Introduction

The protein folding capacity of cells is important for maintaining endoplasmic reticulum (ER) homeostasis. Accumulation of unfolded proteins in the ER induces the unfolded protein response (UPR), which consists of a set of signalling pathways that respond to the resulting ER stress1. In metazoan cells, the UPR is divided into three branches: inositol-requiring enzyme 1 (IRE1), ATF6 and PKR-like ER kinase (PERK)1. The IRE1 branch increases protein folding capacity by inducing translation of the transcription factor XBP12,3; the ATF6 branch is involved in the increase of ER folding ability4; and the PERK branch reduces the initiation of global translation through the phosphorylation of eIF2α5. eIF2α phosphorylation, in turn, leads to the selective translation of transcription factors such as ATF4, thereby increasing ER folding ability6. A unique ISR/PERK-mediated translational control mechanism, independent of the eIF2α phosphorylation/eIF2B axis, is crucial for recovery from the chronic ER stress response7. In budding yeast, activated Ire1 on the ER removes non-conventional introns from unspliced HAC1 mRNA (HAC1u)8,9,10,11,12, thereby relieving translational repression13,14. Translation of the spliced (induced) form of HAC1 mRNA (HAC1i) produces Hac1, a transcription factor that induces the expression of UPR target genes, which play crucial roles in increasing the protein folding and degrading abilities of the ER15. Although the UPR is thought to induce translational regulation in the pathogenic fungus Aspergillus fumigatus16, translational control in response to the UPR has not been evident in the yeast Saccharomyces cerevisiae.

Specific modification of ribosomal proteins is thought to be critical for regulating translation in eukaryotes. One example is the role of ribosome ubiquitination in the quality control system for aberrant translation. Ribosome-associated Quality Control (RQC) is a translation arrest-induced quality control pathway that leads to the co-translational degradation of the arrested products17,18,19,20,21. In the first step of RQC, abnormal stalling ribosomes are recognized, and specific residues in the stalled ribosomes are ubiquitinated. In yeast, the E3 ubiquitin ligase Hel2 ubiquitinates uS10 at K6 and K8 and plays a crucial role in RQC22,23,24. ZNF598, the mammalian homologue of Hel2, ubiquitinates the ribosomal proteins eS10 at K138/K139 and uS10 at K4/K8, thereby inducing translational arrest and RQC triggered by poly-lysine sequences in mRNA25,26,27. Collided ribosomes form a unique structural interface to induce E3 ligase Hel2/ZNF598-driven quality control pathways24,28. Moreover, sequential ubiquitination of the ribosomal protein uS3 triggers the degradation of nonfunctional 18S rRNA29.

Despite increased understanding of the roles of ribosome ubiquitination in quality control pathways, the physiological relevance of ribosome ubiquitination remains largely unknown. However, ribosome ubiquitination has been linked to cellular responses to stress. For example, K63 polyubiquitination may modulate oxidative stress responses, and ubiquitination of specific lysine residues of ribosomal proteins may contribute to stress responses30,31. Although more than 100 ubiquitination sites have been identified in ribosomes, the physiological relevance of ribosome ubiquitination remains unclear. Induction of the UPR in mammalian cells was shown to upregulate the expression of the ubiquitinated ribosomal proteins uS10, eS10 and uS332. Nevertheless, the exact role of ribosome ubiquitination in the UPR remains unknown.

The present study found that ribosome ubiquitination is essential for gene regulation during the UPR in yeast. The E3 ligase Not4-mediated ubiquitination of eS7A was required for resistance to tunicamycin (Tm), an ER stress-inducing compound. Ribosome profiling showed that ubiquitination of eS7A was required for translational controls during the UPR. These findings indicate that Not4-mediated monoubiquitination of eS7A is essential for controlling the translation of specific mRNAs during the ER stress response, including through the upregulation of HAC1i mRNA and the downregulation of HNT1 mRNA.

Results

Monoubiquitination of eS7A is required for translational regulation during the UPR in yeast

Ribosome ubiquitination increases significantly upon induction of the UPR in mammalian cells32. To assess the role of ribosome ubiquitination in the UPR in yeast, the levels of ubiquitinated ribosomal proteins were evaluated by affinity purification of ribosomes with FLAG-tagged Rpl25 from cells expressing N-terminal Myc-tagged Ubiquitin protein (Ub), as previously described22. The levels of the ubiquitinated ribosomal proteins uS10, uS3 and eS7A were substantially increased under UPR conditions (Fig. 1a). Not4 is an E3 ligase for the ribosomal proteins eS7A and eS7B in yeast33,34, and is involved in translation repression35. Cells expressing not4∆ mutant showed Tm-sensitive growth (Fig. 1b). In addition, the eS7a-4KR mutant, which involves lysine-to-arginine substitutions at all four Not4-specific ubiquitination sites, had the same level of Tm sensitivity as not4∆ mutant cells (Fig. 1b). Monoubiquitinated eS7A was not detected in not4∆ mutant cells (Fig. 1c), confirming that Not4 is responsible for the monoubiquitination of eS7A during the UPR. Because Hel2 was previously reported to form K63-linked polyubiquitin chains on Not4 monoubiquitinated eS7A and to play a crucial role in No-Go Decay (NGD)24, we assessed the involvement of Hel2 in the UPR. In contrast to Not4, the deletion of Hel2 (hel2∆) did not affect cell growth in the presence of Tm (Fig. 1b). In addition, neither the uS10 nor the uS3 mutant of Hel2-target lysine residues (uS10-K6/8R and uS3-K212R) affected cell growth in the presence of Tm (Fig. 1b). The uS10-Ub and uS3-Ub signals were not detected in the hel2∆ deletion mutant, whereas the eS7-Ub signal was not detected in the not4∆ deletion mutant (Supplementary Fig. 1), suggesting that eS7 ubiquitination is dependent on Not4. We previously reported that Hel2 elongates the ubiquitin chain at eS7 after Not4-dependent monoubiquitination, which is essential for mRNA quality control in NGD36. However, in contrast to not4∆ and the eS7-4KR mutant, the hel2∆ mutant did not show sensitivity to Tm (Fig. 1b). These results suggest that Not4-mediated monoubiquitination of the ribosomal protein eS7A is indispensable for cell survival under ER stress conditions, whereas Hel2-mediated polyubiquitination of eS7A is not.

