Table 1 Nucleotide sequences of the primers used for Q-rtPCR analysis.

From: The pro-angiogenic role of hypoxia inducible factor stabilizer FG-4592 and its application in an in vivo tissue engineering chamber model

Gene Primer sequence
H-ACTIN-S CACCCAGCACAATGAAGATCAAGAT
H-ACTIN-A CCAGTTTTTAAATCCTGAGTCAAGC
H-HIF1α-S TGATTGCATCTCCATCTCCTACC
H-HIF1α-A GACTCAAAGCGACAGATAACACG
H-VEGF-S GGAGGGCAGAATCATCACGA
H-VEGF-A GCTCATCTCTCCTATGTGCTGG
M-Tnf-F GGCCAACGGCATGGATCT
M-Tnf-R GGCAGCCTTGTCCCTTGAA
M-Il1b-F ATGGGCTGGACTGTTTCTAATG
M-Il1b-R CTTGTGACCCTGAGCGACC
M-GAPDH-F GACAAAATGGTGAAGGTCGGT
M-GAPDH-R GAGGTCAATGAAGGGGTCG