Table 1 Trichophyton interdigitale candidate reference genes used for qRT-PCR.

From: Reference genes for accurate evaluation of expression levels in Trichophyton interdigitale grown under different carbon sources, pH levels and phosphate levels

Gene symbol/accession no. Gene name Primers (5′-3′) forward reverse Length (bp) Tm (°C) Ct range Efficiency (%) R2
adp-rf (H101_06992) ADP ribosylation factor ATGCGAATTCTTATGGTCGG GTTGAATCCGATGGTGGG 105 60.5 18.12–21.89 100 0.9927
β-act (H101_06992) β-actin TGTTTTCCCATCCATTGTCG CATCACCAACATAGGAGTCC 117 60.5 15.20–19.80 104 0.99980
ef1-α (H101_03672) elongation factor 1-alpha GAGAAGTTCGAGAAGGAAGC GACGGTGACATTGTACTTGG 150 60.5 15.95–19.95 98 0.99924
gapdh (H101_04054) glyceraldehyde 3-phosphate dehydrogenase GAAGCCAGTCACCTACGA TGTATCCGAGAATACCCTTGA 80 60.5 16.56–22.64 107 0.99677
psm1 (H101_01238) mitotic cohesion complex 2 CGAGCTCTTCAATTTCAAGTC AAATGGGACGACTTGATTCC 150 60.5 18.80–22.45 101 0.99959
sdha (H101_02447) succinate dehydrogenase complex flavoprotein subunit A GAGGCTGGATTCAACACC TTGTGCATGTTTCCAAGAGC 104 60.5 16.01–19.99 108 0.99882
rpl2 (H101_0787) subunit Psm1 ribosomal protein L GTGGATCTATCTTCACGGC ACAATCTTCTTCACGACACC 112 60.5 19.70–22.84 109 0.99901
ubc (H101_00343) ubiquitin C TGTCATGACTTGGAATGCTG TCCTCAAAATGCATCACGAG 87 60.5 22.78–26.32 103 0.99895