Table 3 Sequence of guide RNA for targeting SHH gene.

From: Influence of SHH/GLI1 axis on EMT mediated migration and invasion of breast cancer cells

S.no. Name Forward Oligo Reverse Oligo
1. KO1 5′CACCG ATACCTTCCGCTGGCGCCTA3′ 5′AAAC TAGGCGCCAGCGGAAGGTATC3′
2. KO2 5′CACCG TAGGGTCTTCTCGGCCACAT3′ 5′AAAC ATGTGGCCGAGAAGACCCTAC3′