Table 5 Target- mRNA sequences obtained from the NCBI database.

From: The effect of Ganoderma lucidum extract on immunological function and identify its anti-tumor immunostimulatory activity based on the biological network

Gene name Forward primer(5′- 3′) Reverse primer(5′- 3′)
mus-Cd3g ACTGTAGCCCAGACAAATAAAGC TGCCCAGATTCCATGTGTTTT
mus-Ptpn22 CGACAAACCAGCATAGCAAA GGACACGACCCAAACAACAT
mus-Prkg2 AAGGACGCGGAACTTCAGG GAGGCACTTTGTCGGGAGAG
mus-Map3k8 ATGGAGTACATGAGCACTGGA GGCTCTTCACTTGCATAAAGGTT
mus-Ngfr TGCCGATGCTCCTATGGCTA CTGGGCACTCTTCACACACTG
mus-Gnas GTCATCTGCACCTTTGCACTT GGCTGCCTAAGAGTTAGCGTC
mus-Actb GGCTCCTAGCACCATGAAGA AGCTCAGTAACAGTCCGCC