Abstract
The ATP-binding cassette transporter 6 (ABCC6) gene encodes a cellular transmembrane protein transporter (MRP6) that is involved in the regulation of tissue calcification in mammals. Mutations in ABCC6 are associated with human ectopic calcification disorders. To gain insight into its evolution and involvement in tissue calcification we conducted a comparative analysis of the ABCC6 gene and the related gene ABCC1 from invertebrates to vertebrates where a bony endoskeleton first evolved. Taking into consideration the role of ABCC6 in ectopic calcification of human skin we analysed the involvement of both genes in the regeneration of scales, mineralized structures that develop in fish skin. The ABCC6 gene was only found in bony vertebrate genomes and was absent from Elasmobranchs, Agnatha and from invertebrates. In teleost fish the abcc6 gene duplicated but the two genes persisted only in some teleost genomes. Six disease causing amino acid mutations in human MRP6 are a normal feature of abcc6 in fish, suggesting they do not have a deleterious effect on the protein. After scale removal the abcc6 (5 and 10 days) and abcc1 (10 days) gene expression was up-regulated relative to the intact control skin and this coincided with a time of intense scale mineralization.
Similar content being viewed by others
Introduction
The ATP-Binding Cassette (ABC) transporters are a large and ancient family of active transporter proteins present in a broad spectrum of organisms from bacteria to vertebrates1,2. These transporters promote the translocation across the cell membrane and organelle compartments of various substrates, from ions and small molecules to large polymers3. ABC mediated transport is suggested to occur via ATP hydrolysis4,5, although the exact mechanism still remains poorly understood6,7,8,9,10. The ABC transporters are characterized by four core domains, two transmembrane domains (TMD) and two highly conserved nucleotide binding domains (NBD), that are part of its functional complex. Half transporters with a single TMD and single NBD also exist and are functional if they assemble as homodimers or heterodimers1,11. The NBDs, are the motor domains of ABC transporters and contain a phosphate binding loop (Walker A), a magnesium binding site (Walker B), a switch region with a histidine loop, a Q-motif and a conserved signature motif (LSGGQ)12,13. In human an estimated 49 ABC members exist and they are divided into seven subgroups (ABCA to ABCG), and some are responsible for, or are involved in human diseases and cancer treatment resistance, as they cause extrusion of anticancer drugs from tumor cells14,15.
The ABC subfamily C (ABCC) members are large proteins (1325–1582 amino acids in length) encoded by 13 genes. Nine genes (ABCC 1–6 and 10–12) encode multidrug resistance-associated proteins (MRP), three genes (ABCC 7–9) encode ion channel proteins or regulators of potassium channels and one pseudogene (ABCC13)2,16,17]. Evolutionary analysis reveals that with the exception of the pseudogene, two major ABCC subfamily clusters exist in humans: one that contains ABCC1, 2, 3, 6, 8 and 9 and another with ABCC 4, 5, 7, 10, 11 and 122.
The ABCC6 gene encodes the multidrug resistance protein 6 (MRP6), which arose in genomes by tandem gene duplication, a process that also produced the ABCC1 (MRP1) gene11, which in humans prevents soft tissue calcification18. Calcification is an essential physiological mechanism in the process of skeletal tissue formation, which is tightly controlled and restricted to specific body regions. Although the calcification process is incompletely understood, inhibitors and promoters are thought to act synergistically to maintain calcification of bone and dental tissue19. Calcification disorders occur when calcium is abnormally deposited in soft tissues causing ectopic calcification20. Biallelic inactivating mutations of the ABCC6 gene lead in most cases to Pseudoxanthoma elasticum (PXE; OMIM#264800), a rare autosomal recessive genetic disorder characterized by aberrant mineralization of soft connective tissue (eyes, cardiovascular system and skin)21,22,23,24. ABCC6 mutations are also linked to some cases of Generalized Arterial Calcification of Infancy (GACI; OMIM #614473)25, a calcification disorder that affects the circulatory system26 and is associated with mutations of the Ectonucleotide Pyrophosphatase/Phosphodiesterase 1 (ENPP1) gene27. Manifestations of PXE are associated with modified plasma inorganic pyrophosphate (PPi) levels and it has been suggested that PPi may be the factor that prevents mineralization in PXE patients, since it is a key regulator of ectopic mineralization inhibiting hydroxyapatite crystal growth28,29,30,31. Nonetheless, the precise function of ABCC6 in the calcification process and pathologies is still controversial and may involve other disease mediators32.
Homologues of the human ABCC6 gene also occur in other vertebrates but their role in tissue calcification remains poorly understood. In recent years, research on ABC transporters in fish has advanced, facilitated by the sequencing of fish genomes33,34. Teleost fish are the largest and most successful group of extant vertebrates and they are used as models to study bone mineralization, as they share with other vertebrates many of the basic features of cartilage (chondrogenesis) and bone (osteogenesis) formation35–42]. So far, zebrafish is the only teleost fish in which the abcc6 gene has been studied and associated with tissue mineralization38,39. In zebrafish, two abcc6 genes were identified and zebrafish abcc6a mutants develop ectopic calcification generally around the perichondral bone in the craniofacial and axial skeleton39. In contrast to humans where the ABCC6 gene is mostly detected in the liver, in zebrafish expression of abcc6a was strongly linked with tissues actively involved in mineralization suggesting that in fish abcc6a functions locally and that ligand transport is not liver derived39. Furthermore, enpp1 mutants exhibited ectopic calcification in soft tissues, including the skin, cartilage elements, heart, intracranial space and notochord sheet35.
The ABCC6 gene is located on human chromosome 16 between its two almost identical pseudogenes, ABCC6P1 and ABCC6P2 which arose by segmental duplications in primate genomes and are proposed to regulate expression of the functional gene43,44,45. In mammals, ABCC6 is highly abundant in the basolateral membrane of hepatocytes and to a lesser extent in the proximal kidney tubules46,47. Very low to undetectable levels of ABCC6 expression occur in brain, retina, vessel walls and the skin (a tissue affected by PXE)21,46,48,49. In order to better understand the potential association of abcc6 genes with vertebrate calcification and tissue mineralization we characterized the evolution of the orthologue of the human ABCC6 gene in other vertebrates and in invertebrates and the expression of its transcripts during scale regeneration in fish. The involvement of abcc6 in scale formation/regeneration, a common mineralization process in fish, has never been addressed. Scales are important skin appendages imbricated in the dermis and are a reservoir of minerals, provide protection and assist hydrodynamics. When scales are lost, they regenerate and the formation of a new scale and the scale pocket is initiated almost immediately after damage50. The potential involvement of abcc6 and the sequence related abcc1 in the process of scale regeneration was analyzed in the sea bream by measuring transcript abundance at several time points after damage was inflicted.