Figure 1
figure 1

Not4-mediated monoubiquitinated eS7A is required for translational controls in the UPR in yeast. (a) Ubiquitinated proteins in the ribosome after the addition of tunicamycin. Yeast cells harboring pCUP1p-MYC-UBI and pRPS2(uS5)-FLAG or pRPL25(uL23)-FLAG were cultured in 800 mL of synthetic complete medium. Myc-Ubi expression was induced by culturing the cells in the presence of 0.1 mM Cu2+ for 2 h. Cell lysates were prepared and FLAG-tagged ribosomes were purified using an M2 FLAG-affinity resin (Sigma), as described22. Affinity purified samples were subjected to SDS-PAGE followed by western blotting with an anti-Myc antibody. The arrows indicate proteins previously identified by mass spectrometry. (b) The Not4 ubiquitination of ribosomal protein eS7A is crucial for UPR in yeast. Genetic screening was performed to identify the E3 ubiquitin enzyme NOT4 required for resistance to Tm. (c) Dependence of eS7A mono- and poly-ubiquitination on Not4. (d) Ribosome profiling showing up- and down-regulation of translation by the eS7A ubiquitination. The ribosome profiling and RNA-seq results represent two independent biological replicates. The correlations between replicates are shown in Supplementary Fig. 3a,b. (f) eS7A ubiquitination-dependent up- and down-regulation of specific mRNAs in response to UPR. The mRNA most upregulated by eS7A ubiquitination was HAC1, and the mRNA most upregulated was HNT1. (g) UPR does not inhibit bulk translation in wild-type and mutant cells. (h) Phosphorylation of eIF2α in response to amino acid depletion or Tm treatment. Shown are the levels of eIF2α phosphorylation in WT and S52A mutants in response to amino acid starvation and the presence of Tm. (a, c, h) Cropped gels or blots were display. All uncropped images are available in Supplemental Figure S7.

Full size image

These results suggested that translational control may play a role in the UPR in yeast and may involve eS7A ubiquitination. To test this, we then performed RNA-seq and ribosome profiling to investigate the regulation of translation in response to ER stress, and estimated translation efficiency (TE) by assessing both mRNA abundance and ribosome occupancy. During the early response, within 1 h after Tm treatment, the translation of 20 mRNAs was statistically and significantly changed (Supplementary Fig. 2a; q-value < 0.01), whereas > 200 mRNAs were up- or down-regulated 4 h after Tm treatment (Supplementary Fig. 2a). eS7A ubiquitination-dependent translational regulation was therefore monitored at 4 h. A modest translational response was observed in eS7A-4KR mutant cells, with statistically significant changes in the translation of 214 mRNAs (Fig. 1d,e; Supplementary Fig. 2b; q-value < 0.01). To examine the eS7A ubiquitination dependency of the involved mRNAs, TE was compared in eS7A-WT and eS7A-4KR mutant cells (Fig. 1d,e), with 29 and 12 mRNAs categorised as being up- and down-regulated, respectively, in response to eS7A ubiquitination (Fig. 1f). These subsets were identified using the formula “log2 TE fold change (eS7A-WT)—log2 TE fold change (eS7A-4KR)”, with mRNAs scored as > 2 and < − 2 defined being up- and down-regulated, respectively, in response to eS7A ubiquitination. Polysome analysis showed that UPR moderately repressed general translation in wild-type and eS7A-4KR mutant cells (Fig. 1g). The levels of phosphorylated eIF2α did not increase during the UPR (Fig. 1h), suggesting that initiation of general translation was not inhibited by phosphorylated eIF2α during the UPR. To rule out the effect of eS7A-4KR mutations on general translation, protein synthesis rates were measured in eS7A-WT and the eS7A-4KR mutant by puromycin labelling. Protein synthesis rates did not differ significantly in eS7A-WT and eS7A-4KR (Supplementary Fig. 3a,b), indicating that eS7A monoubiquitination is involved in regulating the translation of specific mRNAs in response to ER stress.

Not4-mediated monoubiquitination of eS7A plays a crucial role in upregulating translation during the UPR, with the translation of HAC1 most drastically upregulated in response to the UPR. The downregulation of translation of specific mRNAs during the UPR was also abrogated in eS7A-4KR mutant cells, with the translation of mRNA encoding Histidine triad NucleoTide-binding 1 (HNT1) being most drastically repressed (Fig. 1e). Hac1 induces the expression of long un-decoded transcript isoforms, and downregulation of HNT1 translation depends on the uORFs, leading to protein downregulation in response to the UPR37. Ribosome profiling confirmed the repression of HNT1 translation, with the TE being downregulated approximately 60-fold 4 h after Tm treatment. Importantly, the UPR-associated downregulation of HNT1 was significantly diminished in eS7A-4KR mutant cells (4-fold; Supplementary Fig. 2d), despite its level of mRNA being slightly increased (Supplementary Fig. 2d).

