Kif1bp loss in mice leads to defects in the peripheral and central nervous system and perinatal death

Hirst, Caroline S.; Stamp, Lincon A.; Bergner, Annette J.; Hao, Marlene M.; Tran, Mai X.; Morgan, Jan M.; Dutschmann, Matthias; Allen, Andrew M.; Paxinos, George; Furlong, Teri M.; McKeown, Sonja J.; Young, Heather M.

doi:10.1038/s41598-017-16965-3

Download PDF

Article
Open access
Published: 30 November 2017

Kif1bp loss in mice leads to defects in the peripheral and central nervous system and perinatal death

Caroline S. Hirst¹^na1,
Lincon A. Stamp ORCID: orcid.org/0000-0002-8925-7894¹^na1,
Annette J. Bergner¹,
Marlene M. Hao¹,
Mai X. Tran¹,
Jan M. Morgan¹,
Matthias Dutschmann²,
Andrew M. Allen ORCID: orcid.org/0000-0002-2183-5360³,
George Paxinos⁴,
Teri M. Furlong⁴,
Sonja J. McKeown^1,5 &
…
Heather M. Young ORCID: orcid.org/0000-0002-0457-8710¹

Scientific Reports volume 7, Article number: 16676 (2017) Cite this article

1677 Accesses
11 Citations
Metrics details

Subjects

A Publisher Correction to this article was published on 08 June 2018

This article has been updated

Abstract

Goldberg-Shprintzen syndrome is a poorly understood condition characterized by learning difficulties, facial dysmorphism, microcephaly, and Hirschsprung disease. GOSHS is due to recessive mutations in KIAA1279, which encodes kinesin family member 1 binding protein (KIF1BP, also known as KBP). We examined the effects of inactivation of Kif1bp in mice. Mice lacking Kif1bp died shortly after birth, and exhibited smaller brains, olfactory bulbs and anterior commissures, and defects in the vagal and sympathetic innervation of the gut. Kif1bp was found to interact with Ret to regulate the development of the vagal innervation of the stomach. Although newborn Kif1bp^−/− mice had neurons along the entire bowel, the colonization of the gut by neural crest-derived cells was delayed. The data show an essential in vivo role for KIF1BP in axon extension from some neurons, and the reduced size of the olfactory bulb also suggests additional roles for KIF1BP. Our mouse model provides a valuable resource to understand GOSHS.

A truncating Aspm allele leads to a complex cognitive phenotype and region-specific reductions in parvalbuminergic neurons

Article Open access 13 February 2020

Early loss of Scribble affects cortical development, interhemispheric connectivity and psychomotor activity

Article Open access 27 April 2021

Mutations in the KIF21B kinesin gene cause neurodevelopmental disorders through imbalanced canonical motor activity

Article Open access 15 May 2020

Introduction

Goldberg-Shprintzen syndrome (GOSHS, OMIM 609460) is a rare human condition characterized by intellectual disability, microcephaly, dysmorphic facial features, peripheral neuropathy as well as Hirschsprung disease in which neurons are absent from the distal bowel^1,2,3,4. GOSHS is associated with recessive mutations in the gene encoding kinesin family member 1-binding protein (KIF1BP; also known as KBP and KIAA1279)^2,4,5. Studies of human, mouse and zebrafish have shown that KIF1BP is expressed in nearly all tissues^5,6,7 (www.brain-map.org/). Despite the widespread expression of KIF1BP⁵, GOSHS primarily affects the development of neurons and neural crest-derived tissues^4,6. However, there is a wide range of phenotypic variations between GOSHS patients, and mesenchymal tissues can also be affected, including urogenital structures, limbs, eyes and heart^2,3,4,8. Most mutations found in GOSHS patients are thought to cause loss of function of KIF1BP, primarily through nonsense mediated mRNA degradation².

Kinesins (KIF proteins) are a large family of microtubule-based intracellular motors that transport cargo from one part of the cell to another. Cell biological approaches revealed that KIF1BP interacts with a subset of kinesins including KIF1A, KIF1B, KIF1C, KIF3A, KIF13B, KIF14, KIF15 and KIF18A^9,10,11. Studies using cell lines and zebrafish mutants suggest the main role of KIF1BP is to regulate axon extension. Depletion of KIF1BP from PC12 cells and the SH-SY5Y neuroblastoma cell line reduced neurite length^2,6, while overexpression of KIF1BP resulted in increased neurite length in SH-SY5Y cells² but in reduced axon length in cultured hippocampal neurons⁹. kif1bp mutant zebrafish exhibit abnormal CNS and peripheral axon outgrowth^7,11. However, kif1bp mutant zebrafish have neurons along the entire length of the bowel and thus do not develop a Hirschsprung disease-like phenotype⁷.

Mutant mouse models have been critical in understanding many developmental diseases. Here we describe the effects of lack of Kif1bp in mice by generating mice in which Kif1bp is disrupted using CRISPR/Cas9. Our study confirms a role for KIF1BP in axon extension from subpopulations of peripheral and CNS neurons in vivo, but the smaller brain and olfactory bulbs we observed in Kif1bp null mutants suggest additional roles for KIF1BP during nervous system development.

Methods

Mouse strains

Two lines of Kif1bp^+/− mice were generated by CRISPR/Cas9 (see below). All experiments were approved by the Anatomy & Neuroscience, Pathology, Pharmacology and Physiology Animal Ethics Committee of the University of Melbourne and all experiments were performed in accordance with relevant guidelines and regulations. Ret^+/TGM mice, in which cDNA encoding tau-EGFP-myc (TGM) had been inserted into the first coding exon of Ret¹², were mated to Kif1bp^+/− mice.

Generation of Kif1bp null mutant mice using CRISPR/Cas

Mice with targeted disruption of Kif1bp were generated by the Monash University Node of the Australian Phenomics Network. To delete exon 1 of mKBP (2510003E04Rik), guide RNA was designed to bind sequences flanking 5′UTR and intron 1–2. Guide RNA sequences, which were immediately followed by Protospacer Adjacent Motif (PAM) sequences, were cgaccaatgaagtcggtag (forward) and gcagccaggaggagcgttt (reverse) (Fig. 1A). After microinjection and transfer of two-cell stage embryos into a pseudopregnant female, the genotypes of the newborn pups were determined. The genomic regions flanking the gRNA target were amplified by PCR using specific primers: Fwd (5′CAGCGGAAGGCTCTGTATTC 3′) and Rev (5′TGATTCGGACGCTTAGGTTT 3′). Cloning and then sequencing identified two mutant mice where exon 1 was deleted. Although both mice were missing all of exon 1, the deletions were different (Fig. 1B). Hence, after confirmation of transmission of both mutations, two lines of Kif1bp mutant mice were established. Female and male heterozygous mutants for each line were mated.

