Scientific Reports 7:12636; doi:10.1038/s41598-017-13049-0; Article published online 03 October 2017
The original HTML version of this Article contained errors in Table 1, where text was inadvertently inserted on three occasions.
For the Target gene ‘CP hairpin sense strand’ with Primer name ‘CP-RNAi-P2’, the Primer sequence (5′-3′) incorrectly read “GAcomment=” Underline the selected text “AGATCTYCACGAGCCCTATCAGGTGTCTTT Bgl II” and now reads “GAAGATCTYCACGAGCCCTATCAGGTGTCTTT Bgl II”.
For the Target gene ‘CP hairpin reverse strand’ with Primer name ‘CP-RNAi-P3’, the Primer sequence (5′-3′) incorrectly read “GCcomment=” Underline the selected text “comment=” Underline the selected text “GTCGACTCAACGCCGGAACTAGTGGAACTT Sal I” and now reads “GCGTCGACTCAACGCCGGAACTAGTGGAACTT Sal I”.
For the Target gene ‘CP hairpin reverse strand’ with Primer name ‘CP-RNAi-P4’, the Primer sequence (5′-3′) incorrectly read “CGcomment =” Underline the selected text “comment =” the selected text“comment =” Underline the selected text “GGATCCTCACGAGCCCTATCAGGTGTCTTT BamH I” and now reads “CGGGATCCTCACGAGCCCTATCAGGTGTCTTT BamH I”.
These errors have been corrected in the HTML version of the Article; the PDF version was correct from the time of publication.
Author information
Authors and Affiliations
Corresponding authors
Additional information
The original article can be found online at ..https://doi.org/10.1038/s41598-017-13049-0.
The original article can be found online at https://doi.org/10.1038/s41598-017-13049-0.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Jia, R., Zhao, H., Huang, J. et al. Publisher Correction: Use of RNAi technology to develop a PRSV-resistant transgenic papaya. Sci Rep 7, 16390 (2017). https://doi.org/10.1038/s41598-017-16198-4
Published:
DOI: https://doi.org/10.1038/s41598-017-16198-4
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.