Table 3 Primers and probes used for the identification of Zika, chikungunya and dengue viruses.

From: Zika Virus in Salivary Glands of Five Different Species of Wild-Caught Mosquitoes from Mexico

Primer name Sequence 5′-3′ Sensitivity, no. copies reported References
ZIKV 1086 CCGCTGCCCAACACAAG   Lanciotti, R.S., et al. (2007)
ZIKV 1162c CCACTAACGTTCTTTTGCAGACAT 25
ZIKV 1107-FAM AGCCTACCTTGACAAGCAGTCAGACACTCAA  
CHIK-F3 (ACGCAATTGAGCGAAGCAC) 200 Thavara, U., et al.26
CHIK-B3 (CTGAAGACATTGGCCCCAC)
DENV-For TTGAGTAAACYRTGCTGCCTGTAGCTC 35.30 Lai Y.L., et al.28 and García-Ruíz, D., et al.29
DENV-Rev GAGACAGCAGGATCTCTGGTCTYTC