Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Sulodexide reduces glucose induced senescence in human retinal endothelial cells

Abstract

Chronic exposure of retinal endothelium cells to hyperglycemia is the leading cause of diabetic retinopathy. We evaluated the effect of high glucose concentration on senescence in human retinal endothelial cells (HREC) and modulation of that effect by Sulodexide. Experiments were performed on HREC undergoing in vitro replicative senescence in standard medium or medium supplemented with glucose 20 mmol/L (GLU) or mannitol 20 mnol/L (MAN). Effect of Sulodexide 0.5 LRU/mL (SUL) on the process of HREC senescence was studied. Glucose 20 mmol/L accelerates senescence of HREC: population doubling time (+ 58%, p < 0.001) β-galactosidase activity (+ 60%, p < 0.002) intracellular oxidative stress (+ 65%, p < 0.01), expression of p53 gene (+ 118%, p < 0.001). Senescent HREC had also reduced transendothelial electrical resistance (TEER) (− 30%, p < 0.001). Mannitol 20 mmol/L used in the same scenario as glucose did not induce HREC senescence. In HREC exposed to GLU and SUL, the senescent changes were smaller. HREC, which became senescent in the presence of GLU, demonstrated higher expression of genes regulating the synthesis of Il6 and VEGF-A, which was reflected by increased secretion of these cytokines (IL6 + 125%, p < 0.001 vs control and VEGF-A + 124% p < 0.001 vs control). These effects were smaller in the presence of SUL, and additionally, an increase of TEER in the senescent HREC was observed. Chronic exposure of HREC to high glucose concentration in medium accelerates their senescence, and that process is reduced when the cells are simultaneously exposed to Sulodexide. Additionally, Sulodexide decreases the secretion of IL6 and VEGF-A from senescent HREC and increases their TEER.

Introduction

Diabetes mellitus is nowadays a common disease, causing dysfunction of the vascular endothelial cells, which results in various pathologies within the microvascular and macrovascular system1. Diabetic retinopathy is one of the most common consequences of diabetes mellitus and a leading cause of visual impairment in that group of patients2. In the early stages of the disease, it is asymptomatic, but at that time, changes in the endothelial cells have already started. They include the abnormal secretory activity of the cells, reduction of the endothelial glycocalyx thickness, disruption of the blood-retinal barrier, thickening of the basement membrane and degeneration of capillaries. Later, leakage and proliferation of the retinal microvessels due to progressive ischemia lead to diabetic macular oedema and bleeding into the retina and vitreous body3.

Hyperglycemia, which is characteristic for diabetic patients, causes endothelial dysfunction via different mechanisms, such as damage to the glycocalyx4, oxidative stress5, activation of the inflammation, induction of imbalance between coagulation and fibrinolysis, and stimulation of cellular senescence6. High glucose-dependent hyperosmolality may also contribute to the promotion of angiogenesis in retinal endothelial cells and retinopathy7. The senescent phenotype of retinal endothelial cells may contribute to abnormal angiogenesis in retinopathy8. High glucose level, as well as advanced glycation end products, accelerate thesenescence of endothelial cells9,10. Therefore, inhibition of retinal endothelial senescence may be an effective way of slowing the progress of diabetic retinopathy11. Previously, we found that senescence of human venous and arterial endothelial cells was slowed down by Sulodexide, which is a mixture of glycosaminoglycans: low molecular-weight heparin and dermatan sulphate12,13. Sulodexide also reduced glucose toxicity towards human venous endothelial cells14.

In the presented study, we tested the hypothesis that senescence of retinal endothelial cells caused by chronic exposure to high glucose concentration is slowed down by Sulodexide. We also evaluated the effect of Sulodexide on senescent retinal endothelial cells.

Material and methods

Experiments were performed on HREC (#HEC09, Neuromics, Edina, MN, USA) in in vitro culture. Cells were seeded in 75 cm2 culture flasks coated with AlphaBioCoat Solution (#AC00, Neuromics, Edina, MN, USA) and were grown in Endo Growth Medium (EKG001, Neuromics, Edina, MN, USA) supplemented with fetal bovine serum 0.5% until they formed monolayers. Then the cells were harvested with cell detachment solution (#ADF001, Neuromics, Edina, MN, USA) and seeded in quadruplicates into 25 cm2 coated, as described above, culture flasks at a density of 1.5 × 105 cells/flask.

We studied the senescence of HREC in two sets of experiments. In the first one, we compared the effects of mannitol and glucose, used at the same concentrations of the HREC senescence. The following experimental groups were studied:

  • Control group exposed to the standard culture medium (glucose concentration 5.0 mmol/L).

