Publisher Correction | Open | Published:

Publisher Correction: Use of RNAi technology to develop a PRSV-resistant transgenic papaya

Scientific Reportsvolume 7, Article number: 16390 (2017) | Download Citation

Subjects

Scientific Reports 7:12636; doi:10.1038/s41598-017-13049-0; Article published online 03 October 2017

The original HTML version of this Article contained errors in Table 1, where text was inadvertently inserted on three occasions.

For the Target gene ‘CP hairpin sense strand’ with Primer name ‘CP-RNAi-P2’, the Primer sequence (5′-3′) incorrectly read “GAcomment=” Underline the selected text “AGATCTYCACGAGCCCTATCAGGTGTCTTT Bgl II” and now reads “GAAGATCTYCACGAGCCCTATCAGGTGTCTTT Bgl II”.

For the Target gene ‘CP hairpin reverse strand’ with Primer name ‘CP-RNAi-P3’, the Primer sequence (5′-3′) incorrectly read “GCcomment=” Underline the selected text “comment=” Underline the selected text “GTCGACTCAACGCCGGAACTAGTGGAACTT Sal I” and now reads “GCGTCGACTCAACGCCGGAACTAGTGGAACTT Sal I”.

For the Target gene ‘CP hairpin reverse strand’ with Primer name ‘CP-RNAi-P4’, the Primer sequence (5′-3′) incorrectly read “CGcomment =” Underline the selected text “comment =” the selected text“comment =” Underline the selected text “GGATCCTCACGAGCCCTATCAGGTGTCTTT BamH I” and now reads “CGGGATCCTCACGAGCCCTATCAGGTGTCTTT BamH I”.

These errors have been corrected in the HTML version of the Article; the PDF version was correct from the time of publication.

Author information

Author notes

  1. Ruizong Jia, Hui Zhao and Jing Huang contributed equally to this work.

Affiliations

  1. Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agriculture Sciences, 571101, Haikou, Hainan, China

    • Ruizong Jia
    • , Hui Zhao
    • , Jing Huang
    • , Hua Kong
    • , Yuliang Zhang
    • , Jingyuan Guo
    • , Qixing Huang
    • , Yunling Guo
    • , Qing Wei
    • , Jiao Zuo
    • , Yun J. Zhu
    • , Ming Peng
    •  & Anping Guo
  2. Hawaii Agriculture Research Center, 96797, Waipahu, HI, USA

    • Ruizong Jia
    •  & Yun J. Zhu
  3. School of Basic and Life Science, Hainan Medical University, Haikou, 571199, Hainan, China

    • Jing Huang
  4. Institute of Banana and Plantain, Haikou Substation, Chinese Academy of Tropical Agriculture Sciences, 570102, Haikou, Hainan, China

    • Qing Wei

Authors

  1. Search for Ruizong Jia in:

  2. Search for Hui Zhao in:

  3. Search for Jing Huang in:

  4. Search for Hua Kong in:

  5. Search for Yuliang Zhang in:

  6. Search for Jingyuan Guo in:

  7. Search for Qixing Huang in:

  8. Search for Yunling Guo in:

  9. Search for Qing Wei in:

  10. Search for Jiao Zuo in:

  11. Search for Yun J. Zhu in:

  12. Search for Ming Peng in:

  13. Search for Anping Guo in:

Corresponding authors

Correspondence to Yun J. Zhu or Ming Peng or Anping Guo.

About this article

Publication history

Published

DOI

https://doi.org/10.1038/s41598-017-16198-4

Article notes

Ruizong Jia, Hui Zhao and Jing Huang contributed equally to this work.

Article notes

The original article can be found online at ..https://doi.org/10.1038/s41598-017-13049-0.

Article notes

The original article can be found online at https://doi.org/10.1038/s41598-017-13049-0.

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.