Table 1 Primers sequences used for qRT-PCR.

From: Cir-ITCH inhibits gastric cancer migration, invasion and proliferation by regulating the Wnt/β-catenin pathway

Gene Forward primer Reverse primer Probe
cir-ITCH (Taqman) GCAGAGGCCAACACTGGAA TCCTTGAAGCTGACTACGCTGAG CCGTCCGGAACTATGAACAACAATGGCA
GAPDH (Taqman) CCATGACCCCTTCATTGACC TTGATTTTGGAGGGATCTCG CTGAGAACGGGAAGCTTGTC
Linear ITCH TAGACCAGAACCTCTACCTCCTG TTAAACTGCTGCATTGCTCCTTG  
Linear ITCH1 GGAGACAACGCCTTAACC CATCTACTGTGACCTCTACG  
Linear ITCH2 CAACAGAGACAATAGGAGACT TCAGAAGTGGCAGATGGT  
Linear ITCH3 GATAACATCCAGTAACCACAG ATAACAGCCACCTTGACAG  
Linear ITCH4 GGCAGCACTGGATTGTATA GCAACCACTGAAGGAACT  
Circular ITCH ACAAGAACAACAACGTGGCA GCTCTTTGTCACCTCCAAGC  
c-Myc TTCGGGTAGTGGAAAACCAG CAGCAGCTCGAATTTCTTCC  
CyclinD1 GAGGAGCAGCTCGCCAA CTGTCAAGGTCCGGCCAGCG  
GAPDH GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC  
miR-216b ACACACTTACCCGTAGAGATTC Universal primer  
miR-17 CAAAGTGCTTACAGTGCAGGTA Universal primer  
miR-214 ACAGCAGGCACAGACAGGCAGT Universal primer  
miR-7 TGGAAGACTAGTGATTTTGTT Universal primer  
miR-128 TCACAGTGAACCGGTCTCTTT Universal primer  
U6 GGGCAGGAAGAGGGCCTAT Universal primer