Analysis of the CRISPR-Cas system in bacteriophages active on epidemic strains of Vibrio cholerae in Bangladesh


CRISPR-Cas (clustered regularly interspersed short palindromic repeats-CRISPR-associated proteins) are microbial nuclease systems involved in defense against phages. Bacteria also resist phages by hosting phage-inducible chromosomal islands (PICI) which prevent phage reproduction. Vibrio cholerae which causes cholera epidemics, interacts with numerous phages in the environment and in cholera patients. Although CRISPR-Cas systems are usually carried by bacteria and archea, recently V. cholerae specific ICP1 phages were found to host a CRISPR-Cas system that inactivates PICI-like elements (PLE) in V. cholerae. We analyzed a collection of phages and V. cholerae isolated during seasonal cholera epidemics in Bangladesh, to study the distribution, and recent evolution of the phage-encoded CRISPR-Cas system. Five distinct but related phages carrying the CRISPR-Cas system, and possible CRISPR-Cas negative progenitor phages were identified. Furthermore, CRISPR arrays in the phages were found to have evolved by acquisition of new spacers targeting diverse regions of PLEs carried by the V. cholerae strains, enabling the phages to efficiently grow on PLE positive strains. Our results demonstrate a continuing arms-race involving genetic determinants of phage-resistance in V. cholerae, and the phage-encoded CRISPR-Cas system in the co-evolution of V. cholerae and its phages, presumably fostered by their enhanced interactions during seasonal epidemics of cholera.


Bacteriophages contribute to the evolution of their host bacteria in a variety of ways including promotion of genetic diversity by horizontal transfer of genes, and by providing a selective pressure for better fitness of the bacteria1,2. Vibrio cholerae the causative agent of cholera epidemics interacts with numerous phages in the aquatic ecosystem, and in the intestine of cholera patients. Seasonal epidemics of cholera reportedly collapse due to predation of the pathogen by phages1,3,4. Interactions of phage and bacteria may lead to the evolution of numerous phage resistance machineries and mechanisms in bacteria such as blocking of adsorption, abortive infection system, restriction modification system, and the CRISPR-Cas (clustered regularly interspersed short palindromic repeats-CRISPR-associated proteins) system5,6,7. On the other hand, phages also evolve and occasionally effectively bypass these antiviral strategies of bacteria6,8.

CRISPR-Cas loci in microbial hosts contain a combination of CRISPR-associated (cas) nuclease genes as well as genes for non-coding RNA elements capable of programming the specificity of the CRISPR-mediated nucleic acid cleavage9,10. A CRISPR array consists of short direct repeats separated by different short sequences called spacers. To allow nucleic acid cleavage by the associated Cas nuclease, the non-coding CRISPR array is transcribed and cleaved within direct repeats into short crRNAs containing individual spacer sequences. The crRNAs then direct Cas nucleases to the target site (protospacer) which has a sequence complementary to the spacer sequence of the crRNA, and the Cas protein complex degrades the foreign genome in the interference stage11,12,13.

Another way for bacteria to defend against phage infection is by hosting a chromosomal island called phage-inducible chromosomal island (PICI), which being excised from the bacterial chromosome upon phage infection, circularizes, replicates and interferes with phage reproduction14,15. The Staphylococcus aureus pathogenicity islands (SaPIs), which carry and spread critical virulence genes represent well studied examples of PICIs14,16. Upon infection by specific helper phages, SaPIs are induced to excise from the bacterial chromosome, replicate, and package themselves to produce mature phage particles containing SaPI DNA instead of the phage genome, restricting the reproduction of the invading phage17. Therefore, following lysis of the infected cell, SaPIs are spread to neighboring cells instead of the helper phage genome. Several strategies used by SaPIs interfere with recognition of the phage genome and its packaging into the phage capsid, and instead promote their own packaging and propagation using the helper phage. These include remodeling the phage capsid proteins to generate small capsids that can accommodate the smaller SaPI DNA and leave out the larger helper phage genome16. The SaPIs may encode proteins that interfere with phage packaging by blocking the small subunit of phage terminase, and instead allowing the small subunit of SaPI terminase to bind the phage-encoded large subunit to cleave SaPI DNA for packaging16. Another interference mechanism involves interrupting phage late gene activation, which is essential for phage packaging and cell lysis17.

Vibrio cholerae strains have been found to carry PICI-like elements (PLE) that can resist virulent phages6,18. PLE activity was shown to reduce phage genome replication and accelerate cell lysis following infection by ICP1 phages, thus killing infected cells and preventing the production of progeny phage. PLEs were also found to be mobilized by ICP1 infection and spread to neighboring cells18.