  • Glucose group exposed to standard medium supplemented with glucose 20 mmol/L.

  • Mannitol group exposed to standard medium supplemented with mannitol 20 mmol/L.

In the second set of the experiments, we studied the effect of Sulodexide on the glucose-induced senescence of HREC. The following experimental groups were established:

  • Control group exposed to the standard culture medium (glucose concentration 5.0 mmol/L).

  • Glucose group exposed to standard medium supplemented with glucose 20 mmol/L.

  • Glucose-Sulodexide group exposed to standard medium supplemented with glucose 20 mmol/L and Sulodexide 0.5 LRU/mL.

Replicative senescence of the endothelial cells was induced according to the protocol established in our previous study12. Every four days, growing cells were harvested from the culture flasks, counted in a hemocytometer, and afterwards reseeded into 25 cm2 flasks at a density of 1.5 × 105 cells/flask. During the experiment, ten passages were performed. Population doubling time (PDT) of the cultured cells was calculated according to the standard formula:

$$ {\text{PDT}} = \ln 2/\left[ {\ln \;\;\left( {{\text{N}}/{\text{No}}} \right)/{\text{t}}} \right] $$

where N—number of cells harvested from the flask, No—number of cells seeded into the flask, t—a time of culture.

After the last passage, cells were seeded into six wells, 24-well culture plates and into Labtec plates, which were grown to monolayers, for further study. The following functional parameters of the endothelial cells from each experimental group were studied:

Intracellular generation of free radicals measured with a 2′7'-dichlorodihydrofluorescein probe, which in the presence of oxidative stress is converted to fluorescent 2′7'-dichlorodihydrofluorescein. Fluorescence was measured in a microplate fluorescent reader, with excitation at 485 nm and emission at 530 nm. Generation of free radicals was expressed per amount of the cells' protein, measured in the cellular lysates with a BCA protein assay kit (# ab207002, Abcam, Cambridge, UK).

Secretory activity of the cells evaluated during 24 h’ incubation of the cell monolayers in the media appropriate for each group. We measured Interleukin – 6 (IL6) and Vascular Endothelial Growth Factor-A (VEGF-A) concentration in supernatants collected at the end of the incubation with standard ELISA kits (R&D Sytems, Minneapolis, MN, USA). The concentration of these cytokines was expressed per number of cells in each well, which were counted in a hemocytometer.

Expression of genes in the endothelial cells evaluated at the start of the experiment and after ten passages of the cells in different media as described above. In each group, cells were grown to monolayers in 6-well plates. At the end of 24 h’ exposure to the medium appropriate for each group, total RNA was isolated using the ReliaPrepTM RNA Cell Miniprep System (Promega, Madison, WI, USA) treated with DNase I using DNA-free DNase Treatment and Removal Reagent (Thermo Fisher Scientific, Waltham MA, USA). RNA was reverse-transcribed to cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). Relative levels of the mRNA of 3 genes (p 53, IL6, VEGF-A) were studied in triplicates from each experiment:

  • p53 [F:TTGCAATAGGTGTGCGTCAG; R:TCCCCACAACAAAACACCAG]

  • IL6 [F:ATGAACTCCTTCTCCACAAGC; R:GTTTTCTGCCAGTGCCTCTTTG]

  • VEGF-A [F: CTTGCCTTGCTGCTCTACCT; R:GCAGTAGCTGCGCTGATAGA]

and normalized to the level of internal house-keeping genes:

  • Glyceraldehyde-3-Phosphate dehydrogenase [F:TTCGTCATGGGTGTGAACC; R:GATGATGTTCTGGAGAGCCC]

  • Hypoxanthine phosphoribosyltranferase 1 [F:TGCTCGAGATGTGATGAAGG; R:TCCCCTGTTGACTGGTCATT]

Relative gene expression was calculated using the 2-∆∆Ct method15.

The β-galactosidase activity measured in the cell monolayers grown in Labtec wells with a Senescence Detection Kit (#ab6535, abcam, Cambridge, UK). Evaluation of β-galactosidase activity in the cell monolayers was studied at the beginning of the study and after ten passages in the different media. Results are expressed as % of change vs the beginning of the study.

Transendothelial electrical resistance (TEER) was measured using a Millicell-ERS (Merck, Poland). HREC were grown on the collagen-treated Transwell inserts, and resistance of the endothelial monolayers was measured 72 h since the cellular monolayer was established. Values of TEER are expressed as Ω x cm2.