Not4-mediated eS7A monoubiquitination is required for translational regulation of HAC1i and HNT1 mRNA

We identified Hac1 as the most significantly upregulated gene during the UPR (Fig. 1d,e). HAC1u mRNA is stored in the cytoplasm in the absence of ER stress, and its translation is tightly suppressed by a base-pairing interaction between the intron and the 5′untranslated region (5′UTR)13,14,38. Excision of the intron by Ire1-dependent splicing in response to ER stress leads to robust translation of HAC1i mRNA, with the resulting Hac1 protein upregulating UPR target gene expression. Tm drastically and rapidly increased the TE of HAC1i mRNA (Fig. 2a; Supplementary Fig. 12a). This increase was less robust in eS7A-4KR mutant than in eS7A-WT cells (93.05-fold vs. 5.89-fold, respectively; Fig. 2a). Mapping of the footprints throughout HAC1i mRNA in eS7A-WT and eS7A-4KR mutant cells (Fig. 2b) suggested that this mRNA does not contain a strong translation pause site.

Figure 2
figure 2

Not4-mediated monoubiquitinated eS7A is required for upregulation of HAC1i translation in response to UPR in yeast. (a) Upregulation of HAC1i translation in response to UPR was diminished in eS7A-4KR mutant cells. (b) Map of the A-site position of footprints at HAC1. (c) Significant reductions in Hac1 protein levels in not4∆ and eS7A-4KR mutant cells. (d) Normalisation of Hac1 protein levels relative to tubulin levels. The normalised levels of Hac1 protein were significantly lower in eS7A-4KR mutant than in WT. (e) Upregulation of HAC1 mRNA in W303(WT), eS7A-WT and eS7A-4KR mutant strains. (f) Regulation of mRNA splicing of HAC1u was moderately reduced in eS7A-4KR mutant cells. (g) Splicing efficiency of HAC1 estimated by the ratio of total HAC1 mRNA to HAC1i mRNA in eS7A-WT and eS7A-4KR mutant cells. (h) Translation efficiency of HAC1, estimated by the ratio of Hac1 protein to HAC1i mRNA in eS7A-WT and eS7A-4KR mutant cells. (i) Translation efficiency after 4 h of Tm treatment, as estimated by ribosome footprints and mRNA reads in the eS7A-WT and eS7A-4KR mutant cells. (j) Translation of HAC1i mRNA is decreased in eS7A-4KR mutant cells. Polysome profiles were generated by continuous measurement of absorbance at 254 nm. Equal volumes of the fractions were collected and processed for northern blotting. (k) Quantification of HAC1i and HAC1u mRNA levels in sucrose gradient fractions. (c, f, j) Cropped blots were display. Cropped blots were display. All uncropped images are available in Supplemental Figure S8.

Full size image

To validate these results by ribosome profiling, the expression of HAC1 was evaluated at the splicing, translation and protein levels. Hac1 protein was detected 0.5 h after the addition of Tm to WT cells, but its signal was much weaker in not4∆ and eS7A-4KR mutant cells, being approximately 50% of the levels in eS7A-WT cells (Fig. 2c). The level of Hac1 protein normalized to that of tubulin also indicated that Hac1 protein was significantly downregulated in the eS7A-4KR mutant, being approximately 50% of the levels in eS7A-WT cells 4 h after Tm treatment (Fig. 2d). In eS7A-4KR mutant cells, induction of HAC1 mRNA by Tm treatment was intact (Fig. 2e–g), although this induction was moderately delayed by about 30 min after the addition of Tm (Fig. 2f,g). The splicing efficiency (the ratio of HAC1u + HAC1i mRNAs to HAC1i mRNA) was moderately reduced in not4∆ and eS7A-4KR mutant cells (Fig. 2g).

In comparing TE in eS7-WT and eS7-4KR cells 4 h after the addition of Tm based on reads of HAC1, we found that the translation of HAC1 mRNAs was approximately 4-fold lower in eS7-4KR than in wild-type (WT) cells (Fig. 2i). To validate TE by other methods, we analyzed the distribution of HAC1 mRNA by sucrose gradient ultracentrifugation (Fig. 2j,k). In the absence of Tm, the HAC1u mRNAs were detected on polysomes, with their distribution and levels being similar in eS7A-4KR and eS7A-WT cells (Fig. 2f,j,k). In the absence of Tm treatment, however, almost no footprints of ribosomes on HAC1u were observed in eS7A-4KR and eS7A-WT cells (Fig. 2b), consistent with previous findings. These results may have been due to the tightly packed configuration of ribosomes on HAC1u mRNA. After Tm treatment for 4 h, the levels of HAC1i mRNA on polysomes were moderately but significantly lower in eS7A-4KR than in eS7A-WT cells (Fig. 2b,k). Overall, the changes in the levels of HAC1i mRNA on polysomes were consistent with TE calculated based on the levels of HAC1i mRNA and Hac1 protein, or approximately 2-fold (Fig. 2h). The imperfect correlation of TE with the ratio of protein to mRNA level may be due to a difference in the efficiency of recovery of mRNA reads from ribosomes translating HAC1i mRNA in eS7A-WT and eS7A-4KR mutant cells.