Genotyping of Kif1bp lines

Genotyping by PCR was performed on DNA extracted from tail tissues of newborn mice, or liver and tail from embryonic mice. Primers used for mKif1bp genotyping were as described above. PCRs were performed using standard PCR protocols with the addition of 5% DMSO in the reaction. Some genotyping of Kif1bp lines was also performed by Transnetyx (Cordova, TN, USA). Conditions and primers used to genotype Ret^TGM mice have been described previously¹².

Western blot

Protein was isolated from brain of E12.5 embryos generated by crossing mice heterozygous for Kif1bp. Tissue was lysed in RIPA buffer containing protease inhibitors, manually homogenised on ice and cleared by centrifugation at 14,000g at 4 °C for 15min before storing at −20C. Samples were processed further for SDS-PAGE followed by western blot analysis. Blots were blocked in 5% milk powder and incubated in either rabbit anti-Kif1bp (1:1000, kindly supplied by Maria Alves and Robert Hofstra) or mouse anti-E7 Tubulin (1:500, Developmental Studies Hybridoma Bank) at 4 °C overnight with constant agitation. The Kif1bp antibody was a rabbit polyclonal antibody directed against a peptide encompassing amino acids 24–38 of mKif1bp⁶. After washing in PBS/Tween 20, blots were incubated in either goat anti-rabbit IgG-HRP or goat anti-mouse IgG-HRP (Zymed, both 1:10,000). Bands were detected using chemiluminescence (Amersham ECL, GE Healthcare).

Immunohistochemistry

Wholemount preparations of E12.5 gastrointestinal tract and lungs, E15.5 small intestine, E16.5 diaphragm and external muscle/myenteric plexus of P0 mice were fixed and processed for immunohistochemistry as described previously^13,14. For cryosections of the olfactory bulb/nasal cavities and brainstems, newborn mice were injected with ketamine (200 mg/kg) and xylazine (20mg/kg) followed by transcardiac tissue perfusion with 4% paraformaldehyde. The heads were post-fixed overnight, washed and then cryoprotected. Cryosections of various tissues were processed for immunohistochemistry as described previously¹⁵ using the following primary antisera: goat anti-Sox10 (1:200, Santa Cruz, Dallas, Texas, USA), mouse anti-Tuj1 (1:2000, Covance, North Ryde, NSW, Australia), sheep anti-nNOS (1:2000, gift of Dr Piers Emson)^16,17, human anti-HuC/D (1:5000, gift of Dr Vanda Lennon)¹⁸, sheep anti tyrosine hydroxylase (TH) (1:2000, Chemicon), guinea-pig anti-Phox2b (1:1000, gift of Prof. Hideki Enomoto)¹⁹, rabbit anti-NK1 receptor (NK1R) (1:1000, Millipore), goat anti-ChAT (1:50, Millipore) and rabbit anti-GABA (1:1000; Sigma). Secondary antisera used were donkey anti-sheep FITC (1:100, Jackson Labs), donkey anti-mouse Alexa594 (1:200, Molecular Probes), donkey anti-guinea pig FITC (1:100, Chemicon) and donkey anti-human Alexa594 (1:500, Jackson Labs). In some sections, nuclei were labelled with DAPI.

Myenteric neuron counts in the distal colon of P0 mice

The number of Hu + and NOS + neurons present in stacked confocal images of 393 μm × 393 μm fields of view of wholemount preparations of distal colon were counted manually using Fuji cell counter.

Measurement of migration distance

The distance from the ileocaecal junction to the most distal Sox10 + cell in wholemount preparations of E12.5 colon was measured from projected confocal images using Fuji software as described previously²⁰. The distance from the junction between the stomach and small intestine and the most distal Sox10 + cell was also measured in wholemount preparations of gut from E10.5 mice using the same method.

Measurement of area occupied by vagal fibers in the stomach and TH + fibers in the duodenum

Wholemount preparations of stomach from E12.5 mice were processed for Tuj1 immunostaining, imaged on a confocal microscope and then the area occupied by Tuj1 vagal branches measured in projected images using Fuji software. Wholemount E15.5 gut preparations were immunostained for tyrosine hydroxylase (TH), and then tiled confocal images were montaged into a single image. Using Fuji software, the first 2 mm of the duodenum was marked, and the area containing TH + fibers within the 2 mm zone was measured.

Measurement of commissure thickness

P0 mice were perfusion fixed as described above and the brain processed for paraffin sectioning and Nissl staining. Sections were scanned and measurements taken using CaseViewer software. Both the anterior and posterior branches of the anterior commissure were measured. As many fibres in the anterior commissure of Kif1bp^−/− mice did not cross the midline, the thickness of the anterior commissure was measured between 200–300 μm from the midline. Measurements were collected across multiple sections and averaged. The thickness of the corpus callosum was measured at the midline at two points: Anteriorly at the level of the lateral septal nucleus, and posteriorly at the level of the ventral hippocampal commissure.

Skull bone and cartilage staining

Skull bone and cartilage staining was performed using Alizarin Red and Alcian blue as described previously²¹.

Statistics

GraphPad Prism 7.03 was used to analyse data and prepare graphs. All measurements were performed with the researcher blinded to the genotype of the preparations.

Results

Generation of Kif1bp null mutant mice using CRISPR/Cas technology

Using CRISPR-Cas9 editing, two lines of mice were generated in which exon 1 of Kif1bp was disrupted (Fig. 1A,B). Western blotting showed an absence of Kif1bp protein in newborn Kif1bp^−/− mice of both lines (Fig. 1C; see Supplementary Figure 1 for full-length gels). Kif1bp^−/− mice in both lines were born in the expected Mendelian ratios (20/75 for line 1 and 17/89 for line2), but died within 3–4 hours after birth. Most Kif1bp^−/− mice had cyanotic skin colour shortly after birth (Fig. 1C). Newborn Kif1bp^−/− mice also had significantly lower body weights than their littermates (1.20 ± 0.09 g for Kif1bp^−/− mice versus 1.31 ± 0.02 g for their littermates, mean ± S.D., unpaired t test, p = 0.0098). Breathing in newborn Kif1bp^−/− mice was characterized by sporadic deep gasping activities and an absence of detectable normal breathing movements (Supplementary movie). Histopathological analysis performed by the Australian Phenomics Network revealed that all major organs were present and there was no obvious pathology in the heart, thymus, lungs, trachea, diaphragm, pancreas, spleen, intestines or spinal cord. Alizarin Red and Alcian blue skull preparations did not reveal any noticeable defects in craniofacial morphology in P0 homozygous mutant mice (data not shown).