Material and Methods
Database searches and sequence retrieval
The genomes of several vertebrates and invertebrates (with publicly available data) were analyzed for orthologues of the human ABCC6 gene (ENSG00000091262) and the sequence related family members, ABCC1 (ENSG00000103222) and ABCC3 (ENSG00000108846). A total of 30 vertebrate genomes representatives of different classes (see Supplementary Table 1), were searched using the BLAST algorithm or database annotations for orthologues of the human ABCC6, ABCC1 and ABCC3 genes. The majority of the data accessed was deposited in the Ensembl database and the most recent assembly update was used (http://ensembl.org/, 2018). The genomes analyzed included 8 mammals (chimpanzee, Pan troglodytes; gorilla, Gorilla gorilla; mouse, Mus musculus; dog, Canis lupus familiaris; armadillo, Dasypus novemcinctus; cow, Bos taurus; opossum, Monodelphis domestica; platypus, Ornithorhynchus anatinus); a bird, the chicken (Gallus gallus); a reptile, the green anole lizard (Anolis carolinensis); an amphibian, Xenopus (Xenopus tropicalis); a lobe-finned fish, the coelacanth (Latimeria chalumnae); 9 teleosts (Actinopterigii) and 1 non-teleost ray finned fish, the spotted gar (Lepisosteus oculatus) and two agnathans (the sea lamprey, Petromyzon marinus and the arctic lamprey, Lethenteron camtschaticum, GCA_000466285.1, available from NCBI, 2018). The teleost genomes explored were: tilapia, Oreochromis niloticus; platyfish, Xiphophorus maculates; cod, Gadus morhua; stickleback, Gasterosteus aculeatus; medaka, Oryzias latipes; tetraodon, Tetraodon nigroviridis; blind cave fish, Astyanax mexicanus; zebrafish, Danio rerio, and the sea bass, Dicentrarchus labrax (http://seabass.mpipz.de/)51. The genomes of two cartilaginous fish which diverged prior to the emergence of bony vertebrates (Class Chondrichthyes), the elephant shark (Callorhinchus milii, http://esharkgenome.imcb.a-star.edu.sg/, 2018) and whale shark (Rhincodon typus, GCF_001642345.1, available from NCBI, 2018), were also explored as well as the transcriptomes of two other cartilaginous fishes, the small spotted catshark (Scyliorhinus canicula) and the little skate (Leucoraja erinácea), available from Skatebase (http://skatebase.org/, 2018). The short scaffolds of the little skate genome limited gene identification.
To trace the likely evolutionary origin of the ABCC6 gene, the genomes of several invertebrates were also analyzed by accessing the Ensembl Metazoa database (http://metazoa.ensembl.org/index.html, 2018). Invertebrate genomes analyzed (n = 12, Supplementary Table 2) included the deuterostomes basal to the vertebrates, the urochordate Ciona (Ciona intestinalis and Ciona savigny), the cephalochordate Amphioxus (Branchiostoma floridae) and the hemichordate, the Sea urchin (Strongylocentrotus purpuratus) and also several protostome genomes: the Owl limpet (Lottia gigantea), the Leech (Helobdella robusta), the Fruit fly (Drosophila melanogaster), the Honey bee (Apis mellifera), the Flour beetle (Tribolium castaneum), the Mosquito (Anopheles gambiae), the crustacean Daphnia (Daphnia pulex) and a roundworm, the Nematode (Caenorhabditis elegans). The amino acid sequences of putative candidate genes were retrieved by selecting those with the lowest e-value similarity score (e < −20) and their similarity to the query protein and putative identity was confirmed by searching against the NCBI human protein database (http://blast.ncbi.nlm.nih.gov/Blast.cgi, 2018), using the Blastp algorithm.
Multiple sequence alignment and phylogenetic analysis
The full-length human and vertebrate MRP6 deduced proteins were aligned using ClustalW and the amino acids that are normally changed by the principal nucleotide mutations responsible for the manifestation of PXE (http://www.hgmd.cf.ac.uk/; accessed May 2016) were mapped across different species. The deduced nucleotide sequence of the full-length human ABCC6 gene (ENSG00000091262) and the two pseudogenes ABCC6P1 (ENSG00000256340) and ABCC6P2 (ENSG00000255277) were also aligned to identify differences between the sequences. The GeneDoc 2.7 software was used to calculate the percentage of sequence identity/similarity between the homologue genes of the different species.
Phylogenic trees were constructed using the deduced amino acid sequence alignment of the retrieved ABCC6, ABCC1 and ABCC3 genes (see Supplementary Tables 1 and 2). The sequences of other human ABCC transporters: ABCC 2, 4, 5, 8, 9, 10, 11, 12 and CFTR were also included. Sequences were aligned in the AliView platform52 using MUSCLE53 and manually edited to remove sequence gaps and poorly aligned regions. The final edited alignment was used as the input for the construction of phylogenetic tree by: Bayesian inference (BI) in MrBayes54 and Maximum Likelihood (ML) implemented in PhyML 3.0 software (http://www.atgc-montpellier.fr/phyml/)55, using the SMS automatic model selection56, for protein evolutionary analysis according to the AIC (Akaike Information Criterion).
BI analysis was performed using an LG substitution model (Aamodel = LG) and 1.000.000 generation sampling and probability values to support tree branching. The ML tree was built with an LG+I+G+F substitution model with the following parameters: gamma shape- 4 rate categories (G=0.972) and proportion of invariable sites (I=0.035). The statistical support for tree branching was assessed using 100 bootstrap replicates. Both, BI and ML phylogenetic trees were displayed and annotated in the FigTree program and rooted with the protostome and other human ABCC branches.
Gene structure and gene synteny
The gene structure of human ABCC6 and its two pseudogenes (ABCC6P1 and ABCC6P2) and the spotted gar abcc6 gene were retrieved from ENSEMBL and compared. The gene environment of the vertebrate ABCC6 genes was characterized using as a template the human gene annotation in ENSEMBL (GRCh38, same assembly as in UCSC genome browser). Gene orthologues were identified in the mammals, gorilla (Gorilla gorilla), opossum (Monodelphis domestica) and platypus (Ornithorhynchus anatinus), in the bird, chicken (Gallus gallus), in the ray-finned fishes, spotted gar (Lepisosteus oculatus), zebrafish (Danio rerio), Tetraodon (Tetraodon nigroviridis), medaka (Oryzias latipes) and in two cartilaginous fishes, the elephant shark (Callorhinchus milii) and whale shark (Rhincodon typus) using genome annotations, complemented with sequence homology searches.