In a separate set of experiments, we evaluated the effect of Sulodexide on the secretory activity of REC made senescent in control medium or in medium supplemented with glucose 20 mmol/L. After ten passages, the secretory activity of RES was studied during 24 h’ incubation in the culture medium appropriate for each group ± Sulodexide 0.5 LRU/mL. The concentration of IL6 and VEGF in the supernatant of the cells was measured with ELISA as described above, and recalculated per number of cells in each well. TEER was measured in the senescent cells after 24- hour exposure to Sulodexide 0.5 LRU/mL in the medium.

Statistical analysis

Results are presented as mean ± SD. Analysis of the data was performed with a one-way analysis of variance. A p-value of less than 0.05 was considered significant.

Results

Repeated eight passages of HREC resulted in senescence of these cells, which was reflected in the control group by the increased intracellular generation of free radicals (+ 50%, p < 0.01, vs start), the elevation of SA-β-Galactosidase activity (+ 479%, p < 0.001 vs start) and prolongation of population doubling time (+ 125%, p < 0.001 vs start). Replicative senescence of HREC was accelerated in the presence of glucose 20 mmol/L, but not mannitol 20 mmol/L, added to the culture medium, as reflected by greater changes of the studied parameters (Fig. 1).

Figure 1
figure1

Activity of β-galactosidase (A), expression of p53 gene (B), intracellular oxidative stress (C) and Population doubling time (D) in HREC at the end of the replicative senescence in control medium (Control), medium supplemented with Mannitol 20 mmol/L (Mannitol) or medium supplemented with glucose 20 mmol/L (Glucose) (n = 8) (ANOVA analysis).

Glucose-induced senescence as reflected by increased oxidative stress, SA-β-galactosidase activity and prolongation of PDT was reduced in the HREC simultaneously exposed to Sulodexide in medium (0.5 LRU/mL), by 24%, p < 0.05, 32% p < 0.01, − 20%, p < 0.05, respectively (Fig. 2). Chronic exposure to high glucose concentration in the medium resulted in a stronger decrease of TEER, as compared to the control group, and that effect was partially modified by simultaneous treatment with Sulodexide (0.5 LRU/mL) (Fig. 2D).

Figure 2
figure2

Activity of β-galactosidase (A), population doubling time (B), intracellular oxidative stress (C) and TEER (D) in HREC at the end of the replicative senescence in control medium (Control), medium supplemented with glucose 20 mmol/L Glucose) or medium supplemented with glucose 20 mmol/L and Sulodexide 0.5 LRU/mL (Glucose + Sul) (n = 8) (ANOVA analysis).

In HREC undergoing replicative senescence, we observed increased expression of genes regulating the synthesis of p53, IL6 and VEGF-A. That process was enhanced in the presence of glucose 20 mmol/L (+ 117%, p < 0.001, + 113% p < 0.001, + 122% p < 0.001, respectively) (Fig. 3).The presence of Sulodexide in the medium partially prevented the glucose-induced increased expression of p53, IL6 and VEGF genes: − 35%, p < 0.05, − 29% p < 0.05 and − 27% p < 0.05, respectively (Fig. 3). HREC made senescent in medium supplemented with glucose secreted more IL6 (+ 125%, p < 0.001) and VEGF (+ 124%, p < 0.001) than cells made senescent in control medium (Fig. 4). The presence of Sulodexide in high glucose medium reduced the intensity of their senescence as reflected by the reduced synthesis of IL6 (− 34%, p < 0.05) and VEGF (− 27%, p < 0.05) (Fig. 4).

Figure 3
figure3

Expression of genes for p53 (A), IL6 (B) and VEGF-A (C), presented as change versus start of the experiment, in HREC at the end of the replicative senescence in control medium (Control) medium supplemented with glucose 20 mmo/l (Glucose) and medium supplemented with glucose 20 mmol/L and Sulodexide 0.5 LRU/mL (Glucose + Sul) (n = 8) (ANOVA analysis).

Figure 4
figure4

Secretion of IL6 (A) and VEGF-A (B) in HREC at the end of the replicative senescence in control medium (Control) medium supplemented with glucose 20 mmo/L (Glucose) and medium supplemented with glucose 20 mmol/L and Sulodexide 0.5 LRU/mL (Glucose + Sul) (n = 8) (ANOVA analysis).