Not4 monoubiquitinates eS7 at four lysine residues (Supplementary Fig. 4a), with K83 ubiquitination being primarily responsible for mRNA quality control24. To identify the ubiquitination site(s) of eS7A required for the upregulation of HAC1i, HAC1u mRNA splicing and Hac1 protein levels were examined in four mutants containing a single lysine residue, eS7A, susceptible to Not4-mediated monoubiquitination, eS7A-3KR-K72, eS7A-3KR-K76, eS7A-3KR-K83 and eS7A-3KR-K8424. Hac1 protein levels were significantly lower in eS7A-3KR-K72 and eS7A-3KR-K76 single-lysine and eS7A-4KR mutant cells (Supplementary Fig. 4b,d), but not in eS7A-3KR-K83 and eS7A-3KR-K84 single-lysine cells (Supplementary Fig. 4c,e). These results, which indicate that monoubiquitination of eS7A at lysine 83 or 84 is sufficient for the production of Hac1 protein, are consistent with a model in which translation of HAC1i mRNA is facilitated by monoubiquitinated eS7A at lysine residue 83 or 84. However, the possibility that mutation of eS7A could cause structural changes to the ribosome in addition to the ubiquitination defect cannot be excluded.

After Tm treatment, the translation of HNT1 mRNA is suppressed in an uORF-dependent manner37,39. We also found that HNT1 was most markedly repressed upon UPR (Fig. 1e). Hac1 is reported to be required to synthesize uORF-containing HNT1 mRNAs, making it essential for the downregulation of HNT1. Interestingly, assessment of ribosome occupancy on HNT1 mRNA (Fig. 3a) showed that the ribosomes efficiently read through the uORF in the eS7A-4KR mutant after Tm treatment. The reduction of Hnt1 protein after Tm treatment was significantly restored in the eS7A-4KR mutant (Fig. 3b), but the level of long transcripts containing uORFs was not reduced in the mutant (Fig. 3c). These findings indicate that, although the level of Hac1 was lower in eS7A-4KR mutant than in es7A-WT cells, it was sufficient in the former to induce uORF-containing HNT1 mRNA under UPR conditions. Thus, independently of Hac1, eS7 ubiquitination may facilitate the translation of uORFs, thereby repressing the translation of HNT1 ORF (Fig. 3d).

Figure 3
figure 3

Downregulation of HNT1 translation during UPR was defective in eS7A-4KR mutant cells. (a) Map of the A-site position of footprints at HNT1 in eS7A-WT or eS7A-4KR mutant cells in the absence (-Tm) or presence of (+ Tm) for 4 h. (b) Hnt1-FLAG protein level was significantly reduced by Tm treatment. (c) The uORF-containing HNT1 mRNA was induced by Tm treatment in eS7A-WT and eS7A-4KR mutant cells. (d) Model for uORF-dependent translational downregulation of HNT1 and the role of eS7 ubiquitination in this regulation. In eS7-WT cells, translation initiation from uORF3 reduced initiation from HTN1 main ORF in the presence of Tm. In eS7-4KR cells, translation initiation from uORF3 was reduced, and initiation from HTN1 main ORF was not downregulated upon UOR. (b, c) Cropped blots were display. All uncropped images are available in Supplemental Figure S9.

Full size image

Deubiquitinating enzyme complex Upb3-Bre5 is involved in the regulation of eS7A ubiquitination during UPR

Our results demonstrated that eS7A ubiquitination is required for translational controls during UPR. We therefore assessed whether the upregulation of eS7A ubiquitination is dependent on Ire1 and Hac1. We found that eS7A ubiquitination was increased in ire1∆ and hac1∆ mutant cells 4 h after Tm addition (Fig. 4a), indicating that the Ire1-Hac1 pathway is not required for the upregulation of eS7A ubiquitination.

Figure 4
figure 4

Deubiquitinating enzyme complex Upb3-Bre5 is involved in the regulation of eS7A ubiquitination during UPR. (a) Regulation of eS7A ubiquitination during UPR was independent of Ire1 and Hac1. (b) UPR had no effect on Not4 levels. (c) A genetic screen to identify the enzyme response for the deubiquitination of polyubiquitinated S7A. The levels of polyubiquitinated eS7A 2 h after Tm addition were significantly and specifically increased in ubp3∆ mutant cells. (d) Ubp3 is a deubiquitinating enzyme of eS7A and is required for Tm resistance. (e) Levels of polyubiquitinated eS7A during UPR in ubp3∆ mutant cells. (f) Monosomes and polysomes, but not free 40S, in both wild-type and ubp3∆ mutant cells contain polyubiquitinated eS7A. (g) The splicing of HAC1u mRNA was intact in ubp3∆ mutant cells. (h) Hac1 protein level was slightly reduced in ubp3∆ mutant cells. (i) Ubp3 and its co-factor Bre5 were significantly and gradually decreased as a function of time during UPR. (j) Downregulation of Ubp3 but not Bre5 was impaired in ire1∆ cells, but not in hac1∆ cells. (a, b, c, e, f, h, i, j) Cropped gels or blots were display. All uncropped images are available in Supplemental Figure S10.

