Table 1 Primers used for amplifying and Sanger sequencing exonic and flanking regions of canine NAGLU gene and for genotyping the causative insertion and wild-type alleles in Schipperkes.

From: An exonic insertion in the NAGLU gene causing Mucopolysaccharidosis IIIB in Schipperke dogs

Exon #Exon length (bp)Forward PrimerReverse PrimerAmplicon Length (bp)Annealing Temperature (°C)
1424ATGTGAAAGCTCTCCAGGTACACGATGTCACCGTTTCCATTCTTC92566
2148GTGAGTCCTGGAGTGAAACAGTTAGCGTTTCTAGTGAGGTGCTG48565
3–4147 (Exon 3)
86 (Exon 4)
TTGCAACAAAGCTGACCCATTAGGCTGCCATTTGCTAAGACTGTG79867
5257CACTGCTCCATCTAGGACTCTGAGTGCTTGGTCAACTGTCAAGG68267
6a1450GACAACACTGCCCTAGAGATCCCCTCGCCTCCACATAGTACAAG95367
6bATGGTTACCACTGTCTGGTACAAAACGTATTGGGAGAGGATTCCC104365
Genotyping GCATTCCCTTCCAACAGCACCAGTGCCCACAAGGAGCCAGCCACCAAT16968
  1. Primer pairs 6a and 6b were designed to amplify and sequence exon 6 to make it across this relatively long exon.