The anti-inflammatory effect of Sulodexide was also observed in the cells which were previously made senescent in the standard medium or in medium supplemented with glucose 20 mmol/L. The secretory activity of these cells for IL6 and VEGF-A was reduced after acute exposure to Sulodexide 0.5 LRU/mL by 28%, p < 0.05 and by 22%, p < 0.05 in cells made senescent in control medium and by 23%, p < 0.05 and by 16%, p < 0.05, respectively, in cells made senescent in the presence of high glucose concentration in the medium (Fig. 5). Additionally, treatment with Sulodexide 0.5 LRU/mL caused an increase of TEER by 19%, p < 0.01 in cells made senescent in control medium and by 67%, p < 0.01 in the cells made senescent due to chronic exposure to glucose (Fig. 5C).

Figure 5
figure5

Effect of Sulodexide on synthesis of IL6 (A), VEGF (B) and value of TEER (C) in HREC made senescent in control medium (SEN)and in HREC made senescent in control medium + glucose 20 mmol/L (GLU-SEN) (n = 10) (ANOVA analysis).

Discussion

Dysfunction of retinal endothelial cells is the main pathomechanism leading to the development of diabetic retinopathy. Our results show that chronic exposure of retinal endothelial cells to high glucose concentration causes the senescence of these cells. Intracellular oxidative stress observed in retinal endothelial cells treated with glucose may be an important factor accelerating their senescence16. Increased β-galactosidase activity and expression of the senescent protein p53 confirmed that cells became senescent17. We also observed increased secretion of IL6 and VEGF, which are characteristic of diabetic retinopathy18,19. In our previous studies on peritoneal mesothelial cells, we found that glucose-induced oxidative stress, but not hyperosmolality, changes the properties of these cells during four weeks of culture in a medium with increased glucose concentration20. In retinal endothelial cells, glucose-induced oxidative stress, but not hyperosmolality, causes cell death21. Results from our study prove that hyperosmolality caused by the addition of glucose to the culture medium was not the factor causing HREC senescence (Fig. 1).

Sulodexide is a potential drug in the treatment of this pathology. In a clinical 12-month study, Sulodexide was shown to slow the progression of non-proliferative diabetic retinopathy22. The presented results confirm the strong anti-senescent and anti-inflammatory effect of sulodexide in microvascular retinal endothelial cells, which was shown previously in venous12,23 and arterial13 endothelial cells. The senescent phenotype of retinal endothelial cells predisposes patients to abnormal, excessive growth of retinal microvessels and pathological neovascularization, leading to vitreous haemorrhages8.

In the pathomechanisms of diabetic retinopathy, there are two possible therapeutic approaches. The first one is the direct inhibition of the angiogenic and inflammatory effects of retinal endothelial cells modified by chronic hyperglycemia24. Another possibility is the prevention of the development of pathologic, senescent changes in retinal endothelial cells which are responsible for their angiogenic and inflammatory action25. Inhibition of arginase 1 protects against premature senescence of retinal endothelial cells11.

Our results suggest that Sulodexide can reduce the intensity of diabetic retinopathy through both above-mentioned mechanisms. It slows the senescence of retinal endothelial cells chronically exposed to hyperglycemia (Figs. 2, 3, 4). Reduced expression of the p53 gene by 35% in cells exposed to high glucose load and Sulodexide (Fig. 3A) confirms the anti- senescent action of that drug in the presence of hyperglycemia. Sulodexide also inhibits the angiogenic and inflammatory phenotype of retinal endothelial cells made senescent due to repeated passages in the control medium or in the presence of hyperglycemia (Fig. 5). Previously, Giurdanella et al. showed that Sulodexide prevents glucose toxicity in retinal endothelial cells due to inhibition of NFκB activity, which confirms its anti-inflammatory action, which was also observed in the present study26.

The beneficial effect of Sulodexide in patients with diabetic retinopathy could also be due to its other biological effects. In conditions of diabetes mellitus thickness of the glycocalyx covering the surface of endothelial cells lining the retinal vessels is decreased27. Such changes may result in abnormal interactions between the circulating cells in the bloodstream, and increased permeability of the vascular wall, predisposing patients to the formation of haemorrhages28. Damage to the glycocalyx is reflected by the reduced value of TEER and results in the increased permeability of the vascular wall. Our results show that during senescence, TEER decreases and that effect is stronger when senescence is induced by chronic exposure to high glucose concentration (Fig. 2). Sulodexide partially prevents that change during senescence of HREC (Fig. 2) and partially restores TEER when applied to the senescent HREC (Fig. 5). Results from previous studies show that the decreased thickness of the endothelial glycocalyx caused by mechanical stress in the arterial vessels29 or during diabetes mellitus in the retinal vessels30 can be restored with Sulodexide. Our results suggest that restoration of the glycocalyx translates into the increased TEER, which may increase the tightness of the vascular wall.