Full size image

To further elucidate the mechanism underlying the regulation of eS7A ubiquitination, we measured the expression of the E3 ligase Not4, which is responsible for the monoubiquitination of eS7A. We found that Not4 expression remained unchanged after the addition of Tm (Fig. 4b). We next hypothesized that the increase in monoubiquitinated eS7A in response to Tm is caused by a decrease in deubiquitinating activity. To test this possibility, we first performed a genetic screen to identify the enzyme responsible for deubiquitinating ubiquitinated eS7A. The levels of ubiquitinated eS7A were significantly and specifically increased in ubp3∆ mutant cells 2 h after the addition of Tm (Fig. 4c, lane 4). Deletion of UBP3 conferred sensitivity to Tm (Fig. 4d), suggesting that Ubp3 is the enzyme responsible for deubiquitinating ubiquitinated eS7A and that it contributes to resistance to ER stress. To measure the levels of ubiquitinated eS7A during UPR, we used N-terminal Myc-tagged ubiquitin, followed by ribosome affinity purification22. Tm addition significantly upregulated monoubiquitinated eS7A in a time-dependent manner (Fig. 4e). Western blot analysis of sucrose gradient fractions showed that monosomes or polysomes, but not free 40S subunits, contained ubiquitinated eS7A in both WT and ubp3∆ mutant cells (Fig. 4f), suggesting that translating ribosomes contain polyubiquitinated eS7A. In ubp3∆ mutant cells, the levels of mono- and di-ubiquitinated eS7A were increased in mono- and polysome fractions, but not in the 40S subunit (Fig. 4f), indicating that eS7A is the substrate of Ubp3 in monosomes and polysomes but not in the 40S subunit. Assessments of the levels of expression of HAC1 mRNA and Hac1 protein in the ubp3∆ deletion mutant showed that Hac1 protein expression was significantly decreased (Fig. 4g,h).

Next, we assessed whether the UPR results in the downregulation of the deubiquitinating enzyme. Ubp3 forms a complex with its cofactor Bre5 in vivo, with complex formation required for Ubp3 function40,41. Western blot analysis of Ubp3-3HA and Bre5-3HA expressed from endogenous promoters showed that the levels of the deubiquitinating enzyme Ubp3 and its cofactor Bre5 decreased significantly and gradually during the UPR (Fig. 4i). The downregulation of Ubp3 was impaired in ire1∆ but not in hac1∆ mutant cells, although neither of these UPR factors was required for the downregulation of Bre5 (Fig. 4j). These results indicate that activated Ire1 induces the downregulation of Ubp3, but not of Bre5, during the UPR. Taken together, these findings indicate that downregulation of deubiquitination in response to UPR increases the levels of monoubiquitinated eS7A, a downregulation that is affected by, but not completely dependent on, the Ire1-Hac1 pathway (Fig. 5).

Figure 5
figure 5

Model for regulation of eS7A ubiquitination in response to UPR and its roles in translational controls. Not4-mediated monoubiquitination of eS7A at lysine 83 or 84 is required to control translation during UPR. Tm-induced ER stress increased the levels of ubiquitinated eS7A in a manner independent of Ire1 and Hac1. Monoubiquitinated eS7A is required for upregulation of specific mRNAs including HAC1i mRNA and downregulation of HNT1 mRNA. Ribosome ubiquitination of eS7A is therefore likely required for translational control in response to ER stress in yeast.

Full size image

Discussion

Ubiquitination of ribosomal proteins plays an essential role in quality control induced by ribosomal stalling22,23,24,26,28,37. However, the physiological functions of ribosome modifications remain unclear. The findings of this study indicate that ribosome eS7 monoubiquitination is required for translational controls during ER stress responses in yeast. Ribosome profiling revealed that eS7A monoubiquitination was necessary for translational up- and down-regulation of specific mRNAs. Monoubiquitination of eS7A facilitated the translational upregulation of HAC1i mRNA, a master transcription factor in the UPR, and the downregulation of HNT1 during ER stress. The mechanisms underlying the roles of eS7A ubiquitination in translational regulation of specific mRNAs during ER stress, however, remain unclear. Hac1-mediated production of long transcripts containing uORFs was shown to repress the translation of histidine triad nucleotide-binding 1 (HNT1) mRNA37. We recently reported that uORF3 is required for HNT1 expression, and that translation of HNT1 is efficiently repressed by a strong Kozak sequence uORF3 during UPR39. These findings suggest that initiation of translation at the AUG codon of uORF3 is inefficient, and that leaky scanning of uORF3 is responsible for translation of HNT1. Although Tm treatment reduced the production of Hnt1 protein in eS7A-WT, it did not alter Hnt1 protein production in the eS7A-4KR mutant (Fig. 3b), despite the level of long transcripts containing uORFs not being changed in this mutant (Fig. 3c). These findings suggested that initiation of translation at the AUG codon of uORF3 is repressed in the eS7A-4KR mutant, and that initiation of translation at the AUG codon of the HNT1 ORF is stimulated by the increase in leaky scanning of uORF3. Thus, eS7 ubiquitination may facilitate the translation of uORF3, thereby repressing the translation of HNT1 ORF.

