Table 2 PCR primer sequences.

From: Towards the cell-instructive bactericidal substrate: exploring the combination of nanotopographical features and integrin selective synthetic ligands

Target Gene Forward Sequence Reverse Sequence
GAPDH GTCAGTGGTGGACCTGACCT ACCTGGTGCTCAGTGTAGCC
OPN AGCTGGATGACCAGAGTGCT TGAAATTCATGGCTGTGGAA
OCN CAGCGAGGTAGTGAAGAGACC TCTGGAGTTTATTTGGGAGCAG