Table 2 Primers used for real-time-PCR.

From: Vibrio cholerae autoinducer-1 enhances the virulence of enteropathogenic Escherichia coli

Gene Primer name Primer sequence Reference
rpoA qPCR_rpoA_F qPCR_rpoA_R GGCGCTCATCTTCTTCCGAAT CGCGGTCGTGGTTATGTG Modified based on ref.63
espB EPEC qPCR_EspB_F qPCR_EspB_R GGCTCTTTTGCTGCCATTAATAGC TCTGCTGCATCTGCAATACC This study
espA EPEC qPCR_EspA_F qPCR_EspA_R GTGCGAATGCGAGTACTTCGAC TTGCAGCCTGAAAAACACCGAGT This study
tir EPEC qPCR_Tir_F qPCR_Tir_R GGACCCTCTGCATTTCGTGTTG GTCCCCCGGTAAAAACAAATCTG This study
escJ EPEC qPCR_EscJ_F qPCR_EscJ_R GCAAGCACTGTTGCTATCCA GCTGGGTGGGAAAATAACCT This study
espB EHEC qPCR_EspBH_F qPCR_EspBH_R GCTTCGGAGAGTACGACCG CGGCCTGCTGAATCTGATAGC This study
espA EHEC qPCR_EspAH_F qPCR_EspAH_R CCACGGCACAAAAGATGGC CCGCCTTCACTGTTTGCAG This study
tir EHEC qPCR_TirH_F qPCR_TirH_R CGCCTGTAAGGAATTCTATGGC GCCTGTTAAGAGTATCGAGCGG This study
sipB qPCR_SipB_F qPCR_SipB_R GGAACAAAGTCCGGCGAGAG TGAGACAGCGAAACATCGCC 64
sipC qPCR_SipC_F qPCR_SipC_R AAACCCAGTTACGCGAGCAG TGCCGTCGTTTTAGCTGCAT 64
avrA qPCR_AvrA_F qPCR_AvrA_R TGTTGAGCGTCTGGAAAGTG CAGATTCAACGCCTTCCATT 65