Understanding translational regulation in response to the accumulation of unfolded proteins in the ER can be improved by determining the molecular mechanisms underlying eS7A monoubiquitination-mediated regulation of translation during the UPR. Our results suggested that initiation of translation of specific mRNAs, including HAC1i and uORF3 of HNT1 mRNA, depends on eS7 ubiquitination by an as yet unknown mechanism, and that reduced translation from these initiation codons resulted in defects in the upregulation of HAC1i mRNA and the downregulation of HNT1 mRNA upon UPR (Fig. 5). These interactions between eS7A and translation initiation factors may be critical for initiating translation at specific sites. eIF3 binding to ribosomes elongating and terminating on short upstream ORFs has been shown to promote the re-initiation of GCN4 translation42,43,44,45. Moreover, eIF3-dependent translation initiation mechanism contributes to translational recovery in chronic ER stress response7.The recently resolved cryo-EM structure of eIF3 in the context of the human 43S pre-initiation complex44,46,47, and the proximity of eIF3 to eS7A in a yeast 48S pre-initiation complex model suggest that eS7A is associated with specific initiation factors47 (Supplementary Fig. 5). Modification of eS7A, including ubiquitination, may affect the interaction of the 40S subunit with translation initiation factors in the pre-initiation complex, modulating the initiation of translation of specific mRNAs.

The level of monoubiquitinated eS7A in response to UPR was also upregulated in ire1∆ and hac1∆ mutant cells, indicating that the Ire-Hac1 pathway is not necessary for the regulation of eS7A ubiquitination. These results strongly suggest that the deubiquitinating enzyme complex Upb3-Bre5 was involved in the regulation of eS7A ubiquitination. The level of monoubiquitinated eS7A was upregulated in ubp3∆ mutant cells. Ubp3 is the enzyme that deubiquitinates ubiquitinated eS7A and contributes to cell resistance to ER stress. Bre5 is a regulatory subunit that is downregulated upon UPR, even in ire1∆ and hac1∆ mutant cells, indicating that the downregulation of the deubiquitinating enzyme complex Ubp3-Bre5 is independent of the Ire1-Hac1 pathway. These findings suggest that ER stress reduced the levels of the deubiquitinating enzyme complex Ubp3-Bre5, leading to an increase in the ubiquitinated form of eS7A. Monoubiquitinated eS7A facilitates the translation of HAC1i mRNA, resulting in efficient induction of Hac1-target genes and downregulation of HNT1 by as yet unknown mechanisms. Further investigations are needed to determine the mechanism underlying the ribosome ubiquitination-mediated regulation of translation initiation upon UPR.

Materials and methods

Yeast strains and genetic methods

The S. cerevisiae strains used in this study are listed in Table 1. Gene disruption and C-terminal tagging were performed as previously described48,49. S. cerevisiae W303-1a based strains were obtained by established recombination techniques using PCR-amplified cassette sequences (kanMX4, hphMX4, natMX4, natNT2 or HISMX6)48,49. To construct strains of essential ribosomal protein genes (uS10, uS3, eS7AeS7B), the shuffle strain transformed with plasmid expressing mutant ribosomal protein products was grown on SDC plates containing 0.5 mg/mL 5-fluoroorotic acid (5-FOA, #F9001-5, Zymo Research) and a strain lacking URA3 was isolated.

Table 1 Yeast strains in this study.
Full size table

Plasmid constructs

Specific DNA sequences were PCR amplified using gene specific primers and cloned into vectors using PrimeSTAR HS DNA polymerase (#R010A, Takara-bio) and T4 DNA ligase (#M0202S, NEB). The sequences of all cloned DNAs amplified by PCR were verified by sequencing. Plasmids and primers used in this study are listed in Tables 2 and 3, respectively.

Table 2 Plasmids used in this study.
Full size table
Table 3 Primers used in this study.
Full size table

Yeast culture and media

All yeast cells were cultured at 30 °C in YPD or synthetic complete (SC) medium containing 2% glucose and harvested during log phase by centrifugation. To induce ER stress, yeast cells were grown at 30 °C until their absorbance at 600 nm was 0.2, treated with 1 µg/mL tunicamycin (Tm, #208-08243, Wako) for ~ 4 h and harvested. For polysome analysis, yeast cells cultured at 30 °C for 3 h after Tm addition were treated for 5 min with 0.1 mg/mL cycloheximide (CHX, #06741-04, Nacalai tesque) before harvesting by centrifugation. All cell pellets were frozen in liquid nitrogen immediately after harvest and stored at − 80 °C until used.

RNA isolation

Total RNA was isolated from yeast cells by acidic phenol RNA extraction24 with several modifications. Each cell pellet was re-suspended on ice in 200 µL RNA buffer (300 mM NaCl, 20 mM Tris–HCl (pH 7.5), 10 mM EDTA, 1% SDS, in DEPC-treated MilliQ water), followed by immediate addition of 250 µL of water-saturated phenol. The preparations were mixed well by vortexing for 10 s, incubated at 65 °C for 5 min, again mixed by vortexing for 10 s and chilled on ice for 5 min. After centrifugation at 16,000 × g for 5 min at room temperature, 190 µL of each water layer was transferred to a new 1.5 mL RNase free tube. A 250 µL aliquot of water-saturated phenol was added and the procedure was repeated. After centrifugation, 170 µL of each water layer was transferred to a new 1.5 mL RNase free tube; 200 µL of water-saturated phenol/chloroform (1:1) was added; and the tubes were vortexed for 10 s and centrifuged at 16,000 × g for 5 min at room temperature. A 150 µL aliquot of each water layer was transferred to a new 1.5 mL RNase free tube, to which was added 200 µL of water-saturated phenol/chloroform/isoamylalchol (25:24:1), followed by vortexing for 10 s and centrifugation at 16,000 × g for 5 min at room temperature. Finally, 130 µL of each water layer was transferred to a new 1.5 mL RNase free tube and subjected to ethanol precipitation. Each RNA pellet was dissolved in 20–30 µL of DEPC-treated water.