Transcriptome database searches
To increase knowledge about the physiological importance of the ABCC genes, searches on vertebrate transcriptome data were also performed. The distribution of non-mammalian ABCC6 transcripts was characterized using transcriptome and EST (Expressed sequence tag) databases for the human, bird, reptile, amphibian and teleosts and a digital expression map was developed to identify overlapping tissue expression of the ABCC6 gene. Searches were performed in the lineage-specific NCBI EST databases for human (taxid: 9606); birds (taxid: 8782); reptiles (taxid:8504); amphibians (taxid:8292) and teleost fishes (taxid:32443) using the human, chicken, anole lizard, Xenopus and zebrafish abcc6 sequences, respectively. The identity of the retrieved sequences was confirmed by homology with the human orthologues. Searches were also performed in other gene expression databases: Geisha (http://geisha.arizona.edu/geisha/), Xenbase (http://www.xenbase.org/entry/), Expression Atlas Database (https://www.ebi.ac.uk/gxa/home), GeneCards (http://www.genecards.org/), Ensembl (http://www.ensembl.org/index.html) and complemented with published data39. In addition, available sea bass scale and skin transcriptomes were also analysed for abcc6 and abcc1 transcripts57.
Polymerase chain reaction (PCR) and quantitative-PCR (qPCR)
We further explored the potential physiological role of abcc transcripts in fish skin during scale regeneration. Abcc1 and abcc6 genes were studied in the regenerating skin/scale of sea bream (Sparus aurata) over 28 days as previously described58,59. The experiments were carried out following international and national guidelines for animal care and experimentation, under a “Group-I” license from the Portuguese Government Central Veterinary service to CCMAR and conducted by a certified investigator (DMP).
Briefly, adult sea bream of the same age class (1 year), were maintained in 500 L replicate tanks (n = 8) in an open seawater circuit and supplied with a constant flow of aerated seawater at 18 °C + 1 °C. At time zero all fish in the 8 experimental tanks were anaesthetized in 2-phenoxyethanol (0.01%), rinsed in seawater and the scales were removed from the left flank of the body by gently stroking the skin with forceps to minimize damage to the dermis. Samples (N = 8/time point) of intact skin (untouched right hand flank) and damaged skin (left hand flank) were collected at 0, 5, 10 and 28 days after scale removal. At each sample point fish were removed from 2 tanks and killed with an overdose of 2-phenoxyethanol (0.1% in seawater) and then rinsed in clean seawater. The skin was then dissected from below the dorsal fin directly above the lateral line using a scalpel and forceps and removing the muscle before snap freezing the sample in liquid nitrogen. In this way, the same fish provided control and regenerating skin samples that were directly compared. No mortality or skin lesions occurred in any of the fish.
Specific primers for sea bream abcc6 (forward, Sb_abcc6fwd ttagagacaagacccgcat and reverse, Sb_abcc6rev tggcaaaggtgtggatgaag) and abcc1 (forward, Sb_abcc1fwd tatgagtcacctcaacaaagc and reverse, Sb_abcc1rev tccgttcatactggattacca) were designed using sequences retrieved from the CCMAR sea bream transcriptome database60. Preliminary analysis of tissue expression was established by PCR of abcc6 and abcc1 using sea bream cDNA from bone, skin, larva and scale. The thermocycle was as follows: 95 ºC, 3 min; (95 ºC 30 sec, 60 ºC 30 sec, 72 ºC 30 sec) cycled 40 times and a final extension at 72 ºC for 5 min. The amplified PCR products were sequenced to confirm their identity before testing gene expression during regeneration.
To investigate the potential involvement of abcc6 and abcc1 in sea bream skin regeneration a qPCR experiment was run using cDNA from both intact and damaged skin of 6 individuals for each time point. The qPCR was performed for a 10 μl final reaction volume, in duplicate, using 1× SsoFast-Evagreen Supermix (Biorad) and 300 nM of forward and reverse primers. The PCR reaction was performed using a CFX Connect™ Real-Time PCR Detection System (Bio-Rad) and the following program: 30s at 95 °C, 45 cycles of 5 s at 95 °C and 15 s at 60 °C. Negative controls were also run and included a no-template control (NTC). A final melt-curve was carried out between 60 °C and 95 °C and produced a single product dissociation curve for each gene. Relative expression of the analysed genes was compared using the delta Ct values normalized with the geometric mean of the reference genes rps18 (forward primer agggtgttggcagacgttac and reverse primer cttctgcctgttgaggaacc) and β-actin (forward primer ccctgccccacgccatcc and reverse primer tctcggctgtggtggtgaagg). The reference gene expression did not vary significantly between any of the samples. Results are presented as 1/delta Ct.
Statistical analysis
The relative expression data from qPCR was evaluated by two-way ANOVA with a Tukey’s multiple comparisons test using the software GraphPad Prism, version 7.0a for Mac OS X (GraphPad Software, La Jolla California USA, www.graphpad.com). The significance cut-off was set at p < 0.05 and results are presented as mean ± standard error of the mean (sem).
Results
ABCC6 members in vertebrates
Orthologues of the human ABCC6 gene were identified in all the teleost and tetrapod genomes analyzed (Fig. 1 and Supplementary Table 1). Searches in the genome of the elephant shark (Callorhinchus milii) and whale shark (Rhincodon typus) and in transcriptome data from two other cartilaginous fish species, the small spotted catshark (Scyliorhinus canicula) and Little skate (Leucoraja erinácea), failed to retrieve putative abcc6 genes or transcripts. In the Agnatha, sea lamprey (Petromyzon marinus) and arctic lamprey (Lethenteron camtschaticum) as previously reported, abcc6-like genes were absent61 (Fig. 1 and Supplementary Table 1). In some teleost species such as the stickleback (Gasterosteus aculeatus), blind cave fish (Astyanax mexicanus) and zebrafish (Danio rerio) more than one abcc6 gene was identified. In stickleback and blind cave fish two abcc6 genes (abcc6a and abcc6b) were found and in zebrafish three seem to exist (abcc6a, abcc6b1 and abcc6b2) (Fig. 1).
No putative abcc6-like pseudogenes were identified in the vertebrate genomes analysed with the exception of the primates. Searches in the chimpanzee (Pan troglodytes) and gorilla (Gorilla gorilla) identified orthologues of the human ABCC6 full-length gene as well as other genome regions which may encode putative ABCC6 pseudogenes. In the chimpanzee, ABCC6-like putative genome regions were found in Scaffold KV421237.1 (ENSPTRG00000048009) and Scaffold AACZ04003842.1 and in the gorilla genome a region up-stream (2.3 Mb) of the predicted ABCC6 gene (ENSGGOG00000009623) on chromosome 16 was also identified.
ABCC6-related family members, the ABCC1 and ABCC3 genes, were also retrieved from databases for evolutionary comparisons because, a) they are similar to ABCC6 and b) ABCC1 in the human genome is localized in close proximity to the ABCC6 locus. Orthologues of the human ABCC1 and ABCC3 genes were identified in almost all vertebrates with the exception of abcc1 in cod (Gadus morhua) (Fig. 1), probably because its genome assembly is incomplete. In sea lamprey a single abcc1-like and two abcc3-like transcripts (KM232930.1 and KM232931.1) have previously been described61, and the locus for the first transcript was found in the genome assembly (ENSPMAG00000000892) and the orthologues were also retrieved from the arctic lamprey genome (abcc1-like, KE994284.1 and two abcc3-like, KME993868.1 and KE993993.1). Searches in the urochordate, cephalochordate, hemichordate and protostome genomes were also carried out to characterize the origin of the abcc6, 1 and 3 gene family members and putative abcc-like genes were retrieved and many species seem to possess multiple copies (Fig. 1 and Supplementary Table 2).
