Table 3 RT-PCR primer list for TALE Family, Pbx, Hoxa9 and TGIF target genes.

From: Development of Small Molecule MEIS Inhibitors that modulate HSC activity

Gene (human)Forward PrimerReverse PrimerFamily or Modulator
Meis1GGGCATGGATGGAGTAGGCGGGTACTGATGCGAGTGCAGTALE family
Meis2GAAAAGGTCCACGAACTGTGCCTTTCATCAATGACGAGGTCGATTALE family
Meis3ATGGCCCGGAGGTATGATGAGAAGAGCGGGTGTCCATAGATALE family
Pbx1CATGCTGTTAGCGGAAGGCCTCCACTGAGTTGTCTGAACCTALE family
Pbx2ATGGACGAACGGCTACTGGCCCCGATGTCTTGCTTCCCTALE family
Pbx3ATTACAGAGCCAAATTGACCCAGTCTCGGAGAAGGTTCATCACATTALE family
Pbx4TCCGTGGCATTCAAGACGAAGTGGTAAATCTGTCGGATCTGGGTALE family
pKnox1ATAGACAGCTATCAAGATGGGCAGCATCGGGTTCAGAGCAGTTTTALE family
pKnox2GACGCTGCTGTTTGAGAAATGATCGCTGAAGAAGGGTTTGTGTALE family
TGIF1GGGATTGGCTGTATGAGCACCGGCGGGAAATTGTGAACTGATALE family
TGIF2TGACCCCTGGTAGCACACTTAGTGGTGGCGTGTTGAAGAGTTALE family
TGIF2LXCAAAGCCCGGTGGAAAAAGACCAAGAACTCTGCCTGTATCTGCTALE family
Abca1ACCCACCCTATGAACAACATGAGAGTCGGGTAACGGAAACAGGTGIF
Abcg1ATTCAGGGACCTTTCCTATTCGGCTCACCACTATTGAACTTCCCGTGIF
ARTTGTGTCAAAAGCGAAATGGAGTCAATGGGCAAAACATGGPBX1
SPOCK2GGACGAGCAATGGCTGTCGTCGTCATGGTGTGGCCTGCGTTGTPBX1
LAMC2CTCTGCTTCTCGCTCCTCCTCTGTGAAGTTCCCGATCAAPBX1
ErgCGTGCCAGCAGATCCTACGGGTGAGCCTCTGGAAGTCGHoxa9
Flt3AGGGACAGTGTACGAAGCTGGCTGTGCTTAAAGACCCAGAGHoxa9
Lmo2AAGCGGATTCGTGCCTATGAGAGTTGATGAGGAGGTATCTGTCAHoxa9
Sox4AGCGACAAGATCCCTTTCATTCCGTTGCCGGACTTCACCTTHoxa9
MybGAAAGCGTCACTTGGGGAAAATGTTCGATTCGGGAGATAATTGGHoxa9