Effects of loss of Kif1bp and interactions with Ret in the development of gut innervation

Intrinsic innervation

Humans with recessive mutations in KIF1BP have GOSHS, and one of the characteristic malformations is Hirschsprung disease⁴. We therefore examined whether P0 Kif1bp^−/− mice have neurons along the entire length of the colon using antisera to the pan-neuronal marker, HuC/D, and the enteric neuron sub-type marker, nNOS. HuC/D + and nNOS + neurons were present along the entire colon in both lines of P0 Kif1bp^−/− mice (Fig. 2A,B). Furthermore, the densities of HuC/D and nNOS myenteric neurons were quantified in the distal colon of one line of P0 Kif1bp^−/− mice (line 1) and were not significantly different from littermates (Fig. 2C,D; unpaired t tests, p > 0.05). Kif1bp is expressed by the enteric nervous system in zebrafish⁶. RT-PCR (Supplementary Figure 2) and in situ hybridization (Supplementary Figure 3) studies confirmed expression of Kif1bp in ENCCs of embryonic mice, although gut mesenchymal and epithelial cells also expressed Kif1bp (Supplementary Figure 3).

Mutations in some genes result in delayed colonization of the gut by enteric neural crest-derived cells (ENCCs), but the entire gastrointestinal tract is eventually colonized^20,22. We therefore examined whether the colonization of the gut by ENCCs is delayed in embryonic Kif1bp^−/− mice. Wholemount preparations of small and large intestine from E12.5 mice were processed for immunohistochemistry using the neural crest cell marker, Sox10, and the distance from the ileo-caecal junction to the most caudal Sox10 + cell measured; in E12.5 mice, the migratory wavefront in wild-type mice is in the mid-colon²³. In both lines of mice, the migration of ENCCs was significantly delayed in E12.5 Kif1bp^−/− mice compared to littermate controls (Fig. 2E–H; unpaired t tests, p = 0.0008 for line 1 and p = 0.0002 for line 2). However, there was no significant difference in the distance from the stomach to the most caudal Sox10 + cell in E10.5 Kif1bp^−/− mice and their littermates (Fig. 2I), and thus there does not appear to be a delay in the entry of vagal neural crest-derived cells into the gut.

Mutations in RET are the most common cause of HSCR²⁴, and Ret^+/− mice are genetically predisposed to HSCR-like distal aganglionosis^25,26,27. We crossed Kif1bp^+/− mice (line 1) with Ret^+/TGM mice, and then inter-crossed Kif1bp^+/−; Ret^+/TGM mice. In confirmation with the data shown in Fig. 2G,H, the migration of ENCCs in E12.5 Ret^+/+; Kif1bp^−/− mice was significantly delayed compared to Ret^+/+; Kif1bp^+/+ mice (ANOVA, p < 0.05), but there was no significant difference between E12.5 Ret^+/+; Kif1bp^−/− and Ret^+/TGM; Kif1bp^−/− mice (Fig. 2J; ANOVA). Thus Kif1bp does not appear to interact with Ret to regulate ENCC migration.

kif1bp mutant zebrafish exhibit delayed and defective axon growth in the peripheral nervous system, including the ENS⁷. ENCCs migrate in close association with neurites of enteric neurons^28,29. At mid-embryonic ages, most neurites project caudally along the longitudinal axis of the gut^29,30. We used Tuj1 antisera to examine neurites of intrinsic neurons in the gut of E12.5 mice. In the small intestine of both Kif1bp^+/+ and Kif1bp^+/− mice, many Tuj1 + neurites projected caudally, and the appearance of the neuronal network was not obviously different between genotypes (Fig. 2M). We also examined Tuj1 + neurites associated with ENCCs at the migratory wavefront in the mid-colon of E12.5 mice and quantified the density of Tuj1 staining in the same field of view as the most caudal Sox10 + cell. The number of Tuj1 neurites at the migratory wavefront was very variable between embryos of all genotypes; in some embryos there were very few Tuj1 + neurites associated with the most caudal Sox10 + ENCCs (Fig. 2O), while in other embryos, most ENCCs were associated with Tuj1 + neurites (Fig. 2P). Although the four lowest values for the density of Tuj1 + pixels (number of Tuj1 + pixels/area of gut) at the migratory wavefront were all from Kif1bp^−/− mice, overall there was no significant difference in the density of Tuj1 + pixels between Kif1bp^−/− mice and their littermates (Fig. 2K, unpaired t test, p = 0.15). There were also no significant differences in the density of Sox10 + cells close to the migratory wavefront (data not shown, unpaired t test, p = 0.4) or in the ratio of Tuj1 + neurites:Sox10 + ENCCs (Fig. 2L, unpaired t test, p = 0.08), although the four lowest values for the Tuj1:Sox10 ratio were from Kif1bp^−/− mice. Hence we are unable to associate the delay in ENCC migration with defects in neurites close to the migratory wavefront.

Extrinsic innervation of the gut

The axons of sympathetic neurons that innervate the intestines project along intestinal arteries and first enter the small intestine around E15.5³¹. The area occupied by tyrosine hydroxylase (TH) + fibers in the first 2 mm of duodenum in E15.5 Kif1bp^+/+ and Kif1bp^−/− mice was compared (Fig. 3A–D), and was significantly smaller in Kif1bp^−/− mice (Fig. 3E, unpaired t test, p = 0.002).