Sequence conservation of the amino acids altered in PXE disease
Multiple sequence alignment of the deduced amino acid sequence of the MRP6 proteins revealed a relatively high conservation overall, and several highly-conserved regions were identified (Supplementary Fig. 1). Comparison of the deduced full-length MRP6 mature protein sequence from human with the orthologue in the chicken indicated that they shared 52% amino acid identity. The MRP6 proteins in human and the coelacanth were 48% identical and 42–47% identical with the protein orthologues in the ray-finned fishes, stickleback, sea bass, tetraodon, tilapia, medaka, platyfish, cod, zebrafish, blind cave fish and spotted gar (Supplementary Table 3).
One hundred and thirty-eight missense/nonsense mutations, associated exclusively with PXE disease only, were selected from the publicly available list of the Human Gene Mutation Database (HGMD) and the positions of the altered amino acids were mapped in the MRP6 sequence alignment and compared across different vertebrates (Supplementary Fig. 1). Mutations have been identified throughout the protein, however the “hot spots” associated with human PXE are located within the cytoplasmic region of human MRP6 and only one was found within a TM domain (TM12). Comparisons with the vertebrate homologue amino acid positions revealed that the positions mapped in the alignment where the human mutations occur are in general well conserved across other vertebrates. More than 50 amino acid positions are totally conserved (Supplementary Fig. 1), suggesting that they were under high conservative selection pressure during the vertebrate radiation.
Interestingly, in some species, especially within the fishes, there are positions in which the amino acids correspond to mutated amino acids in human MRP6. The amino acid positions, common between the fish and the mutated human MRP6 protein, map to the cytoplasmic region (415; 500; 881; 946; 1049 and 1268) and the transmembrane region (946) and are represented in Fig. 2. Comparisons of ABCC6 and ABCC1 revealed that the location of the ABCC6 point mutations linked with PXE are generally associated with amino acids that are highly conserved across the related family member, suggesting that they may be important in the maintenance of ABCC family function (Supplementary Fig. 1).
Phylogeny of ABCC6
Phylogenetic analysis was performed based on the alignment of the deduced vertebrate MRP6, MRP1 and MRP3 mature proteins and the putative orthologues in deuterostomes basal to vertebrates and protostomes. Both, BI (Fig. 3 and Supplementary Fig. 2) and ML (Supplementary Fig. 3) trees displayed similar topologies and showed that ABCC6 and the two other family members cluster in independent branches (with strong bootstrap support) and that they shared common ancestry prior to the vertebrate radiation (Fig. 3 and Supplementary Figs 2 and 3).
Both trees also suggest that the vertebrate ABCC3 members diverged earlier than the ABCC1 and ABCC6 genes that arose from a subsequent gene duplication event. Several gene duplications also occurred in invertebrates and also in some vertebrates, such as the teleosts. Based on the sequence clustering in the phylogenetic trees, the two abcc6 gene copies (abcc6a and abcc6b) in the stickleback, zebrafish and the blind cave fish seem to be the result of the teleost specific genome duplication and that the existence of a third abcc6 gene in the zebrafish may be the result of a duplication of the abcc6b paralogues (abcc6b1 and abcc6b2). The Xenopus abcc6 gene does not cluster as expected based on the consensus for species evolution, suggesting that abcc6 in this species suffered distinct selective pressures or that there may be errors in the genome assembly and predicted gene.
The clustering of sequences in the tree also confirmed that orthologues of the human ABCC6 genes are absent in cartilaginous fishes, but abcc1 and abcc3 genes are present. The position in the tree of the three lamprey sequences differed according to the method used and while in the BI tree they radiate basal to the vertebrate ABCC1/ABCC6 cluster. In the ML tree ABCC1/ABCC6 are basal to the three major clades (Fig. 3, Supplementary Fig. 3) and so gene identity based upon phylogeny remains unclear. The invertebrate branch contained several abcc-like genes that do not group with any of the three vertebrate ABCC clusters. Inclusion in the phylogenetic tree of the other human ABCC transporters suggested that the identified urochordate, cephalochordate and hemichordate sequences shared common ancestry with vertebrate ABCC1, 3 and 6 genes (Fig. 3, Supplementary Figs 2 and 3).
Gene structure
The gene structure of the human ABCC6 genes (including the two pseudogenes ABCC6P1 and ABCC6P2) was compared with the fish, spotted gar abcc6 gene. In human, the full ABCC6 gene structure is composed of 31 exons and spans 74.56 kb in chromosome 16. The two pseudogenes are much smaller and map in close proximity to the full-length ABCC6 gene. ABCC6P1 is composed of 11 exons and ABCC6P2 of 5 exons which span 27.14 Kb and 3.88 Kb, respectively (Fig. 4). Sequence alignment of the nucleotide sequences of human ABCC6 and its pseudogenes revealed that they are highly identical and that the pseudogenes share ≈95% similarity with the functional gene (data not shown). An extra exon (E2’), present in the two pseudogenes, is not transcribed in the full-length ABCC6 gene transcript (Fig. 4, Supplementary Table 4). Comparisons of the transcript sequences between the ABCC6 gene and ABCC6P1 revealed that exons E1 to E10 in ABCC6 are identical to ABCC6P1 and only exon E11 in ABCC6P1 shows no homology with the ABCC6 gene. For ABCC6P2 the overlapping exons are identical. Comparison of the predicted gene structure of the human and spotted gar (a slowly evolving fish genome, that has not suffered tetraploidization, 3R) revealed that they share the same exon number, possess an identical gene structure and share the same protein motifs with the human ABCC6 gene (Fig. 4, Supplementary Table 4). Overall, this suggests that pressure was maintained to preserve gene structure during evolution.
Gene linkage across vertebrates
The gene environment of the human ABCC6 genes and pseudogenes was characterized and compared with other vertebrates to better understand gene family evolution and origin during the vertebrate radiation (Fig. 5). At least 18 conserved genes flank the vertebrate ABCC6 gene suggesting that evolution of this chromosome segment in vertebrates was under conservative pressure, however in primate genomes gene insertions occurred. In human, both ABCC6 genes and pseudogenes are on chromosome 16 and the arrangement of the neighbouring genes suggest that the two pseudogenes originated from a local genome segmental duplication (and gene inversion for ABCC6P1) which also involved the duplication of members of other gene families (NOMO and NPIPA). Similarly, in the genome of the gorilla a homologue genome region to the human ABCC6P1 was found but ABCC6P2 was absent (Fig. 5).
