Table 1 Summary of tRF-5 series with a relative cloning frequency >0.02‰ (reads per mil) in arsenite-treated samples.

From: A tRNA-derived RNA Fragment Plays an Important Role in the Mechanism of Arsenite -induced Cellular Responses

Sequence Origin Relative sequencing frequency (‰ of total sequencing reads)
Untreated Arsenite
GGGGGTATAGCTCAGCGGTAGAGCGCGTGCT AlaTGC 0.13 0.46
GGGGATGTAGCTCAGTGGTAGAGCGCGCTTC AlaCGC 1.31 7.01
GGGGGTGTAGCTCAGTGGTAGAGCGCGTGCT AlaAGC 1.00 5.25
GGCTCTGGCGCAATGGATAGCGCATTGGACT ArgAGA 0.10 11.66
GGGCCAGTGGCGCAATGGATAACGCGTCTGA ArgACG 0.08 0.83
GACCGCGTGGCCTAATGGATAAGGCGTCTGA ArgCGG 0.04 6.86
GGCTCCGTGGCGCAATGGATAGCGCATTGGA ArgTCT 0.28 13.46
GGTCCCATGGTGTAATGGTTAGCACTCTGGA GlnCAA 0.02 1.59
GGTTCCATGGTGTAATGGTTAGCACTCTGGA GlnCAG 0.07 49.50
GGTTCCATGGTGTAATGGTAAGCACTCTGGA GlnCTG 0.06 2.84
GGCCCCATGGTGTAATGGTTAGCACTCTGGA GlnTTG 0.01 0.72
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCT GluCTC-S 0.01 52.90
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCAATAATTCTCGGCTGC GluCTC-L 0.00 33.90
GCATGTGGTTCAGTGGTAGAATTCTCGCCTA GlyGCC 11.31 23.64
GGTAGCGTGGCCGAGCGGTCTAAGGCGCTGG LeuAAG 1.322 2.95
AGCAGAGTGGCGCAGCGGAAGCGTGCTGGGC MetCAT-1 6.494 79.38
AGCAGTGGCGCAGCGGAAGCGTGCTGGGCCC MetCAT-2 0.13 0.83
GGCTCGTTGGTCTAGGGGTATGATTCTCGCT ProTGG 2.01 9.01
GGCTTGGTCTAGGGGTATGATTCTCGCTTCA ProCGG 0.07 8.96
GCTGTGATGGCCGAGTGGTTAAGGCATTGGA SerCGA 0.03 0.06
GGCCTCGTGGCGCAACGGTAGCGCGTCTGAC TrpTGG 0.08 1.28
GACCTCGTGGCGCAACGGTAGCGCGTCTGAC TrpCCA 0.03 4.42
GGCTCCATAGCTCAGGGGTTAGAGCACTGGT ThrTGT 0.23 1.28
  1. The relative cloning frequency of a tRF was calculated by dividing its read number by the total read number of each experimental group. tRFs were sorted by an alphabetical order of parental tRNA isoforms. For tRNA isoforms sharing the same anticodon, they were sequentially numbered according to the abundance of tRF-5s in the arsenite-treated sample.