Dai

Authors

Yukimasa Takeda
View author publications
You can also search for this author in PubMed Google Scholar
Ping Dai
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Y.T. and P.D. designed the experiments; Y.T. conducted the experiments; P.D. provided comments and conceptual advice; Y.T. and P.D. wrote the manuscript. All authors reviewed the manuscript.

Corresponding authors

Correspondence to Yukimasa Takeda or Ping Dai.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Supplementary Information.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Takeda, Y., Dai, P. Capsaicin directly promotes adipocyte browning in the chemical compound-induced brown adipocytes converted from human dermal fibroblasts. Sci Rep 12, 6612 (2022). https://doi.org/10.1038/s41598-022-10644-8

Download citation

Received: 06 October 2021
Accepted: 12 April 2022
Published: 22 April 2022
DOI: https://doi.org/10.1038/s41598-022-10644-8

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.