Table 1 Primers for initial amplification of 16S rRNA, 18S rRNA, and ITS rDNA regions.

From: Metabarcoding assessment of prokaryotic and eukaryotic taxa in sediments from Stellwagen Bank National Marine Sanctuary

Target Primer Sequence (forward and reverse, respectively) References
Bacteria & Archaea (16S) V4_515F: 5′–GTGYCAGCMGCCGCGGTAA–3′
V4_806R-B: 5′–GGACTACNVGGGTWTCTAAT–3′
Parada et al.65
Apprill et al.66
Fungi (ITS) ITS_86F: 5′–GTGAATCATCGAATCTTTGAA–3′
ITS_4R: 5′–TCCTCCGCTTATTGATATGC–3′
Op De Beeck et al.67
Eukaryotes (18S) SSU_FO4: 5′–GCTTGTCTCAAAGATTAAGCC–3′
SSU_R22: 5′–GCCTGCTGCTGCCTTCCTTGGA–3′
Blaxter et al.68