Strains of the classical biotype of V. cholerae O1 have been found to carry a CRISPR-Cas system6,19,20, which belongs to the previously described type I-E subtype21. However, all available genomic sequence data reveal the absence of CRISPR-Cas system in El Tor biotype strains6. On the other hand PLEs that respond to infection by ICP1 phages are widespread among V. cholerae, and consequently PLE mediated inhibition of phage replication is likely to be prominent in V. cholerae O1 of the El Tor biotype18. Although CRISPR-Cas systems are usually carried by bacteria or archea, recently V. cholerae specific ICP1 phages have been shown to carry a CRISPR-Cas system6. Most of the spacer sequences of the CRISPR arrays carried by these phages show 100% sequence identity with different regions of the 18-kb PLE carried by some V. cholerae O1 El Tor biotype strains6. Consequently, the phage encoded CRISPR-Cas system can inactivate the function of PLEs in interfering with phage-reproduction in these strains. The occurrence of a CRISPR-Cas system in cholera phages represents a remarkable event in microbial arms-race and thus warrants further studies to better understand the distribution and evolution of the phage encoded CRISPR-Cas system, and co-evolution of V. cholerae. Besides, this knowledge would have significance in developing potential phage mediated interventions to control cholera or other bacterial infections.


Distribution of CRISPR-Cas system in the phages

V. cholerae specific phages isolated from environmental waters or stools of cholera patients in Dhaka Bangladesh were initially differentiated based on their host range, and RFLP patterns of their DNA1,3. Twenty nine representative phages which were isolated during January 2001 to November 2015, were subjected to whole genome sequencing. Analysis of the genomic sequences for the occurrence and organization of the CRISPR-Cas loci revealed the presence of CRISPR-Cas related sequences in 5 of the 29 phages (17.2%). These 5 phages were related but also had notable differences in their genomic sequence (Fig. 1). We also identified CRISPR-Cas negative phages with otherwise similar genomic sequence to that of the CRISPR-Cas positive phages except for the presence of the CRISPR-Cas loci (Fig. 1), suggesting that the CRISPR-Cas negative phages could possibly be progenitors of the CRISPR-Cas positive phages. On the other hand, since phages also evolve by mosaicism, there may not be any direct progenitor. The genomic sequence of the CRISPR-Cas positive phages excluding the CRISPR-Cas region was between 84% and 99% identical to the whole genome sequences of 9 CRISPR-Cas negative phages (see Supplementary Table S1). The phylogenetic relatedness based on the sequence of the 7 CRISPR-Cas positive phages and 9 CRISPR-Cas negative phages are presented in Fig. 2.

Figure 1

Alignment of the genomic sequences of representative CRISPR-Cas positive and CRISPR-Cas negative phages using a multiple genome alignment software, BRIG37. Inside each genomic sequence (shown with colored circles), regions that are absent are shown in white. CRISPR-Cas systems are indicated with a black rectangle. Phages JSF1, JSF2, and JSF4 are CRISPR-Cas negative, but have closely similar genomic sequence to the CRISPR-Cas positive phages (JSF5, JSF6, JSF13, JSF14, JSF17).

Figure 2

Dendrogram representing phylogenomic relatedness based on nucleotide similarity of whole genomes of 7 CRISPR-Cas positive phages (JSF5, JSF6, JSF13, JSF14, JSF17, ICP1 2004_A and ICP1 2005_A) denoted with an asterisk, and 9 CRISPR-Cas negative phages (JSF1, JSF2, JSF4, ICP1, ICP1 2001_A, ICP1 2006_A, ICP1 2006_B, ICP1 2006_C, and ICP1 2006_D).

Diversity of spacers in the CRISPR arrays carried by the phages

The overall structure of the CRISPR-Cas loci in the five representative CRISPR-Cas positive phages resembled that of previously reported ICP1 phages6, with two CRISPR loci (CR1 and CR2) and 6 cas genes (Fig. 3). However, there were differences in the sequences, as well as in number of spacers in the CRISPR array carried by various phages analyzed in the present study. Each of the phages designated JSF5 and JSF6 carried a total of 8 spacers spanning the two CRISPR loci, of which 7 spacers were reported previously in CRISPR carried by ICP1 phages6. Although the CRISPR arrays in JSF5 and JSF6 phages were identical, their entire CRISPR-Cas regions were not identical (Fig. 1). Each of JSF13 and JSF14 carried a total of 7 spacers (Fig. 3), but the CRISPR array of JSF13 and JSF14 differed in the sequence of one of the spacers. Three of the spacers of JSF13, and 2 spacers of JSF14 were identical to spacers of ICP1 phages6. JSF17 was found to carry a total of 11 spacers and 4 of these were identical to spacers of ICP1 phages. Therefore, 16 of the 33 different spacers identified in the 5 phages were identical to spacers carried by the CRISPR-Cas positive ICP1 phages, whereas the remaining 17 spacers were new. Sequences of most of the spacers in the CRISPR arrays carried by the phages were identical to diverse regions (protospacers) of the two PLEs carried by V. cholerae strains (Figs 3 and 4) analyzed in our study. We also identified 3 spacers with the corresponding protospacers located in PLE3 reported recently18. Notably, all identified protospacers in the PLEs were found to be located within ORFs, and not in intergenic regions. The putative proteins encoded by some of these ORFs found by BLAST or domain analysis are presented in Table S2 (see Supplementary Table S2). Protospacer-adjacent motifs (PAMs) which are short conserved motifs that are present in immediate vicinity of the protospacers were identical to that of previously reported ICP1 phages6. Instead of GG PAM present in type I-F CRISPR/Cas system in bacteria13 the PAM sequence motifs of the JSF phages analyzed in our study were GA. Sequences of the spacers in the CRISPR arrays and their identity with other DNA are presented in Table 1.

