Table 4 HSC gene pool primers.

From: Development of Small Molecule MEIS Inhibitors that modulate HSC activity

GeneForward PrimerReverse Primer
GAPDHTTGATGGCAACAATCTCCACCGTCCCGTAGACAAAATGGT
B-ActinATGGAGGGGAATACAGCCCTTCTTTGCAGCTCCTTCGTT
Sirt1GACGGTATCTATGCTCGCCTACACAGAGACGGCTGGAACT
Sipa1CGAGGAAGCTTCTGGAACATCAGTACAGGATGCCCACCTT
Tcp11/2AACATAGCTCCACGCCTAGCCTGGAGAGCTGACCGACAAG
Gli1GAGGTTGGGATGAAGAAGCAGGAGACAGCATGGCTCACTA
Als2GAGAAGAGCGCGGAGCTGCTTTGAGTCCATCGGTCAGG
Tpm1CTCCGAGGCTCTCAAAGATGTCCAACTCCTCCTCAACCAG
Map3k7CTCGTCCTCCTCCTCGTCTTCAAAAGCTCCTCTTCCGACA
IL-2AACTCCCCAGGATGCTCACCGCAGAGGTCCAAGTTCATC
Zfp317TGAATTTTGTTTCTTGACATTTCCGGAGACAGGGGATCCTGTTA
RB1ACAGATTTGTCCTTCCCGTGCCATGATTCGATGCTCACAT
TxnipGATGCAAGGGTCTCAGCAGTAGCTCGAAGCCGAACTTGTA
AHRTAGGCTCAGCGTCAGCTACCCTCCTTCTTGCAAATCCTGC
Hif1aGGCGAGAACGAGAAGAAAAAGAGCTCACATTGTGGGGAAG
Dnm1lTGCCTCAGATCGTCGTAGTGCGTGGACTAGCTGCAGAATG
Inpp5dGTGAAGAACCTCATGGGGACGCTGTTCCGGAATTGTGTTT
CblTGCACGGACTAAGATTCCAGATCGCTCGCTTCGACTTCTT
ItchCCTTATGTAGAAGTCACAGTAGTCACCTACAAGCTGCAAAGTCA
Vwa9AACCTGCTTGGAGTCTGCATAGCTAGGGAGTGTCGCAGTG
Meis1GTTGTCCAAGCCATCACCTTATCCACTCGTTCAGGAGGAA
CaluGGAGCTCACTCCCTGGGTAGGCTTGCTCAAAGCAAAGG
ApcCAGCTTTTACAGTCCCAGGCTCTGACCACTACTGGAGGCTG
Cited2GGCTGTCCCTCTATGTGCTGCATATGGTCTGCCATTTCCA
CD81CTGCACCAAATGCATCAAATGTACAGCAGGCTGGTGGTCT
Homer1GGTGGAAAAGCAACTGCAAACATGAGCTCGAGTGCTGAA
Spp1TTGGCAGTGATTTGCTTTTGTCTGCTTCTGAGATGGGTCA
Skp2GGCAAAGGGAGTGACAAAGAAGGAGCAGCTCATCTGGAAG
Clip4GCAGTGTTGGGAGAGTCCATCTCGTGGAAGGAGTGTGTG
Rbl1AATGGTCCAGGAAACACGACGGAAAGTACGGGGTGAGCTA
Gfi1bCCAGAAGTCGGACATGAAGTTGAAGCCTGTGTGCTTGCGG
Trp53CTAGCATTCAGGCCCTCATCAATGTCTCCTGGCTCAGAGG
St6galnac6GCAGCAGTTTGACGACCTCTATCACCATGGTAAACCAGCC
C030006k11RikGCAGGTCTTTGAAGCAGGTGCAGAACCCGCGAGTATTTCT
Dnmt3aTACATCAGCAAACGGAAACGCCTCCTCCACCTTCTGAGACT
Akt1CATGAACGACGTAGCCATTGGCCGTTCCTTGTAGCCAATA
Rbl2TGAAGCAATGCCTTCTCCTCTTCCGTCGTCCAAGAGAATC
Cfl2ATGACTTCATCATTCACTGTAACTCCTCCTTCTTCTCGTCCCAGTG
Tsc-1TGAGGTAAACAGCTGAGGGGACTGTTCTGGGGACAGATGG
MatkTGAAGCCAAGGAGGAAACAGTGTGCTCCCAGAGTCAGATG
hTet2AGAAAAGGGAAAGGAGAGCGGAGAGGGTGTGCTGCTGAAT
MycTGAAGTTCACGTTGAGGGGAGAGCTCCTCGAGCTGTTTG
Elf4AGCCCAGTGATCTGGTCTTCAGGATAGGGGACCTGTTCCA
Akt2TGGACCACAGTCATCGAGAGCTTGTAATCCATGGCGTCCT
Eci2CGAGTTGGCTGAATGGAGTACCAGCTGTGGGAATCTCTGT
cdc42GGGATCTGAAGGCTGTCAAGCTTCTTCGGTTCTGGAGGCT
Gfi1TGGAGCTCTGACTGAAGGCTTCCCTGTCAGTACTGTGGCA
Hoxa9ACAATGCCGAGAATGAGAGCGTTCCAGCGTCTGGTGTTTT
Runx1TTGCCACCTACCATAGAGCCGGTGGACAGAGGAAGAGGTG
Egr1GAGCGAACAACCCTATGAGCGGCCAGTATAGGTGATGGGA
Id1GAGTCTGAAGTCGGGACCACCCTCAGCGACACAAGATGC
MybTGTCCTCAAAGCCTTTACCGGCGTTCACGTATTTCCGAG
Cdkn2cGGGGGACCTAGAGCAACTTACCTCCGGATTTCCAAGTTTCA
Nr4a1AGTTGGGGGAGTGTGCTAGACTCGTTGCTGGTGTTCCATA
Ptpmt1GTGCATTGTAAGGCTGGTCGGGCGATCGCTTCTATAGCCT
Nfat5CGCCCAAGTCCCTGTACTCAACTCCTTTGGGAGAAGATCA
Foxo3TTGTCCCAGATCTACGAGTGGCTGTGCAGGGACAGGTTGT