No genome regions homologous to that containing the primate pseudogenes or orthologues of the NPIPA genes, which duplicated with the ABCC6 gene, were found in other vertebrates. A single copy of the NOMO gene, which is triplicated in the human genome (NOMO 1, 2 and 3), was found in most of the other species analysed, and the gene mapped next to the ABCC6 gene. Mapping of both ABCC6 and ABCC1 genes across the vertebrates suggests that both genes were the result of a tandem gene duplication followed by gene inversion and that this event occurred early in vertebrate evolution. A similar gene organization was generally found across all the species in which both genes were identified except in some teleosts where they map to different chromosomes (Fig. 5). In zebrafish, tetraodon and medaka, the conserved gene environment flanking abcc6 was shared between two genome regions as the result of the teleost specific genome duplication and the resulting gene copies were subsequently deleted and only a few persisted.
Analysis of the cartilaginous fish genomes showed that the gene environment was conserved and similar to the other vertebrates, and that the absence of an orthologue of the human ABCC6 gene was most likely a consequence of a single gene deletion. In the current lamprey genome assemblies, it was not possible to identify a homologue abcc6 gene environment due to the short size of the genome fragments identified.
Expression analysis in non-mammals
The tissue distribution of ABCC6, ABCC1 and ABCC3 transcripts in non-mammalian vertebrates (Supplementary Table 5) revealed they were present in tissues important for calcium homeostasis. In the chicken, ABCC6 was expressed in the epiphyseal growth plate but also in the kidney, an organ, with an important role in calcium balance in vertebrates. In reptiles, an EST was found in the kidney and in teleost fish abcc6 transcripts were found in the craniofacial bone elements, fins and the intervertebral discs. ABCC1 and ABCC3 had a wider tissue distribution than ABCC6 (Supplementary Table 5).
Expression of abcc6 and abcc1 during sea bream scale formation
Both transcripts for abcc6 and abcc1 were expressed in sea bream skin during the 28-day scale regeneration study. By the end of 28-days the scales in the damaged flank were similar to the undamaged scales in the other flank as has previously been reported58,59. Gene transcript abundance of the abcc1 gene in intact and regenerating skin was generally similar during the 28-day regeneration experiment. The exception was at day 10 after scale removal when abcc1 gene transcripts were significantly up-regulated (p = 0.0055) in the regenerating skin relative to intact skin (Fig. 6).
In the case of the abcc6 gene transcripts a significant up-regulation occurred in skin at day 5 (p = 0.0004) and 10 (p = 0.0002) after scale removal relative to intact skin at the corresponding time points. The timing of the change in expression of the abcc1 and abcc6 transcripts was co-incident with the period at which the individual scale area increased and the mineralized layers were deposited in the scale (day 10–28, not shown). The results indicate that abcc1 and abcc6 genes are involved in skin regeneration and scale formation in teleosts.
Discussion
In the present study, the evolution of the vertebrate ABCC6 gene was studied and its potential involvement in fish skin/scale regeneration was investigated. Orthologues of the human ABCC6 gene were explored in several vertebrate genomes and phylogenetic analysis revealed that human and other vertebrate ABCC6 genes shared common ancestry and emerged early in the course of the vertebrate radiation. The abcc6 gene was only found in bony vertebrate genomes and evidence suggests that this gene was deleted from cartilaginous fish, as no putative abcc6 genes or transcripts were found. A teleost specific duplication of the abcc6 gene occurred but the gene duplicates only persisted in the genomes of some species, suggesting that lineage or species-specific gene deletion occurred during their radiation. In the mapping of the human PXE mutations six amino acid positions were common between the fish and the mutated human MRP6 protein, and were located in cytoplasmic and transmembrane regions. This may indicate that the amino acids that cause the disease in humans, are not pathological in fish and this may be linked to differences in function but also the differing structure and physiology of bone. Expression analysis of the abcc1 and 6 genes during the regeneration of damaged skin caused by scale removal revealed that these genes appear to be involved in the later stages of regeneration when intense scale growth and mineralization occur58. Our results provide evidence that abcc6 gene persistence paralleled the acquisition of a bony skeleton and with the existing literature in mammals62,63, highlights its potential importance in the regulation of cellular calcium levels. However, the exact functional role of the abcc gene family in teleost skin, that has calcified scales imbricated in the dermis, remains to be determined.
Orthologues of the human ABCC6 gene persisted in the genomes of different vertebrates which is consistent with the hypothesis of conserved function34. This is further supported by the high sequence and gene structure similarities between the non-mammalian and human ABCC6 genes. In tetrapods and in the majority of teleosts and also in other fish, the coelacanth and spotted gar, a single abcc6 gene was found. However, in the stickleback and blind cave fish two paralogue genes persisted and in the zebrafish genome three were identified. During the vertebrate radiation, duplication and deletion events have shaped genome content64. Genome tetraploidization occurred early during the emergence of vertebrates and prior to the divergence of the jawless fish65,66. In the teleosts, a subsequent genome duplication event occurred and is considered to explain the presence of gene duplicates in teleost genomes relative to tetrapods67. However, only some duplicates persisted in teleosts potentially due to functional redundancy68. The reason why duplicated abcc6 genes persisted in stickleback, blind cave fish and zebrafish and are absent from the genomes of other teleosts is unknown, and it remains to be established if the duplicate gene copies are functional. The use of morpholinos to knockdown abcc6a, but not abcc6b, caused a visible phenotype with pericardial edema and a curled tail and was associated with death in zebrafish, suggesting that abcc6a is essential for normal zebrafish development38. This is further supported by the identification in zebrafish of a mutation in the abcc6a gene that causes hypermineralisation of the skeleton39. In zebrafish, the existence of three gene copies for abcc6 is intriguing as this is the only teleost with a sequenced genome in which this occurs. Mapping of the duplicated abcc6b genes in the zebrafish genome revealed that they share the same chromosome position and thus are likely to be the result of a genome misassembly. This is also suggested by the absence of zebrafish transcripts for abcc6b in public databases and thus the existence of abcc6b paralogue transcripts remains to be confirmed. Lineage-specific gene duplications frequently occur in ABC transporter genes in teleosts34 and further studies are needed to elucidate their functional significance.