RNA electrophoresis and northern blotting

RNA electrophoresis and northern blotting were performed as described24 with the following modifications. A 6 µL aliquot (1 µg) of total RNA solution was mixed with 24 µL of glyoxal solution [600 µL DMSO, 200 µL deionized 40% glyoxal, 120 µL 10 × MOPS buffer (200 mM MOPS, 50 mM NaOAc, 10 mM EDTA, pH 7.0), 62.5 µL of 80% glycerol, and 17.5 µL of DEPC-treated water in 1 µL] and 3 µL of RNA loading buffer (50% glycerol, 10 mM EDTA pH 8.0, 0.05% bromophenol blue and 0.05% xylene cyanol). The mixture was incubated at 74 °C for 10 min and left to stand on ice for 10 min. A 25 µL aliquot of each sample was electrophoresed at 200 V for 40 min on a 1.2% agarose gel in 1 × MOPS buffer (20 mM MOPS, 5 mM NaOAc and 1 mM EDTA, pH 7.0), followed by capillary transfer of RNA to Hybond-N+ membranes (GE Healthcare) with 20× SSC (3 M NaCl and 300 mM trisodium citrate dihydrate) for 18 h. RNA on the membranes was cross-linked with CL-1000 ultraviolet crosslinker (UVP) at 120 mJ/cm2. The membranes were incubated with DIG Easy Hyb Granules (#11796895001, Roche) for 1 h in a hybridization oven at 50 °C. DIG-labelled probe prepared using PCR DIG Probe Synthesis Kit (#11636090910, Roche) was added and the membranes incubated for over 18 h. The membranes were washed twice with wash buffer I (2 × SSC, 0.1% SDS) for 15 min each in a hybridization oven at 50 °C, washed once with wash buffer II (0.1 × SSC, 0.1% SDS) for 15 min at 50 °C, and washed once with 1× maleic acid buffer (100 mM maleic acid, 150 mM NaCl, pH 7.0, adjusted by NaOH) for 10 min at room temperature. The membranes were incubated with Blocking Reagent (#11096176001, Roche) for 30 min and then with anti-Digoxigenin-AP, Fab fragments (#11093274910, Roche) in Blocking Reagent for 1 h. The membranes were washed three times with wash buffer III (1× maleic acid buffer, 0.3% tween 20) for 10 min each, incubated in equilibration buffer (100 mM Tris–HCl, 100 mM NaCl, pH 9.5), and reacted with CDP-star (#11759051001, Roche) for 10 min. Chemiluminescence was detected using LAS-4000 (GE Healthcare), and relative RNA levels were determined using Multi Gauge v3.0 (Fujifilm, Japan).

Trichloroacetic acid (TCA) precipitation for protein preparation

Yeast cell pellets in 1.5 mL tubes were resuspended in 500 µL ice-cold TCA buffer (20 mM Tris–HCl pH 8.0, 50 mM NH4OAc, 2 mM EDTA, and 1 mM PMSF) and transferred to new 1.5 mL tubes containing 500 μL 20% TCA and 500 μL 0.5 mm Zirconia/Silica Beads (BioSpec). The mixtures were vortexed three times for 30 s each, and the supernatants were transferred to new 1.5 mL tubes. A 500 µL aliquot of ice-cold TCA buffer was added to each tube, followed by vortexing for 30 s and transfer of the supernatant to a new 1.5 mL tube. The lysates were centrifuged at 14,000 rpm for 15 min at 4 °C), the supernatants were discarded, and each pellet was resuspended in SDS sample buffer (125 mM Tris–HCl pH 6.8, 4% SDS, 20% glycerol, 100 mM DTT, and 0.01% bromophenol blue) and heated at 95 °C for 5 min or at 65 °C for 15 min. These samples were subsequently loaded onto SDS-PAGE or Nu-PAGE gels.

Ribosome purification to observe ribosome ubiquitination

To assess ribosome ubiquitination during ER stress, ribosomes were purified with Myc-tagged ubiquitin (Myc-Ubi) and the FLAG-tagged ribosomal protein uL23 (uL23-FLAG), as described previously22. Yeast cells harbouring pCUP1p-MYC-UBI and pRPL25(uL23)-FLAG were cultured in 800 mL of synthetic complete medium. To induce the expression of Myc-Ubi, the cells were cultured in the presence of 0.1 mM Cu2+ for 1 h, followed by the addition of Tm to a concentration of 1 µg/mL and harvesting at the indicated time points. Cell lysates were prepared, and FLAG-tagged ribosomes were purified using M2 FLAG-affinity resin (Sigma), as described previously22. Affinity purified samples were subjected to SDS-PAGE followed by staining with Coomassie brilliant blue (CBB) or western blotting with an anti-Myc antibody.

