Table 2 RT-PCR primer list for HDR and S-phase genes.

From: Development of Small Molecule MEIS Inhibitors that modulate HSC activity

GeneForward PrimerReverse Primer
Mcm2AGGAACTCATTGGTGATGGCTCAGCTCCTCCACATCTTCA
XRCC1TGTGGATCTGCTCCTCCTTCTGCCGAAAATCTTCTCAAGG
XRCC2ATCAGCAAACAGGTTGGGTTGATGTGTAGCGACTTTCGCA
ERCC1TCCGTGACGATCTGAATAAGGCTGGGAAGGACGAGGAAAGT
Mre11aAAAGGCTGAGGTGGAGGTCTCCGAGAAAGCAGACAGAGAAA
PcnaTGGATAAAGAAGAGGAGGCGGGAGACAGTGGAGTGGCTTT
RPA1TCCAACGTCTTCAGCAGATTTGTCTGCCAGGTCCACAAGTT