Table 1 The primers used in the LAMP assay.

From: A Gustatory Receptor Used for Rapid Detection of Tyrophagus putrescentiae in Fungi Hosts

Primer name Sequence (5′-3′) Num.
F3-Gr09 TGGGCAGCAAGAACAACG 18
B3-Gr09 TGGAGGAAGACGGTCCAG 18
FIP-Gr09 GCTGTTCGACTCGTCCACCAGCCTCTCGACGCTCTACTACG 42
BIP-Gr09 GTGTCACATTCCCTGCAACTGCGGTCATCAAAGTCGGCGAAG 43