Our phylogenetic evolutionary analysis revealed that ABCC1 and ABCC6 shared a common ancestral origin with the ABCC3 members. The tree topology obtained in our study contradicts the phylogenetic analysis recently published about the lamprey ABCC system61, in which the vertebrate ABCC6 cluster radiates basal to ABCC1, ABCC3 and ABCC2. The extensive genome analysis performed in our study revealed that, 1) the vertebrate ABCC6, ABCC1 and ABCC3 genes shared common ancestry prior to the vertebrate radiation as putative abcc1/3/6-like genes were found in the genomes of deuterostomes basal to vertebrates and that, 2) the vertebrate gene family members arose from the two rounds of genome doublings that occurred early in the vertebrate radiation65,66. This originated ABCC3 and the ABCC1/6 genes that subsequently duplicated to give rise to ABCC1 and ABCC6. In lampreys, putative abcc1/3/6-like genes exist and our analysis was unable to assign a specific identity to the cyclostome genes (which were previously named, abcc1, abcc3a and abcc3b)61. Orthology assignment between lamprey and gnathostome genes are difficult to establish as lamprey genomes are GC-rich in the exon coding domains relative to other vertebrates and this induces protein-codon usage bias and sequence convergence of coding sequences69,70. To further explore the emergence of ABCC1, 3 and 6 and ABCC2 members we extended our phylogenetic analysis to include the orthologues of human ABCC2 from other vertebrates and the resulting tree (Supplementary Fig. 4) confirmed the topology of the other trees and indicates that ABCC2 members i) diverged prior to the chordate ABCC 1/3/6 clade and ii) share a common origin with the vertebrate ABCC13 family.
In human, two ABCC6 pseudogenes have been described43,44. The complete and partial genes are highly similar in sequence but the pseudogenes are much shorter than the coding gene. Orthologues of the human pseudogenes were also predicted to exist in other primates such as the gorilla and chimpanzee and this suggests that they arose from a recent segmental duplication45, and our analysis indicates that this also involved the duplication of genes members of the NPIPA and NOMO families. The non-identification of putative ABCC6 pseudogenes in non-primate vertebrate genomes and also the absence of members of the NPIPA family or extra copies of NOMA in other vertebrates suggests that duplication of this genome region only occurred in the evolutionary transition that led to primates71. The reason why ABCC6 pseudogenes persist in primate genomes is not clear, however in humans they have been found to regulate ABCC6 gene transcription43.
The emergence of the bony skeleton, resulting from an intricate physiological mechanism, was of paramount importance in the evolution of the vertebrates. The zebrafish skeleton shows similarity with human bones in terms of cells, matrix proteins, and molecular signaling pathways72. In zebrafish embryos, the abcc6a duplicate was expressed in the kupffer’s vesicles and in the tail bud, while the abcc6b duplicate was expressed in the enveloping layer and embryonic kidney proximal straight tubules38. Abcc6a expression is also found in mineralized tissue specifically in the osteoblasts (bone forming cells) and missense mutations of abcc6a caused hypermineralization of the axial skeleton, resulting in mineralized structures in the intervertebral space39. The mutation (L1429R) in zebrafish abcc6a resulted in a modification of a highly conserved region of NBD-2 that contains the Walker B motif, essential for binding to ATP73. The L1429 variant also occurs in the cow (L1426R; rs440576475), but no phenotype information is available. In humans, in the corresponding variant (L1425P; rs150230403) a proline substitution occurs instead of a leucine, and was not associated with PXE or any other disease. However, the two algorithm tools, Sorting Intolerant From Tolerant (SIFT74) and Polymorphism Phenotyping (PolyPhen75), that are used to predict the impact of an amino acid substitution on protein structure and function, suggested that this variant has a deleterious and damaging effect on the MRP6 protein. Modification in the preceding amino acid (variant I1424T) in human was associated with PXE. The way in which ABCC6 is involved in the lesions of PXE is strongly linked to the ABCC6 gene and reduced amounts of PPi ABCC6 overexpression induces nucleotide release in vitro, which is rapidly converted by ENPP1 into PPi29. It has been reported that ATP secretion from the liver of Abcc6−/− mice was dramatically lower when compared to wild type mice, and this suggested that MRP6 is an ATP efflux transporter28. ATP is converted into AMP and PPi and represents the main source of mineralization inhibiting PPi in plasma, which fully explains why the absence of ABCC6 results in the ectopic mineralization observed in patients with PXE28 and in Abcc6−/− mice63,76.
We revealed that during sea bream skin/scale regeneration abcc6 and the evolutionary related abcc1 gene expression was up-regulated relative to the control (intact skin) at 5 and 10 days after damage. This is intriguing as the change in gene expression was coincident with the phase of intense scale growth and mineralization and is in agreement with the high expression of abcc6a detected in zebrafish at sites of mineralisation, unlike the mammals where ABCC6 is mainly produced by the liver39. Further studies are required to characterize in more detail the role of abcc6 and 1 in teleost skin/scale regeneration.
Our preliminary expression analysis in a teleost skin regeneration model revealed that the abcc6 gene is likely to be involved in controlling scale mineralization during skin/scale regeneration. In fact, it should be noted that mineralization in PXE and its mouse model Abcc6−/−, is not noted at birth, but develops later in life. Probably the abcc6 gene in fish skin acts as a promoter of scale mineralization, since its expression increases at the stage of intense mineralization. We hypothesize that it may also act as an inhibitor of pathological ectopic calcification through a PPi dependent mechanism. Overall, the presence of the abcc6 gene in teleost fishes, its presence only in the genomes of organisms with a bony skeleton, and up-regulation during intense mineralization of the scales suggests that this gene emerged associated with the need for more sophisticated mechanisms to control intracellular and extracellular PPi. Future studies will be aimed at understanding, at a molecular and cellular level, the function of abcc6 in developing and regenerating teleost skin.
References
Hyde, S. C. et al. Structural model of ATP-binding proteins associated with cystic fibrosis, multidrug resistance and bacterial transport. Nature 346, 362–5 (1990).
Vasiliou, V., Vasiliou, K. & Nebert, D. W. Human ATP-binding cassette (ABC) transporter family. Hum Genomics 3, 281–90 (2009).
Wilkens, S. Structure and mechanism of ABC transporters. F1000Prime Rep 7, 14 (2015).
Zoghbi, M. E. & Altenberg, G. A. Hydrolysis at one of the two nucleotide-binding sites drives the dissociation of ATP-binding cassette nucleotide-binding domain dimers. J Biol Chem 288, 34259–65 (2013).
Zoghbi, M. E. & Altenberg, G. A. ATP binding to two sites is necessary for dimerization of nucleotide-binding domains of ABC proteins. Biochem Biophys Res Commun 443, 97–102 (2014).
Al-Shawi, M. K., Polar, M. K., Omote, H. & Figler, R. A. Transition state analysis of the coupling of drug transport to ATP hydrolysis by P-glycoprotein. J Biol Chem 278, 52629–40 (2003).
Davidson, A. L., Dassa, E., Orelle, C. & Chen, J. Structure, function, and evolution of bacterial ATP-binding cassette systems. Microbiol Mol Biol Rev 72, 317–64, table of contents (2008).
Karasik, A. et al. Boosted coupling of ATP hydrolysis to substrate transport upon cooperative estradiol-17-beta-D-glucuronide binding in a Drosophila ATP binding cassette type-C transporter. FASEB J (2017).
