Table 1 Primers used for dsRNA synthesis and for qRT-PCR.

From: RNA interference-mediated knockdown of voltage-gated sodium channel (MpNav) gene causes mortality in peach-potato aphid, Myzus persicae

Primers Primer sequence
dsRNA synthesis
dsMpNav –F GGATCCTAATACGACTCACTATAGGA CGACGACTCGAACGCTGTGA
dsMpNav -R GGATCCTAATACGACTCACTATAGGA CCCGCACTCGTCCACTTGTT
dsGFP-F GGATCCTAATACGACTCACTATAGGA AGAGTGCCATGCCCGAAGGT
dsGFP-R GGATCCTAATACGACTCACTATAGGA AAGGACAGGGCCATCGCCAA
qRT-PCR
MpNav –F AAGCAATCCGAGCGAAACTC
MpNav –R CCATCCCGTCACCAATTGTC
Actin-F GGTGTCTCACACACAGTGCC
Actin-R CGGCGGTGGTGGTGAAGCTG