The vagal innervation of the stomach was examined using Tuj1 antisera, which labels intrinsic neurons as well as vagal fibers. At the gastroesophageal junction of E12.5 Kif1bp^+/+ mice, large bundles of vagal nerve fibers extended into the stomach and then branched into smaller bundles. The area occupied by branches of the vagus was significantly smaller in E12.5 Kif1bp^−/− mice compared to their littermates (Fig. 4A–C, unpaired t test, p < 0.0001), and vagal branches were often missing in the proximal stomach of the null mutants (Fig. 4B). The width of the vagus nerve at the gastroesophageal junction was also smaller in E12.5 Kif1bp^−/− mice (Fig. 4A,B,D, unpaired t test, p < 0.0001). However, the defect was not fully penetrant as the vagal innervation of the stomach of two Kif1bp^−/− mice was well within the normal range (Fig. 4C,D). Vagal branches were also missing, smaller or shorter in the stomach of newborn Kif1bp^−/− mice (Fig. 4G,H).

Ret null mutant mice do not have any neurons in the small and large intestine, and in the stomach, neurons are only present in the proximal stomach^32,33. In the stomach of E12.5 Kif1bp^+/+-; Ret^+/+ and Kif1bp^+/−; Ret^+/TGM mice, Sox10 + cells and Tuj1 + vagal nerve fibers were present throughout the stomach. In E12.5 Kif1bp^+/+; Ret^TGM/TGM and Kif1bp^+/−; Ret^TGM/TGM mice, Sox10 + cells and Tuj1 + vagal nerve fibers were present only in the proximal stomach, and all Sox10 + cells were associated with vagal nerve fibers (Fig. 4E,E’). In 2/4 Kif1bp^−/−; Ret^TGM/TGM mice, vagal nerve fibers were absent from both sides of the stomach, and the only Tuj1 staining was associated with a very small number of intrinsic neurons (Fig. 4F,F’); in the other 2/4 Kif1bp^−/−; Ret^TGM/TGM embryos examined, a small number of short vagal fibers was present on one side of the stomach only. No vagal fibers were observed in the vicinity of the pancreas in double mutants (Fig. 4K), but were present in other phenotypes (Fig. 4I,J). Thus Kif1bp interacts with Ret to regulate the development of the vagal innervation of the gut. In Kif1bp^−/−; Ret^TGM/TGM mice, all Sox10 + cells in the esophagus appeared to be associated with vagal nerve fibers.

Effects of loss of Kif1bp on the development of the innervation of the lungs and diaphragm

Because Kif1bp^−/− mice die very shortly after birth and exhibit breathing defects the innervation of the lungs and diaphragm were examined. The number of Tuj1 + (vagal) fibers in the lungs of E12.5 Kif1bp^−/− mice was reduced (Fig. 5A,B). However, there were no noticeable differences in the phrenic innervation of the diaphragm of E16.5 Kif1bp^−/− mice compared to littermates (Fig. 5C,D).

Effects of loss of Kif1bp on the brain

Brain size and olfactory bulbs

Newborn Kif1bp^−/− mice had significantly lower brain weights than their siblings (0.09 ± 0.01 g for Kif1bp^−/− mice versus 0.11 ± 0.01 g for their littermates, mean ± S.D., unpaired t test, p = 0.01). Inspection of the brains of newborn Kif1bp^−/− mice revealed noticeably smaller olfactory bulbs (Fig. 6A,C). This was confirmed by measuring the area occupied by the olfactory bulbs from photographs of the dorsal aspect of the brain of P0 mice; in both lines of Kif1bp mice, the olfactory bulbs of Kif1bp^−/− mice were about 50% smaller than Kif1bp^+/+ and Kif1bp^+/− littermates (Fig. 6E,F, unpaired t tests, p = 0.0001 for both lines). The cortical surface area was also slightly, but significantly, smaller in Kif1bp^−/− mice (Fig. 6G,H, p = 0.008 for line 1 and p = 0.048 for line 2). Histological analysis revealed that the olfactory bulbs of newborn Kif1bp^−/− mice were not laminated (Fig. 6B,D), while immunohistochemical studies showed that GABA + and TH + neurons were present in the olfactory bulb of Kif1bp null mutants, but were sparse and were only found close to the periphery (Fig. 6I–L). There was no obvious difference in the appearance of Tuj1 + axons projecting from the olfactory epithelium towards the olfactory lobes in horizontal sections of P0 mice (Fig. 6M–P).

White matter tracts

The width of the corpus callosum and anterior commissure (ac), two of the major white matter tracts in the brain were quantified in Nissl-stained coronal sections. The width of the pars anterior ac and the more posterior ac were measured 200–300 μm from the midline, and were significantly thinner in Kif1bp^−/− mice (Fig. 7A–F, unpaired t tests, p = 0.0013 and p = 0.0001). In the mutants, very few fibers crossed the midline, but appeared to divert dorsally, possibly with fibers in the fornix. However, there was no significant difference in the width of the corpus callosum measured at the midline at level of the lateral septal nucleus or more posteriorly at the level of the ventral hippocampal commissure (Fig. 7G,H, p = 0.7 and p = 0.69).

Respiratory nuclei in the brainstem

Mice harbouring human mutations in PHOX2B associated with congenital hypoventilation syndrome (CCHS) die perinatally from breathing defects, and some of the respiratory nuclei in the brainstem are missing³⁴. Because Kif1bp^−/− mice exhibit breathing, defects, we examined the major nuclei in sagittal sections of the brainstem of newborn mice using antisera to Phox2b, choline acetylcholine transferase (ChAT) and the neurokinin-1 receptor. All major brainstem motor nuclei were present in P0 Kif1bp^−/− mice including the facial (Fig. 8), trigeminal and hypoglossal nuclei as well as the ambiguus nucleus (Fig. 8) and dorsal motor nucleus of the vagus nerve. Moreover, the primary respiratory phase oscillators such as the retrotrapezoid nucleus/parafacial respiratory group, revealed by Phox2b staining^35,36 and the pre-Bötzinger complex, revealed by neurokinin 1 receptor staining^37,38, were also present and not noticeably different in size from wild-type mice (Fig. 8).

Discussion

We generated Kif1bp null mice using Crispr/Cas9. Both mouse lines generated showed the same phenotype of neonatal death, decreased brain size, including cerebral cortex, smaller and disorganised olfactory bulbs, reduced anterior commissure, delayed enteric neural crest colonisation of the gut and defective vagal and sympathetic innervation of the gut. We did not observe craniofacial abnormalities or HSCR in the mouse model. These latter aspects of the phenotype are similar to kif1bp mutant zebrafish, which displayed reduced axonal growth, but neurons were present along the length of the gut and no craniofacial abnormalities were observed⁷.

