Table 1 Primers used in qPCR.

From: Collagen XXV promotes myoblast fusion during myogenic differentiation and muscle formation

  Sequence (5′-3′) Forward primer Sequence (5′-3′) Reverse primer
26S AGGAGAAACAACGGTCGTGCCAAAA GCGCAAGCAGGTCTGAATCGTG
miR-208 ATAAGACGAACAAAAGGTTTGT  
miR-499 TTAAGACTTGCAGTGATGTTT  
Col25a1 GAAAGTGGAGCGTCTCTTGG TGACCAGGAGGACCAGATTC
Myf5 AGGAAAAGAAGCCCTGAAGC GCAAAAAGAACAGGCAGAGG
MyoD GGCTCTCTCTGCTCCTTTGA AGTAGGGAAGTGTGCGTGCT
myogenin TGACCCTACAGACGCCCACAATC CACACCCAGCCTGACAGACAATC
Myh3 GCAAAGACCCGTGACTTCACCTCTAG GCATGTGGAAAAGTGATACGTGG
Myh7 AGGGCGACCTCAACGAGAT CAGCAGACTCTGGAGGCTCTT
Myh7b CACCTTTGTGGACAGCAGAA TAGAAGCCCAGCCTTGAAGA