We conclude that Sulodexide may have a beneficial effect in cases of diabetic retinopathy. It slows down hyperglycemia-dependent senescence of endothelial cells, which translates into the lower angiogenic and inflammatory impact of these cells. An important observation was that Sulodexide also has effective antiangiogenic and anti-inflammatory effects in the senescent HREC. That means that Sulodexide may be effective in retinal endothelial cells, which are already senescent. Further studies are required to explain the potential effect of Sulodexide on the endothelial glycocalyx structure and permeability of the retinal endothelial layer composed of the senescent cells to molecules with various size and electrical charge.

References

  1. 1.

    Beckman, J. A. & Creager, M. A. Vascular complications of diabetes. Circ. Res. 118, 1771–1785 (2016).

    CAS  Article  Google Scholar 

  2. 2.

    Simó-Servat, O., Hernandez, C. & Simo, R. Diabetic retinopathy in the context of patients with diabetes. Ophthalmic Res. 62, 211–217 (2019).

    Article  Google Scholar 

  3. 3.

    Lechner, J., O’Leary, O. E. & Stitt, A. W. The pathology associated with diabetic retinopathy. Vis. Res. 139, 7–14 (2017).

    Article  Google Scholar 

  4. 4.

    Nieuwdorp, M. et al. Loss of endothelial glycocalyx during acute hyperglycemia coincides with endothelial dysfunction and coagulation activation in vivo. Diabetes 55, 480–486 (2006).

    CAS  Article  Google Scholar 

  5. 5.

    Incalza, M. A. et al. Oxidative stress and reactive oxygen species in endothelial dysfunction associated with cardiovascular and metabolic diseases. Vasc. Pharmacol. 100, 1–19 (2018).

    CAS  Article  Google Scholar 

  6. 6.

    Su, J. B. Vascular endothelial dysfunction and pharmacological treatment. World J. Cardiol. 7, 719–741 (2015).

    Article  Google Scholar 

  7. 7.

    Madonna, R. et al. High glucose-induced hyperosmolarity contributes to COX-2 expression and angiogenesis: Implications for diabetic retinopathy. Cardiovasc. Diabetol. 15, 18. https://doi.org/10.1186/s12933-016-0342-4 (2016).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  8. 8.

    Oubaha, M. et al. Senescence-associated secretory phenotype contributes to pathological angiogenesis in retinopathy. Sci. Transl. Med. 8(362), 362ra144 (2016).

    Article  Google Scholar 

  9. 9.

    Yokoi, T. et al. Apoptosis signal-regulating kinase 1 mediates cellular senescence induced by high glucose in endothelial cells. Diabetes 55, 1660–1665 (2006).

    CAS  Article  Google Scholar 

  10. 10.

    Nowotny, K., Jung, T., Höhn, A., Weber, D. & Grune, T. Advanced glycation end products and oxidative stress in type 2 diabetes mellitus. Biomolecules 5, 194–222 (2015).

    CAS  Article  Google Scholar 

  11. 11.

    Shosha, E. et al. Mechanisms of diabetes-induced endothelial cell senescence: Role of arginase 1. Int. J. Mol. Sci. 19, E1215 (2018).

    Article  Google Scholar 

  12. 12.

    Suminska-Jasinska, K. et al. Sulodexide reduces senescence-related changes in human endothelial cells. Med. Sci. Monit. 17, CR222–CR226 (2011).

    CAS  Article  Google Scholar 

  13. 13.

    Sosińska-Zawierucha, P. et al. Sulodexide slows down the senescence of aortic endothelial cells exposed to serum from patients with peripheral artery diseases. Cell. Physiol. Biochem. 45, 2225–2232 (2018).

    Article  Google Scholar 

  14. 14.

    Ciszewicz, M., Polubinska, A., Antoniewicz, A., Suminska-Jasinska, K. & Breborowicz, A. Sulodexide suppresses inflammation in human endothelial cells and prevents glucose cytotoxicity. Transl. Res. 153, 118–123 (2009).

    CAS  Article  Google Scholar 

  15. 15.

    Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408 (2001).

    CAS  Article  Google Scholar 

  16. 16.

    Liu, J. et al. Glucose-induced oxidative stress and accelerated aging in endothelial cells are mediated by the depletion of mitochondrial SIRTs. Physiol. Rep. 8(3), e14331. https://doi.org/10.14814/phy2.14331 (2020).