Similarities between the mouse model and GOSHS in humans include alterations in brain development, particularly a reduced overall size of the brain. The reduced size of the olfactory bulbs in mutant mice was particularly striking. The olfactory bulbs also lacked normal lamellar organisation, although at least some of the normal neuronal subtypes were present. Moreover, a significant decrease in size of the anterior commissure was observed. Because the two olfactory bulbs are interconnected via the anterior limb of the anterior commissure, the reduction in anterior commissure size may be due to the reduction in olfactory bulb size. Further, the reduced development of the olfactory bulb may decrease output from the olfactory bulb to the olfactory cortex and in turn result in reduced communication between olfactory cortices, which normally communicate via axons in the posterior limb of the anterior commissure³⁹. In one reported case of GOSHS, MRI showed an absence of the anterior commissure⁴⁰, however this patient was not genetically confirmed to have GOSHS, and may have had the phenotypically similar but genetically distinct Mowat-Wilson syndrome instead. We were unable to find any reports of defective sense of smell in GOSHS patients, although smell is not routinely included in neurological assessments, and smell identification tests would be difficult to perform in GOSHS patients, who also have mental retardation. Like GOSHS in humans, most of the defects we observed in Kif1bp^−/− mice were not fully penetrant.

Most GOSHS patients have Hirschsprung disease⁴. Kif1bp mutant mice displayed delayed enteric neural crest colonisation of the gut at E12.5, however by birth the entire gastrointestinal tract was colonised and the mice therefore did not display a Hirschsprung disease phenotype. Zebrafish with mutant kif1bp also have full colonisation of the gut⁷. The human gastrointestinal tract is much longer than that of mouse and zebrafish, and hence human enteric neural crest cells must migrate substantially further than in smaller animals. The human gut may therefore be more sensitive to delays in neural crest migration. Differences between human patients and other mouse models of HSCR support this idea. For example, heterozygous mutations of RET can be sufficient to cause HSCR in humans²⁴, while Ret^+/− mice do not have HSCR-like aganglionosis⁴¹. However, reducing the amount of Ret in mice to approximately one third of wild-type levels does cause HSCR-like aganglionosis⁴².

In mice, most enteric neural crest-derived cells migrate in close association with neurites^28,29. We examined if the delay in migration of enteric neural crest cells in Kif1bp mutants might be due to a reduction in the number of neurites along the migratory pathway. However, there was no significant difference in the amount of Tuj1 staining close to the migratory wavefront in Kif1bp null mutants, and so the mechanism by which Kif1bp regulates enteric neural crest cell migration remains to be determined.

Mice lacking Kif1bp exhibited some phenotypic features that have not been reported in GOSHS patients, including defects in the extrinsic innervation of the bowel. Previous studies have shown that the development of the vagal innervation of the mouse stomach requires netrin-1⁴³, Slit ligands⁴⁴, BDNF⁴⁵, and the transcription factor, Tbx1⁴⁶, while artemin⁴⁷, NGF⁴⁸ and netrin-1⁴⁹ play a role in the development of the sympathetic innervation of the gut⁵⁰. Our data show that Kif1bp is required for the development of the vagal innervation of the stomach and the sympathetic innervation of the intestine. kif1bp mutant zebrafish were reported to have reduced axons in the ENS, although it was not determined whether intrinsic and/or extrinsic neurons were affected⁷. Sensory axonal neuropathy has been reported in one case of GOSHS³, but to our knowledge gastric motility and secretion have not been examined in patients with GOSHS. In future studies it would be interesting to examine vagal and sympathetic ganglia in Kif1bp mutants to determine if the reduced innervation is due to reduced numbers of cell bodies and/or defects in axon projections.

We observed an interaction between Kif1bp and Ret in the development of vagal innervation of the stomach, but not in the colonization of the intestine by neural crest-derived cells. In mice lacking only Ret, vagal nerve fibers occupied around one third of the stomach surface, whereas in mice lacking both Ret and Kif1bp, there were almost no vagal nerve fibers in the stomach or projecting to the pancreas.

An incidental observation of our study was that in Ret^−/− mice, almost all of the Sox10 + cells, which are only present in the proximal stomach, were associated with vagal nerve fibers. Recent studies have shown that peripheral glial stem cells (also called Schwann cell precursors) are the source of parasympathetic neurons^51,52, sub-populations of enteric neurons^53,54 and adrenal chromaffin cells⁵⁵. Our data support a very recent study showing that enteric neurons in the esophagus and stomach arise from Schwann cell precursors that navigate into the esophagus and stomach along the vagus nerve⁵³.

In the current study, loss of Kif1bp only affected a sub-population of axons in the peripheral and central nervous systems of mice. For example, we found no evidence that the axons of enteric neurons, the phrenic nerve innervating the diaphragm or the corpus callosum were affected in Kif1bp null mutants. The mechanism by which Kif1bp affects axonal outgrowth and transport has been examined in several studies. A yeast two-hybrid screen using an E11 mouse cDNA library showed that KIF1BP binds to microtubule-associated proteins⁶, and in human fibroblasts, KIF1BP was reported to co-localize and interact with α-tubulin and F-actin². Moreover, recent studies have demonstrated that KIF1BP binds to and regulates a variety of kinesin motor proteins involved in microtubule cytoskeletal organization and neuronal cargo transport^9,11. KIF1BP has been shown to bind KIF1B, SCG10^6,11, KIF1A, KIF1C, KIF3A, KIF13B, KIF14, KIF15 and KIF18A⁹, however no association was detected between SCG10 and KIF1BP in the latter study. These members of the kinesin superfamily are from different subfamilies, which have different functions and transport different cargo⁵⁶. As KIF1BP can bind to multiple different members of these subfamilies, it is possible that the differential effects of loss of Kif1bp on axon projections from different neuronal populations might reflect differences in the expression of particular KIFs by different neuron types.

Unlike GOSHS patients, Kif1bp null mutant mice died within several hours of birth. Premature death was associated with respiratory failure, as indicated by cyanosis and hypoxic gasping. It is possible that respiratory failure is linked to reduced vagal innervation of the lungs. Vagal feedback linked to the Hering-Breuer reflex of pulmonary stretch receptors⁵⁷ is critical for neonatal breathing⁵⁸, and vagotomy triggers acute respiratory failure in neonates⁵⁹. Thus reduced vagal innervation of the lung may be a major contributing factor for respiratory failure observed in Kif1bp^−/− mice. Although critical respiratory centers and motor nuclei in the brainstem appear to be normally developed and the diaphragm is innervated in Kif1bp null mutants, we also cannot rule out the possibility of defects in the connectivity of the neural circuitry underlying respiration. It would be interesting to restore Kif1bp only in the nervous system to determine if neonatal lethality is rescued.

To date, the main cellular functions identified for KIF1BP are to regulate axon growth and synaptic vesicle transport^6,7,9,11. However, our data showing reduced olfactory bulb and brain size strongly suggest that KIF1BP must also play an essential role in survival, proliferation and/or neuronal differentiation during development of some parts of the nervous system.

In conclusion, we have generated the first mouse model of GOSHS, which exhibit defects in the development of subpopulations of CNS and peripheral neurons. It is not surprising that mutations that affect general developmental neurobiological processes such as axon extension (this study) and synapse development that underlie autism⁶⁰ affect both central and peripheral neurons.

Change history

08 June 2018
A correction to this article has been published and is linked from the HTML and PDF versions of this paper. The error has been fixed in the paper.

References

Brooks, A. S. et al. A consanguineous family with Hirschsprung disease, microcephaly, and mental retardation (Goldberg-Shprintzen syndrome). J Med Genet 36, 485–489 (1999).
PubMed PubMed Central CAS Google Scholar
Drevillon, L. et al. KBP-cytoskeleton interactions underlie developmental anomalies in Goldberg-Shprintzen syndrome. Hum Mol Genet 22, 2387–2399 (2013).
Article PubMed CAS Google Scholar
Dafsari, H. S. et al. Goldberg-Shprintzen megacolon syndrome with associated sensory motor axonal neuropathy. Am J Med Genet A 167, 1300–1304 (2015).
Article PubMed CAS Google Scholar
Brooks, A.S. & Hofstra, R.M.W. KIAA1279 and Goldberg-Shprintzen Syndrome, In Epstein’s Inborn Errors of Development: The Molecular Basis of Clinical Disorders of Morphogenesis. (eds. Erickson, R. P. & Wynshaw-Boris, A. J.) 1417–1421 (Oxford University Press, Oxford; 2016).
Brooks, A. S. et al. Homozygous nonsense mutations in KIAA1279 are associated with malformations of the central and enteric nervous systems. Am J Hum Genet 77, 120–126 (2005).
Article PubMed PubMed Central CAS Google Scholar
Alves, M. M. et al. KBP interacts with SCG10, linking Goldberg-Shprintzen syndrome to microtubule dynamics and neuronal differentiation. Hum Mol Genet 19, 3642–3651 (2010).
Article PubMed CAS Google Scholar
Lyons, D. A., Naylor, S. G., Mercurio, S., Dominguez, C. & Talbot, W. S. KBP is essential for axonal structure, outgrowth and maintenance in zebrafish, providing insight into the cellular basis of Goldberg-Shprintzen syndrome. Development (Cambridge, England) 135, 599–608 (2008).
Article CAS Google Scholar
Salehpour, S., Hashemi-Gorji, F., Soltani, Z., Ghafouri-Fard, S. & Miryounesi, M. Association of a Novel Nonsense Mutation in KIAA1279 with Goldberg-Shprintzen Syndrome. Iranian journal of child neurology 11, 70–74 (2017).
PubMed PubMed Central Google Scholar
Kevenaar, J. T. et al. Kinesin-Binding Protein Controls Microtubule Dynamics and Cargo Trafficking by Regulating Kinesin Motor Activity. Curr Biol 26, 849–861 (2016).
Article PubMed CAS Google Scholar
Wozniak, M. J., Melzer, M., Dorner, C., Haring, H. U. & Lammers, R. The novel protein KBP regulates mitochondria localization by interaction with a kinesin-like protein. BMC Cell Biol 6, 35 (2005).
Article PubMed PubMed Central CAS Google Scholar
Drerup, C. M., Lusk, S. & Nechiporuk, A. Kif1B Interacts with KBP to Promote Axon Elongation by Localizing a Microtubule Regulator to Growth Cones. J Neurosci 36, 7014–7026 (2016).
Article PubMed PubMed Central CAS Google Scholar
Enomoto, H. et al. RET signaling is essential for migration, axonal growth and axon guidance of developing sympathetic neurons. Development (Cambridge, England) 128, 3963–3974 (2001).
CAS Google Scholar
Hao, M. M. et al. The role of neural activity in the migration and differentiation of enteric neuron precursors. Neurogastroenterol Motil 22, e127–137 (2010).
PubMed CAS Google Scholar
Hotta, R. et al. Transplanted progenitors generate functional enteric neurons in the postnatal colon. The Journal of clinical investigation 123, 1182–1191 (2013).
Article PubMed PubMed Central CAS Google Scholar
McKeown, S. J., Mohsenipour, M., Bergner, A. J., Young, H. M. & Stamp, L. A. Exposure to GDNF Enhances the Ability of Enteric Neural Progenitors to Generate an Enteric Nervous System. Stem cell reports 8, 476–488 (2017).
Article PubMed PubMed Central CAS Google Scholar
Herbison, A. E., Simonian, S. X., Norris, P. J. & Emson, P. C. Relationship of neuronal nitric oxide synthase immunoreactivity to GnRH neurons in the ovariectomized and intact female rat. J Neuroendocrinol 8, 73–82 (1996).
Article PubMed CAS Google Scholar
Young, H. M. & Ciampoli, D. Transient expression of neuronal nitric oxide synthase by neurons of the submucous plexus of the mouse small intestine. Cell and tissue research 291, 395–401 (1998).
Article PubMed CAS Google Scholar
Fairman, C. L., Clagett-Dame, M., Lennon, V. A. & Epstein, M. L. Appearance of neurons in the developing chick gut. Dev Dyn 204, 192–201 (1995).
Article PubMed CAS Google Scholar
Uesaka, T., Nagashimada, M. & Enomoto, H. GDNF signaling levels control migration and neuronal differentiation of enteric ganglion precursors. J Neurosci 33, 16372–16382 (2013).
Article PubMed CAS Google Scholar
Anderson, R. B. et al. The cell adhesion molecule L1 is required for chain migration of neural crest cells in the developing mouse gut. Gastroenterology 130, 1221–1232 (2006).
Article PubMed CAS Google Scholar
Ovchinnikov, D. Alcian blue/alizarin red staining of cartilage and bone in mouse. Cold Spring Harbor protocols 2009, pdbprot5170 (2009).
Article Google Scholar
Barlow, A. J., Dixon, J., Dixon, M. J. & Trainor, P. A. Balancing neural crest cell intrinsic processes with those of the microenvironment in Tcof1 haploinsufficient mice enables complete enteric nervous system formation. Hum Mol Genet 21, 1782–1793 (2012).
Article PubMed PubMed Central CAS Google Scholar
Obermayr, F., Hotta, R., Enomoto, H. & Young, H. M. Development and developmental disorders of the enteric nervous system. Nat Rev Gastroenterol Hepatol 10, 43–57 (2013).
Article PubMed CAS Google Scholar
Amiel, J. et al. Hirschsprung disease, associated syndromes and genetics: a review. J Med Genet 45, 1–14 (2008).
Article PubMed CAS Google Scholar
McCallion, A. S., Stames, E., Conlon, R. A. & Chakravarti, A. Phenotype variation in two-locus mouse models of Hirschsprung disease: tissue-specific interaction between Ret and Ednrb. Proceedings of the National Academy of Sciences of the United States of America 100, 1826–1831 (2003).
Article ADS PubMed PubMed Central CAS Google Scholar
Stewart, A. L., Young, H. M., Popoff, M. & Anderson, R. B. Effects of pharmacological inhibition of small GTPases on axon extension and migration of enteric neural crest-derived cells. Developmental biology 307, 92–104 (2007).
Article PubMed CAS Google Scholar
Fu, M. et al. Vitamin A facilitates enteric nervous system precursor migration by reducing Pten accumulation. Development (Cambridge, England) 137, 631–640 (2010).
Article CAS Google Scholar