Protein electrophoresis and western blotting

Protein electrophoresis and western blotting were performed as described previously24 with the following modifications. Protein samples were separated by SDS-PAGE or Nu-PAGE, and stained with CBB or transferred to PVDF membranes (Immobilon-P, Millipore). After blocking with 5% skim milk in PBST (10 mM Na2HPO4/NaH2PO4 pH 7.5, 0.9% NaCl, and 0.1% Tween-20), the membranes were incubated with primary antibodies (Table 4) for 1 h at room temperature followed by three washes with PBST and further incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. If detecting HA-tagged proteins, the membranes were incubated with HRP-conjugated antibodies. After three washes with PBST, chemiluminescence was detected by LAS4000 (GE Healthcare).

Table 4 Antibodies used in this study.
Full size table

Sucrose density gradient (SDG) centrifugation

SDG was performed as described22 with the following modifications. Yeast cells were grown exponentially at 30 °C and treated with 0.1 mg/mL cycloheximide for 5 min before harvesting by centrifugation. The cell pellets were frozen and ground in liquid nitrogen using a mortar and pestle. The cell powder was resuspended in lysis buffer (20 mM HEPES–KOH, pH 7.4, 100 mM potassium acetate, 2 mM magnesium acetate, 0.5 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride; Complete mini EDTA-free; #11836170001, Roche) to prepare the crude extracts. Sucrose gradients (10–50% sucrose in 10 mM Tris–acetate, pH 7.4, 70 mM ammonium acetate, and 4 mM magnesium acetate) were prepared in 25 × 89 mm polyallomer tubes (Beckman Coulter) using a Gradient Master (BioComp). Crude extracts (the equivalent of 50 A260 units) were layered on top of the sucrose gradients, followed by centrifugation at 150,000 × g in a P28S rotor (Hitachi Koki, Japan) for 2.5 h at 4 °C. The gradients were fractionated (BioComp Piston Gradient Fractionator), and the polysome profiles generated by continuous measurement of absorbance at 254 nm using a single path UV-1 optical unit (ATTO Biomini UV-monitor) connected to a chart recorder (ATTO digital mini-recorder). For western blotting of these fractions, 900 µL of each fraction were mixed with 180 µL of 100% TCA and the mixtures incubated for 15 min at 4 °C. After centrifugation at 14,000 rpm for 15 min at 4 °C, the supernatants were removed, and each pellet was dissolved in SDS sample buffer (125 mM Tris–HCl pH 6.8, 4% SDS, 20% glycerol, 100 mM DTT, and 0.01% bromophenol blue) and heated at 65 °C for 15 min.

Spot assay

Yeast cells were cultured in 2 mL YPD or SC medium containing 2% glucose at 30 °C for 12–24 h and adjusted to an optical density at 600 nm of 0.3. Ten-fold serial dilutions were prepared in 1.5 mL tubes and spotted onto plates with and without Tm. The plates were incubated at 30 °C for 2–3 days.

Ribosome profiling and RNA-seq

To induce ER stress, yeast cells were grown at 30 °C until reaching an optical density at 600 nm of 0.2. The cells were treated with 1 µg/mL Tm for ~ 4 h, harvested by vacuum filtration, and lysed by cryogenic grinding in a mixer mill (Retsch MM400). Whole cell lysates containing 10 µg of total RNA were each treated with 12.5 units of RNase I (Epicentre) at 23 °C for 45 min, and the ribosome fraction was sedimented through a 1 M sucrose cushion. The ribosome protected mRNA fragments were extracted with TRIzole regent (Life Technologies) and used for library preparation.

Library preparation was performed as described50 with the following modifications. For ribosome profiling analysis, whole cell lysates containing 20 μg of total RNA were each treated with ten units of RNase I (Epicentre) at 24 °C for 45 min. Linker DNA consisted of 5′-(Phos)NNNNNIIIIITGATCGGAAGAGCACACGTCTGAA(ddC)-3′, with (Phos) indicating 5′ phosphorylation; (ddC) indicating a terminal 2′, 3′-dideoxycytidine; and Ns and Is indicate random barcodes for eliminating PCR duplication and multiplexing barcodes, respectively. The linkers were pre-adenylated with a 5′ DNA Adenylation kit (NEB), and then used for the ligation reaction. Un-reacted linkers were digested with 5′ deadenylase (NEB) and RecJ exonuclease (epicentre) at 30 °C for 45 min. RNA was reverse transcribed using the oligonucleotide primer, 5′-(Phos)NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG (iSp18)GTGACTGGAGTTCAGACGTGTGCTC-3′. PCR was performed with the primers, 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′, where Js indicate reverse complement of the index sequence determined during Illumina sequencing. For RNA-seq analysis, total RNA was extracted from lysate using Trizol reagent (Life Technologies); rRNAs were removed from the total RNA using the Ribo-Zero Gold rRNA Removal Kit (Yeast) (Illumina); and the cDNA libraries were prepared using a TruSeq Stranded mRNA Library Prep Kit (Illumina). The libraries were sequenced on a HiSeq 2000/4000 (Illumina). The reads were mapped to yeast transcriptome, removing duplicated reads based on random barcode sequences. The analyses for ribosome profiling were restricted to read lengths of 30–33 nt for eS7-WT (0 h after Tm treatment), 29–33 nt for eS7-WT (4 h after Tm treatment), and 28–32 nt for eS7A-4KR datasets. The position of the A-site from the 5′-end of the reads was estimated based on the length of each footprint. The offsets using for analysis of ribosome profiling were 17 for 32–33 nt, 16 for 29–31 nt and 15 for 28 nt reads. For analysis of RNA-seq, an offset 15 was used for all mRNA fragments. The DESeq package was used to calculate the fold change of mRNA expression and TE51.