    Article  PubMed  PubMed Central  Google Scholar 

  17. 17.

    Shosha, E. et al. Mechanisms of diabetes-induced endothelial cell senescence: Role of arginase 1. Int. J. Mol. Sci. 19, 1215 (2018).

    Article  Google Scholar 

  18. 18.

    Yao, Y. et al. Interleukin-6 and diabetic retinopathy: A systematic review and meta-analysis. Curr. Eye Res. 44, 564–574 (2019).

    CAS  Article  Google Scholar 

  19. 19.

    Wong, T., Cheung, C. M. G., Larsen, M., Sharma, S. & Simo, R. Diabetic retinopathy. Nat. Rev. Dis. Primers. https://doi.org/10.1038/nrdp.2016.12 (2016).

    Article  PubMed  Google Scholar 

  20. 20.

    Breborowicz, A., Breborowicz, M. & Oreopoulos, D. G. Glucose-induced changes in the phenotype of human peritoneal mesothelial cells: Effect of L-2-oxothiazolidine carboxylic acid. Am. J. Nephrol. 23, 471–476 (2003).

    CAS  Article  Google Scholar 

  21. 21.

    Jiao, W. et al. Activation of the Notch-Nox4-reactive oxygen species signaling pathway induces cell death in high glucose-treated human retinal endothelial cells. Mol. Med. Rep. 19, 667–677 (2019).

    CAS  PubMed  Google Scholar 

  22. 22.

    Song, J. H., Chin, H. S., Kwon, O. W., Lim, S. J. & Kim, H. K. Effect of sulodexide in patients with non-proliferative diabetic retinopathy: Diabetic retinopathy sulodexide study (DRESS). Graefes Arch. Clin. Exp. Ophthalmol. 253, 829–837 (2015).

    CAS  Article  Google Scholar 

  23. 23.

    Urbanek, T. et al. Sulodexide reduces the inflammatory reaction and senescence of endothelial cells in conditions involving chronic venous disease. Int. Angiol. 35, 140–147 (2016).

    PubMed  Google Scholar 

  24. 24.

    Wang, W. & Lo, A. C. Y. Diabetic retinopathy: Pathophysiology and treatments. Int. J. Mol. Sci. 19(6), E1816 (2018).

    Article  Google Scholar 

  25. 25.

    Wei, W. & Ji, S. Cellular senescence: Molecular mechanisms and pathogenicity. J. Cell. Physiol. 233, 9121–9135 (2018).

    CAS  Article  Google Scholar 

  26. 26.

    Giurdanella, G. et al. Sulodexide prevents activation of the PLA2/COX-2/VEGF inflammatory pathway in human retinal endothelial cells by blocking the effect of AGE/RAGE. Biochem. Pharmacol. 142, 145–154 (2017).

    CAS  Article  Google Scholar 

  27. 27.

    Harris, N. R., Leskova, W., Kaur, G., Eshaq, R. S. & Carter, P. R. Blood flow distribution and the endothelial surface layer in the diabetic retina. Biorheology 56, 181–189 (2019).

    CAS  Article  Google Scholar 

  28. 28.

    Eshaq, R. S., Aldalati, A. M. Z., Alexander, J. S. & Harris, N. R. Diabetic retinopathy: Breaking the barrier. Pathophysiology 24, 229–241 (2017).

    Article  Google Scholar 

  29. 29.

    Li, T., Liu, X., Zhao, Z., Ni, L. & Liu, C. Sulodexide recovers endothelial function through reconstructing glycocalyx in the balloon-injury rat carotid artery model. Oncotarget 8, 91350–91361 (2017).

    Article  Google Scholar 

  30. 30.

    Broekhuizen, L. N. et al. Effect of sulodexide on endothelial glycocalyx and vascular permeability in patients with type 2 diabetes mellitus. Diabetologia 53, 2646–2655 (2010).

    CAS  Article  Google Scholar 

Download references

Funding

The study was supported by a grant from the Poznan University of Medical Sciences.

Author information

Affiliations

Authors

Contributions

All authors contributed equally to the manuscript.

Corresponding author

Correspondence to A. Bręborowicz.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Gericke, A., Suminska-Jasińska, K. & Bręborowicz, A. Sulodexide reduces glucose induced senescence in human retinal endothelial cells. Sci Rep 11, 11532 (2021). https://doi.org/10.1038/s41598-021-90987-w

Download citation

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing