Table 1 RT-PCR primer list for MEIS target and CDKI genes.

From: Development of Small Molecule MEIS Inhibitors that modulate HSC activity

GeneForward PrimerReverse Primer
GAPDHTTGATGGCAACAATCTCCACCGTCCCGTAGACAAAATGGT
Meis1GTTGTCCAAGCCATCACCTTATCCACTCGTTCAGGAGGAA
P15 (CDK2NB)CAGTTGGGTTCTGCTCCGTAGATCCCAACGCCCTGAAC
P16 (CDKN2A)GGGTTTCGCCCAACGCCCCGATGCAGCACCACCAGCGTGTCC
P18 (CDK2NC)CTCCGGATTTCCAAGTTTCAGGGGGACCTAGAGCAACTTAC
P19 (CDKN2D)-TCAGGAGCTCCAAAGCAACTTTCTTCATCGGGAGCTGGT
P19-ARFGTTTTCTTGGTGAAGTTCGTGCTCATCACCTGGTCCAGGATTC
P21 (CDKN1A)ATCACCAGGATTGGACATGGCGGTGTCAGAGTCTAGGGGA
P27 (CDKN1B)GGGGAACCGTCTGAAACATTAGTGTCCAGGGATGAGGAAG
P57 (CDKN1C)TTCTCCTGCGCAGTTCTCTTCTGAAGGACCAGCCTCTCTC
Hif-1αCGGCGAGAACGAGAAGAAAAACTTCAGACTCTTTGCTTCG
Hif-2α (EPAS1)ATCACGGGATTTCTCCTTCCGGTTAAGGAACCCAGGTGCT
Hif-3αTGTGAACTTCATGTCCAGGCGCAATGCCTGGTGCTTATCT