Young, H. M. et al. Colonizing while migrating: how do individual enteric neural crest cells behave? BMC biology 12, 23 (2014).
Article PubMed PubMed Central CAS Google Scholar
Young, H. M., Jones, B. R. & McKeown, S. J. The projections of early enteric neurons are influenced by the direction of neural crest cell migration. J Neurosci 22, 6005–6018 (2002).
Article PubMed CAS Google Scholar
Sasselli, V. et al. Planar cell polarity genes control the connectivity of enteric neurons. The Journal of clinical investigation 123, 1763–1772 (2013).
Article PubMed PubMed Central CAS Google Scholar
Hatch, J. & Mukouyama, Y. S. Spatiotemporal mapping of vascularization and innervation in the fetal murine intestine. Dev Dyn 244, 56–68 (2015).
Article PubMed Google Scholar
Durbec, P. L., Larsson-Blomberg, L. B., Schuchardt, A., Costantini, F. & Pachnis, V. Common origin and developmental dependence on c-ret of subsets of enteric and sympathetic neuroblasts. Development (Cambridge, England) 122, 349–358 (1996).
CAS Google Scholar
Young, H. M., Stamp, L. A. & McKeown, S. J. ENS Development Research Since 1983: Great Strides but Many Remaining Challenges. Advances in experimental medicine and biology 891, 53–62 (2016).
Article PubMed CAS Google Scholar
Nagashimada, M. et al. Autonomic neurocristopathy-associated mutations in PHOX2B dysregulate Sox10 expression. The Journal of clinical investigation 122, 3145–3158 (2012).
Article PubMed PubMed Central CAS Google Scholar
Dubreuil, V. et al. A human mutation in Phox2b causes lack of CO2 chemosensitivity, fatal central apnea, and specific loss of parafacial neurons. Proceedings of the National Academy of Sciences of the United States of America 105, 1067–1072 (2008).
Article ADS PubMed PubMed Central Google Scholar
Onimaru, H., Ikeda, K. & Kawakami, K. CO2-sensitive preinspiratory neurons of the parafacial respiratory group express Phox2b in the neonatal rat. J Neurosci 28, 12845–12850 (2008).
Article PubMed CAS Google Scholar
Gray, P. A., Rekling, J. C., Bocchiaro, C. M. & Feldman, J. L. Modulation of respiratory frequency by peptidergic input to rhythmogenic neurons in the preBotzinger complex. Science (New York, N.Y 286, 1566–1568 (1999).
Article CAS Google Scholar
Smith, J. C., Ellenberger, H. H., Ballanyi, K., Richter, D. W. & Feldman, J. L. Pre-Botzinger complex: a brainstem region that may generate respiratory rhythm in mammals. Science (New York, N.Y 254, 726–729 (1991).
Article ADS CAS Google Scholar
Brunjes, P. C. The mouse olfactory peduncle. 2.The anterior limb of the anterior commissure. Frontiers in neuroanatomy 6, 51 (2012).
PubMed Google Scholar
Ohnuma, K., Imaizumi, K., Masuno, M., Nakamura, M. & Kuroki, Y. Magnetic resonance imaging abnormalities of the brain in Goldberg-Shprintzen syndrome (Hirschsprung disease, microcephaly, and iris coloboma). Am J Med Genet 73, 230–232 (1997).
Article PubMed CAS Google Scholar
Schuchardt, A., D’Agati, V., Larsson-Blomberg, L., Costantini, F. & Pachnis, V. RET-deficient mice: an animal model for Hirschsprung’s disease and renal agenesis. Journal of internal medicine 238, 327–332 (1995).
Article PubMed CAS Google Scholar
Uesaka, T., Nagashimada, M., Yonemura, S. & Enomoto, H. Diminished Ret expression compromises neuronal survival in the colon and causes intestinal aganglionosis in mice. The Journal of clinical investigation 118, 1890–1898 (2008).
Article PubMed PubMed Central CAS Google Scholar
Ratcliffe, E. M. et al. Netrin/DCC-mediated attraction of vagal sensory axons to the fetal mouse gut. The Journal of comparative neurology 498, 567–580 (2006).
Article PubMed CAS Google Scholar
Goldberg, D. et al. Slit/Robo-mediated chemorepulsion of vagal sensory axons in the fetal gut. Dev Dyn 242, 9–15 (2013).
Article PubMed CAS Google Scholar
Murphy, M. C. & Fox, E. A. Mice deficient in brain-derived neurotrophic factor have altered development of gastric vagal sensory innervation. The Journal of comparative neurology 518, 2934–2951 (2010).
Article PubMed PubMed Central CAS Google Scholar
Calmont, A., Thapar, N., Scambler, P. J. & Burns, A. J. Absence of the vagus nerve in the stomach of Tbx1−/− mutant mice. Neurogastroenterol Motil 23, 125–130 (2011).
Article PubMed CAS Google Scholar
Honma, Y. et al. Artemin is a vascular-derived neurotropic factor for developing sympathetic neurons. Neuron 35, 267–282 (2002).
Article PubMed CAS Google Scholar
Glebova, N. O. & Ginty, D. D. Heterogeneous requirement of NGF for sympathetic target innervation in vivo. J Neurosci 24, 743–751 (2004).
Article PubMed CAS Google Scholar
Brunet, I. et al. Netrin-1 controls sympathetic arterial innervation. The Journal of clinical investigation 124, 3230–3240 (2014).
Article PubMed PubMed Central CAS Google Scholar
Uesaka, T., Young, H. M., Pachnis, V. & Enomoto, H. Development of the intrinsic and extrinsic innervation of the gut. Developmental biology 417, 158–167 (2016).
Article PubMed CAS Google Scholar
Dyachuk, V. et al. Neurodevelopment. Parasympathetic neurons originate from nerve-associated peripheral glial progenitors. Science (New York, N.Y 345, 82–87 (2014).
Article ADS CAS Google Scholar
Espinosa-Medina, I. et al. Neurodevelopment. Parasympathetic ganglia derive from Schwann cell precursors. Science (New York, N.Y 345, 87–90 (2014).
Article ADS CAS Google Scholar
Espinosa-Medina, I. et al. Dual origin of enteric neurons in vagal Schwann cell precursors and the sympathetic neural crest. Proceedings of the National Academy of Sciences of the United States of America 114, 11980–11985 (2017).
Article PubMed PubMed Central CAS Google Scholar
Uesaka, T., Nagashimada, M. & Enomoto, H. Neuronal Differentiation in Schwann Cell Lineage Underlies Postnatal Neurogenesis in the Enteric Nervous System. J Neurosci 35, 9879–9888 (2015).
Article PubMed CAS Google Scholar
Furlan, A. et al. Multipotent peripheral glial cells generate neuroendocrine cells of the adrenal medulla. Science (New York, N.Y 357 (2017).
Hirokawa, N. & Noda, Y. Intracellular transport and kinesin superfamily proteins, KIFs: structure, function, and dynamics. Physiological reviews 88, 1089–1118 (2008).
Article PubMed CAS Google Scholar
Kubin, L., Alheid, G. F., Zuperku, E. J. & McCrimmon, D. R. Central pathways of pulmonary and lower airway vagal afferents. J Appl Physiol (1985) 101, 618–627 (2006).
Article Google Scholar
Dutschmann, M., Morschel, M., Rybak, I. A. & Dick, T. E. Learning to breathe: control of the inspiratory-expiratory phase transition shifts from sensory- to central-dominated during postnatal development in rats. The Journal of physiology 587, 4931–4948 (2009).
Article PubMed PubMed Central CAS Google Scholar
Wong, K. A. et al. Pulmonary vagal innervation is required to establish adequate alveolar ventilation in the newborn lamb. J Appl Physiol (1985) 85, 849–859 (1998).
Article CAS Google Scholar
Rao, M. & Gershon, M. D. The bowel and beyond: the enteric nervous system in neurological disorders. Nat Rev Gastroenterol Hepatol 13, 517–528 (2016).
Article PubMed PubMed Central CAS Google Scholar