Khunweeraphong, N., Stockner, T. & Kuchler, K. The structure of the human ABC transporter ABCG2 reveals a novel mechanism for drug extrusion. Sci Rep 7, 13767 (2017).
Nikaido, H. How are the ABC transporters energized? Proc Natl Acad Sci USA 99, 9609–10 (2002).
Dean, M., Hamon, Y. & Chimini, G. The human ATP-binding cassette (ABC) transporter superfamily. J Lipid Res 42, 1007–17 (2001).
Hollenstein, K., Dawson, R. J. & Locher, K. P. Structure and mechanism of ABC transporter proteins. Curr Opin Struct Biol 17, 412–8 (2007).
Hung, L. W. et al. Crystal structure of the ATP-binding subunit of an ABC transporter. Nature 396, 703–7 (1998).
Glavinas, H., Krajcsi, P., Cserepes, J. & Sarkadi, B. The role of ABC transporters in drug resistance, metabolism and toxicity. Curr Drug Deliv 1, 27–42 (2004).
Kuchler, K. The ABC of ABCs: multidrug resistance and genetic diseases. FEBS J 278, 3189 (2011).
Kruh, G. D. & Belinsky, M. G. The MRP family of drug efflux pumps. Oncogene 22, 7537–52 (2003).
Sodani, K., Patel, A., Kathawala, R. J. & Chen, Z. S. Multidrug resistance associated proteins in multidrug resistance. Chin J Cancer 31, 58–72 (2012).
Le Saux, O. et al. The molecular and physiological roles of ABCC6: more than meets the eye. Front Genet 3, 289 (2012).
Komarova, S. V. et al. Mathematical model for bone mineralization. Front Cell Dev Biol 3, 51 (2015).
Smith, R. & Wordsworth, B.P. The physiology and pathology of bone. in Clinical and Biochemical Disorders of the Skeleton (Oxford University press, Oxford, 2005).
Bergen, A. A. et al. Mutations in ABCC6 cause pseudoxanthoma elasticum. Nat Genet 25, 228–31 (2000).
Costrop, L. M. et al. Novel deletions causing pseudoxanthoma elasticum underscore the genomic instability of the ABCC6 region. J Hum Genet 55, 112–7 (2010).
Le Saux, O. et al. Mutations in a gene encoding an ABC transporter cause pseudoxanthoma elasticum. Nat Genet 25, 223–7 (2000).
Ringpfeil, F., Lebwohl, M. G., Christiano, A. M. & Uitto, J. Pseudoxanthoma elasticum: mutations in the MRP6 gene encoding a transmembrane ATP-binding cassette (ABC) transporter. Proc Natl Acad Sci USA 97, 6001–6 (2000).
Nitschke, Y. et al. Generalized arterial calcification of infancy and pseudoxanthoma elasticum can be caused by mutations in either ENPP1 or ABCC6. Am J Hum Genet 90, 25–39 (2012).
Li, Q. et al. Mutations in the ABCC6 gene as a cause of generalized arterial calcification of infancy: genotypic overlap with pseudoxanthoma elasticum. J Invest Dermatol 134, 658–665 (2014).
Rutsch, F. et al. Mutations in ENPP1 are associated with ‘idiopathic’ infantile arterial calcification. Nat Genet 34, 379–81 (2003).
Jansen, R. S. et al. ABCC6-mediated ATP secretion by the liver is the main source of the mineralization inhibitor inorganic pyrophosphate in the systemic circulation-brief report. Arterioscler Thromb Vasc Biol 34, 1985–9 (2014).
Jansen, R. S. et al. ABCC6 prevents ectopic mineralization seen in pseudoxanthoma elasticum by inducing cellular nucleotide release. Proc Natl Acad Sci USA 110, 20206–11 (2013).
Jiang, Q., Endo, M., Dibra, F., Wang, K. & Uitto, J. Pseudoxanthoma elasticum is a metabolic disease. J Invest Dermatol 129, 348–54 (2009).
Jiang, Q., Li, Q. & Uitto, J. Aberrant mineralization of connective tissues in a mouse model of pseudoxanthoma elasticum: systemic and local regulatory factors. J Invest Dermatol 127, 1392–402 (2007).
Ziegler, S.G. et al. Ectopic calcification in pseudoxanthoma elasticum responds to inhibition of tissue-nonspecific alkaline phosphatase. Sci Transl Med 9 (2017).
Jeong, C. B. et al. Marine medaka ATP-binding cassette (ABC) superfamily and new insight into teleost Abch nomenclature. Sci Rep 5, 15409 (2015).
Luckenbach, T., Fischer, S. & Sturm, A. Current advances on ABC drug transporters in fish. Comp Biochem Physiol C Toxicol Pharmacol 165, 28–52 (2014).
Apschner, A., Huitema, L. F., Ponsioen, B., Peterson-Maduro, J. & Schulte-Merker, S. Zebrafish enpp1 mutants exhibit pathological mineralization, mimicking features of generalized arterial calcification of infancy (GACI) and pseudoxanthoma elasticum (PXE). Dis Model Mech 7, 811–22 (2014).
Canario, A. V. et al. Novel bioactive parathyroid hormone and related peptides in teleost fish. FEBS Lett 580, 291–9 (2006).
Laizé, V., Gavaia, P. J. & Cancela, M. L. Fish: a suitable system to model human bone disorders and discover drugs with osteogenic or osteotoxic activities. Drug Discovery Today: Disease Models 13, 29–37 (2014).
Li, Q. et al. The abcc6a gene expression is required for normal zebrafish development. J Invest Dermatol 130, 2561–8 (2010).
Mackay, E. W., Apschner, A. & Schulte-Merker, S. Vitamin K reduces hypermineralisation in zebrafish models of PXE and GACI. Development 142, 1095–101 (2015).
Pomozi, V. et al. Analysis of pseudoxanthoma elasticum-causing missense mutants of ABCC6 in vivo; pharmacological correction of the mislocalized proteins. J Invest Dermatol 134, 946–53 (2014).
Redruello, B. et al. Isolation and characterization of piscine osteonectin and downregulation of its expression by PTH-related protein. J Bone Miner Res 20, 682–92 (2005).
Rotllant, J. et al. Calcium mobilization from fish scales is mediated by parathyroid hormone related protein via the parathyroid hormone type 1 receptor. Regul Pept 132, 33–40 (2005).
Piehler, A. P. et al. The human ABC transporter pseudogene family: Evidence for transcription and gene-pseudogene interference. BMC Genomics 9, 165 (2008).
Pulkkinen, L., Nakano, A., Ringpfeil, F. & Uitto, J. Identification of ABCC6 pseudogenes on human chromosome 16p: implications for mutation detection in pseudoxanthoma elasticum. Hum Genet 109, 356–65 (2001).
Symmons, O., Varadi, A. & Aranyi, T. How segmental duplications shape our genome: recent evolution of ABCC6 and PKD1 Mendelian disease genes. Mol Biol Evol 25, 2601–13 (2008).
