Table 1 Details of the sex-chromosome specific-markers used.

From: Sex determination using circulating cell-free fetal DNA in small volume of maternal plasma in elephants

Marker Primer sequences 5′-3′ (fw/rev) 5′dye Anneal T (°C) Primers (μM) Size (bp) GenBank Acc. No.
AmelY TTCCAGGCAAGGCTAGAACA 6-Fam 47 1 75 MK645854
ACAACTCAGGGAGGTTTTACG MK645855
SRY AGCAAGCTGCTGGGATACCAGTG 6-Fam 53 0.5 85 MK645856
TATAGTCCGGGTTCTGCGCCTCC MK645857
PlpX CTAGCACTGGGTTTGGTTTG 6-Fam 50 0.5 147 MK654898
CCATATCTGCCTCCCTAGAC MK654899