Table 2 Primers used in this work.

From: Suitability of two distinct approaches for the high-throughput study of the post-embryonic effects of embryo-lethal mutations in Arabidopsis

Gene name Amplified region (bp) Primers
ATSWI3A 4001 F: ggggacaagtttgtacaaaaaagcaggctACTTTCAGGTTGTTCACCAGA
R: ggggaccactttgtacaagaaagctgggtTCTCACGTATTCCTGTCACCA
EMB1381 5694 F: ggggacaagtttgtacaaaaaagcaggctTTGGACCGTAATAACATCCCG
R: ggggaccactttgtacaagaaagctgggtCAAAAGAGAATCCATTTCCAC
EMB1408 5191 F: ggggacaagtttgtacaaaaaagcaggctCGATCAAGCTTTGGGATCTCG
R: ggggaccactttgtacaagaaagctgggtCCGAATATGAAAAGGCATGTC
EMB1441 8456 F: ggggacaagtttgtacaaaaaagcaggctGCTCAATTGGTAGTTGTTCTG
R: ggggaccactttgtacaagaaagctgggtTACAAGGCCCACCCAAAGTTT
EMB1513 4593 F: ggggacaagtttgtacaaaaaagcaggctAGGCGTAAGCTCACTGTGTTG
R: ggggaccactttgtacaagaaagctgggtTTCGAAAGAAAAATCCGACAA
EMB1586 3901 F: ggggacaagtttgtacaaaaaagcaggctGTGTTCATGACCCACGACATT
R: ggggaccactttgtacaagaaagctgggtTTTGGCAATGGCACTAAACAA
EMB1611 7464 F: ggggacaagtttgtacaaaaaagcaggctCCTGGAAACATGACTTCGGTC
R: ggggaccactttgtacaagaaagctgggtGGCCAGTAAAACCACCAAACC
EMB1637 4001 F: ggggacaagtttgtacaaaaaagcaggctGGTGGTGGTTTGTTGCCTTCT
R: ggggaccactttgtacaagaaagctgggtGGGTTGGTTGCTGTTGAGATT
EMB1674 6435 F: ggggacaagtttgtacaaaaaagcaggctCACGCATGCAACAGAGATGAC
R: ggggaccactttgtacaagaaagctgggtATGGCTCCTCTCTCCAAAGGA
EMB1688 3384 F: ggggacaagtttgtacaaaaaagcaggctGTGACTTGTTGTTTTGGTTAG
R: ggggaccactttgtacaagaaagctgggtTTGAACTATCACGTCTTTTCC
EMB1691 7693 F: ggggacaagtttgtacaaaaaagcaggctGCCGGGTAGAGAAATACACTG
R: ggggaccactttgtacaagaaagctgggtACCAATTTGTGGTGCGGTTGC
EMB1706 8220 F: ggggacaagtttgtacaaaaaagcaggctATCTCCTTCAAAGTTCAGCTC
R: ggggaccactttgtacaagaaagctgggtATCTTGCTTGTGAGAAAGGCA
EMB1745 6539 F: ggggacaagtttgtacaaaaaagcaggctTGCAGGAGTAAACACAAGCGC
R: ggggaccactttgtacaagaaagctgggtATAGAGAGAGGGTTGAGGAG
EMB1895 8109 F: ggggacaagtttgtacaaaaaagcaggctGTCTAGAGTCATGTTAGGTGG
R: ggggaccactttgtacaagaaagctgggtTGACGTGGTGATTCTCAGTGG
EMB1990 2533 F: ggggacaagtttgtacaaaaaagcaggctTGTGTCATGGATTACTAATTT
R: ggggaccactttgtacaagaaagctgggtCGATTTCTGGATTTGAGGTTG
EMB2001 3822 F: ggggacaagtttgtacaaaaaagcaggctCATATATGTGTTGAAAACTCA
R: ggggaccactttgtacaagaaagctgggtGTTTGCTTGTTATATTGTGTA
EMB2036 3501 F: ggggacaagtttgtacaaaaaagcaggctTCGTCGCTGGTTCTATGGTTT
R: ggggaccactttgtacaagaaagctgggtCTCTCAAGGAAACGTGCAAGA
EMB2107 4995 F: ggggacaagtttgtacaaaaaagcaggctCAGAGATTACAAGATATCCTG
R: ggggaccactttgtacaagaaagctgggtACTGACTCCAGCAAAATCGGC
EMB2736 5372 F: ggggacaagtttgtacaaaaaagcaggctACAGGTATGGGCATCAGGTTT
R: ggggaccactttgtacaagaaagctgggtACGAGCTCACAATCAGAGTAC
EMB3008 5953 F: ggggacaagtttgtacaaaaaagcaggctCTTCTGATCGGGTGCTTGATA
R: ggggaccactttgtacaagaaagctgggtTGACTATGACGACTGTTGCTG
GAL4 489 F: TCAAGTGCTCCAAGAAGAAGC
R: TGTCCAGATCGAAATCGTCT
CRE 1031 F: CACCATGGCCAATTTACTGACCGTAC
R: CTAATCGCCATCTTCCAGCAG
  1. F: forward primer. R: reverse primer. attB1 and attB2 sites are represented in lower case.