Beck, K., Hayashi, K., Dang, K., Hayashi, M. & Boyd, C. D. Analysis of ABCC6 (MRP6) in normal human tissues. Histochem Cell Biol 123, 517–28 (2005).
Le Saux, O. et al. Expression and in vivo rescue of human ABCC6 disease-causing mutants in mouse liver. PLoS One 6, e24738 (2011).
Hendig, D. et al. Gene expression profiling of ABC transporters in dermal fibroblasts of pseudoxanthoma elasticum patients identifies new candidates involved in PXE pathogenesis. Lab Invest 88, 1303–15 (2008).
Matsuzaki, Y., Nakano, A., Jiang, Q. J., Pulkkinen, L. & Uitto, J. Tissue-specific expression of the ABCC6 gene. J Invest Dermatol 125, 900–5 (2005).
Costa, R. A., Cardoso, J. C. & Power, D. M. Evolution of the angiopoietin-like gene family in teleosts and their role in skin regeneration. BMC Evol Biol 17, 14 (2017).
Tine, M. et al. European sea bass genome and its variation provide insights into adaptation to euryhalinity and speciation. Nat Commun 5, 5770 (2014).
Larsson, A. AliView: a fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 30, 3276–8 (2014).
Edgar, R. C. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics 5, 113 (2004).
Ronquist, F. et al. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61, 539–42 (2012).
Guindon, S. et al. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 59, 307–21 (2010).
Lefort, V., Longueville, J. E. & Gascuel, O. SMS: Smart Model Selection in PhyML. Mol Biol Evol 34, 2422–2424 (2017).
Pinto, P.I.S., Thorne, M.A.S. & Power, D.M. European sea bass (Dicentrarchus labrax) skin and scale transcriptomes. Marine Genomics (2017).
Guerreiro, P. M., Costa, R. & Power, D. M. Dynamics of scale regeneration in seawater- and brackish water-acclimated sea bass, Dicentrarchus labrax. Fish Physiol Biochem 39, 917–30 (2013).
Vieira, F. A. et al. Skin healing and scale regeneration in fed and unfed sea bream, Sparus auratus. BMC Genomics 12, 490 (2011).
Louro, B., Marques, J. P., Power, D. M. & Canario, A. V. Having a BLAST: Searchable transcriptome resources for the gilthead sea bream and the European sea bass. Mar Genomics 30, 67–71 (2016).
Ren, J. et al. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in sea lamprey and Japanese lamprey. BMC Genomics 16, 436 (2015).
Favre, G. et al. The ABCC6 Transporter: A New Player in Biomineralization. Int J Mol Sci 18 (2017).
Klement, J. F. et al. Targeted ablation of the abcc6 gene results in ectopic mineralization of connective tissues. Mol Cell Biol 25, 8299–310 (2005).
Levasseur, A. & Pontarotti, P. The role of duplications in the evolution of genomes highlights the need for evolutionary-based approaches in comparative genomics. Biol Direct 6, 11 (2011).
Caputo Barucchi, V., Giovannotti, M., Nisi Cerioni, P. & Splendiani, A. Genome duplication in early vertebrates: insights from agnathan cytogenetics. Cytogenet Genome Res 141, 80–9 (2013).
Nakatani, Y., Takeda, H., Kohara, Y. & Morishita, S. Reconstruction of the vertebrate ancestral genome reveals dynamic genome reorganization in early vertebrates. Genome Res 17, 1254–1265 (2007).
Jaillon, O. et al. Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 431, 946–57 (2004).
Qian, W., Liao, B. Y., Chang, A. Y. & Zhang, J. Maintenance of duplicate genes and their functional redundancy by reduced expression. Trends Genet 26, 425–30 (2010).
Manousaki, T. et al Jawless fishes of the world 2–16 (Cambridge Scholars Publisher, Newcastle, 2016).
Smith, J. J. et al. Sequencing of the sea lamprey (Petromyzon marinus) genome provides insights into vertebrate evolution. Nat Genet 45(415-21), 421e1–2 (2013).
Johnson, M. E. et al. Positive selection of a gene family during the emergence of humans and African apes. Nature 413, 514–9 (2001).
Hosen, M. J. et al. Zebrafish models for ectopic mineralization disorders: practical issues from morpholino design to post-injection observations. Front Genet 4, 74 (2013).
Geourjon, C. et al. A common mechanism for ATP hydrolysis in ABC transporter and helicase superfamilies. Trends Biochem Sci 26, 539–44 (2001).
Kumar, P., Henikoff, S. & Ng, P. C. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc 4, 1073–81 (2009).
Adzhubei, I. A. et al. A method and server for predicting damaging missense mutations. Nat Methods 7, 248–9 (2010).
Gorgels, T. G. et al. Disruption of Abcc6 in the mouse: novel insight in the pathogenesis of pseudoxanthoma elasticum. Hum Mol Genet 14, 1763–73 (2005).
Amemiya, C. T. et al. The African coelacanth genome provides insights into tetrapod evolution. Nature 496, 311–6 (2013).
Berthelot, C. et al. The rainbow trout genome provides novel insights into evolution after whole-genome duplication in vertebrates. Nat Commun 5, 3657 (2014).
Mulley, J. F., Zhong, Y. F. & Holland, P. W. Comparative genomics of chondrichthyan Hoxa clusters. BMC Evol Biol 9, 218 (2009).
Near, T. J. et al. Resolution of ray-finned fish phylogeny and timing of diversification. Proc Natl Acad Sci USA 109, 13698–703 (2012).
Acknowledgements
Financed by the Foundation for Science and Technology (FCT, Portugal) under the project UID/Multi/04326/2013. We also acknowledge Rute C Félix for helping with the in silico searches. BP was supported by “Fundo Regional para a Ciência (FRC) (M3.1.2/F/023/2011). JCRC and RAC are funded by FCT contracts UID/Multi/04326/2013 and FCT grant SFRH/BD/81625/2011, respectively.
Author information
Authors and Affiliations
Contributions
D.M.P.: planned and supervised the work; B.P. and J.C.R.C. performed all data searches and analysis in the original submission; J.C.R.C. updated and reanalyzed the data in the revised submission; R.A.C.: performed expression analysis. B.P., J.C.R.C., D.M.P., R.A.C., A.R.C. and J.B.A.: wrote and critically revised the manuscript; All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Competing Interests
The authors declare no competing interests.
Additional information
Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Parreira, B., Cardoso, J.C.R., Costa, R. et al. Persistence of the ABCC6 genes and the emergence of the bony skeleton in vertebrates. Sci Rep 8, 6027 (2018). https://doi.org/10.1038/s41598-018-24370-7
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-018-24370-7
This article is cited by
-
Mechanics and pharmacology of substrate selection and transport by eukaryotic ABC exporters
Nature Structural & Molecular Biology (2019)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.