Table 1 Primers used in the study for Sanger sequencing and RT-PCR.

From: A dog oviduct-on-a-chip model of serous tubal intraepithelial carcinoma

Gene nameGene ID*Primer sequence
Tumor protein p53 (TP53)403869F5′CCAGAGAGCGTCGTGAACTG–3′
R5′CTTGGCCAAATTTCCTT–3′
Myc proto-oncogene (Myc)403924F5′–AAAAGGTCCGAATCGGGGTC–3′
R5′ATCTGATCACGCAGGGCAAA–3′
Phosphatase and tensin homolog (PTEN)403832F5′–CCAATTCAGGACCCACACGA–3′
R5′CTAGCCTCCGGGTTTGATGG–3′
RB transcriptional corepressor 1 (RB1)476915F5′–AGGCAGCAACCCTCCTAAAC–3′
R5′TCCGGGACCCTCATTTCTCT–3′
Paired box 8 (PAX8)403927F5′–ACAAACGGCAGAACCCTACC–3′
R5′GTCGTTGTCACAGACACCCT–3′
Marker of proliferation KI-67 (Ki67)100686578F5′–GGTCGTCTGAAACCGGAGTT–3′
R5′GAGCTGGAGATCCCTTACGC–3′
GAPDH403755F5′–GTAGTGAAGCAGGCATCGGA–3′
R5′–GTCGAAGGTGGAAGAGTGGG–3′
BRCA1403437F5′–AGGAAAGCGCGGGAATTACA–3′
R5′–GCCCTCACTCAAGAAAGCCT–3′
BRCA2474180F5′–GTCAGCTTTCTGGCCGAAGT–3′
R5′AATCTGCTTGATTGCACCGC–3′
  1. *from Canis lupus familiaris.