Download references

Acknowledgements

This work was supported by NHMRC Australia Project Grant 1047953 to HMY and SMcK. We thank Robert Hofstra and Maria Alves for the KIF1BP antisera, Hideki Enomoto for the PHOX2B antisera, Vanda Lennon for the HuC/D antisera and Piers Emson for the nNOS antisera.

Author information

Caroline S. Hirst and Lincon A. Stamp contributed equally to this work.

Authors and Affiliations

Department of Anatomy and Neuroscience, The University of Melbourne, Victoria, 3010, Australia
Caroline S. Hirst, Lincon A. Stamp, Annette J. Bergner, Marlene M. Hao, Mai X. Tran, Jan M. Morgan, Sonja J. McKeown & Heather M. Young
Florey Institute of Neuroscience and Mental Health, The University of Melbourne, Victoria, 3010, Australia
Matthias Dutschmann
Department of Physiology, The University of Melbourne, Victoria, 3010, Australia
Andrew M. Allen
Neuroscience Research Australia and School of Medical Sciences, The University of New South Wales, 2031, NSW, Australia
George Paxinos & Teri M. Furlong
Cancer Program, Monash Biomedicine Discovery Institute and Department of Anatomy and Developmental Biology, Monash University, Victoria, 3800, Australia
Sonja J. McKeown

Authors

Caroline S. Hirst
View author publications
You can also search for this author in PubMed Google Scholar
Lincon A. Stamp
View author publications
You can also search for this author in PubMed Google Scholar
Annette J. Bergner
View author publications
You can also search for this author in PubMed Google Scholar
Marlene M. Hao
View author publications
You can also search for this author in PubMed Google Scholar
Mai X. Tran
View author publications
You can also search for this author in PubMed Google Scholar
Jan M. Morgan
View author publications
You can also search for this author in PubMed Google Scholar
Matthias Dutschmann
View author publications
You can also search for this author in PubMed Google Scholar
Andrew M. Allen
View author publications
You can also search for this author in PubMed Google Scholar
George Paxinos
View author publications
You can also search for this author in PubMed Google Scholar
Teri M. Furlong
View author publications
You can also search for this author in PubMed Google Scholar
Sonja J. McKeown
View author publications
You can also search for this author in PubMed Google Scholar
Heather M. Young
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conception: H.M.Y., S.McK. Data acquisition: C.S.H., L.A.S., A.J.B., M.X.T., J.M.M., S.McK., H.M.Y. Data analysis and interpretation: C.S.H., A.J.B., M.M.H., M.D., A.M.A., G.P., T.M.F., S.McK., H.M.Y. Manuscript writing: H.M.Y., S.McK. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Sonja J. McKeown or Heather M. Young.

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Supplementary information

video of newborn Kif1bp mice

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Hirst, C.S., Stamp, L.A., Bergner, A.J. et al. Kif1bp loss in mice leads to defects in the peripheral and central nervous system and perinatal death. Sci Rep 7, 16676 (2017). https://doi.org/10.1038/s41598-017-16965-3

Download citation

Received: 02 October 2017
Accepted: 19 November 2017
Published: 30 November 2017
DOI: https://doi.org/10.1038/s41598-017-16965-3

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.