Figure 3

Structure of CRISPR-Cas system carried by phages JSF5, JSF6, JSF13, JSF14, JSF17, and ICP1_2005_A showing the diversity and arrangement of the spacers. The repeat (28 bp) and spacer (32 bp) are shown as green diamonds, and red rectangles respectively. An AT-rich leader sequence precedes each CRISPR locus (black rectangle). Spacers are marked with vertical, horizontal or no lines to show their 100% identity.

Figure 4

Genomic organization of PLE and protospacer targets of CRISPR-Cas carried by various JSF phages. PLE 1 and PLE 2 consists of 25 and 28 ORFs respectively. Unique ORFs of PLE1 and PLE2 are represented in cyan and fire brick colors respectively. ORFs of PLE1 and the corresponding ORFs of PLE2 that share similar sequences are shown in blue color. The genomic regions of PLE corresponding to spacers of different JSF phages are shown using different colors as indicated.

Table 1 Sequence of spacers in the CRISPR array carried by different phages.

Distribution of PLE in V. cholerae O1 strains

A total of 163 V. cholerae O1 El Tor biotype strains isolated during 2001 to 2015 were initially screened for the presence of PLE 1 and PLE2 related sequences using PCR assays. All V. cholerae isolated during 2001 to 2004 were found to be negative for these PLEs. Chronologically, Presence of PLE was first detected in V. cholerae O1 El Tor strains isolated in 2005. Thereafter, the proportion of strains carrying PLE steadily increased, and all isolates of El Tor V. cholerae O1 since 2012 were found to carry PLE. Ten representative PLE positive V. cholerae O1 isolates were subjected to whole genome sequencing, and the sequence of their PLE were compared. Each PLE positive strain carried either one or the other of the two PLE types (see Supplementary Table S3). The sequences of PLE1 and PLE2 were found to be identical to previously published sequences for these two PLEs respectively18. Accordingly, PLE1 and PLE2 contained respectively 25 and 28 ORFs, and 17 of these were shared by both PLE1 and PLE2 (Fig. 4). A putative integrase homologue6 was encoded by ORF1 in PLE1 and by ORF2 in PLE2. The GC content of PLE1 and PLE2 were 38.3 and 38.6 respectively, which were lower than that of the host V. cholerae (47.5%).

Temporal changes in phage-susceptibility of V. cholerae O1 El Tor strains

We analyzed the susceptibility of a chronological collection of V. cholerae O1 El Tor biotype strains isolated during different cholera epidemics in Bangladesh from 2001 through 2015 to 8 different phages. Five of these phages carried the CRISPR-Cas system whereas 3 were CRISPR-Cas negative, but otherwise similar in genomic sequence to the CRISPR-Cas positive phages (Fig. 1). Further details on these and other phages are available in Table S4 (see Supplementary Table S4). This analysis was done to understand possible effect of the emerging diversity in phage-encoded CRISPR-Cas structures on the susceptibility of V. cholerae strains with or without harboring the PLE. All V. cholerae strains isolated during 2001 to 2004 were negative for PLE, and were susceptible to all 8 phages (Fig. 5). Thus the CRISPR-Cas negative phages i.e., JSF1, JSF2, and JSF4 formed clear plaques at high efficiency on the PLE negative V. cholerae strains isolated during 2001 to 2004. However, with the emergence of PLE2 positive V. cholerae isolates, the susceptibility of V. cholerae to the CRISPR-Cas negative phages diminished (see Supplementary Table S3). On the other hand, as expected CRISPR-Cas positive phages represented by JSF5 and JSF6 were able to infect and form plaques on all V. cholerae isolates from 2001 through 2007 including those that carried PLE2 and were resistant to the CRISPR-Cas negative phages. Similarly JSF13 and JSF14 with more and diverse spacers in the CRISPR array could plaque on most V. cholerae isolated during 2001 to 2011 including the post-2008 isolates which were positive for PLE1 and were resistant to JSF5 and JSF6 phages. With highest number of spacers in the CRISPR array, JSF17 phage infected and formed plaques on all V. cholerae O1 El Tor isolates of 2001 through 2015 included in the study (Fig. 5; see Supplementary Table S3). Notably, JSF17 continued to be one of the most prevalent phages from 2013 through 2015.

Figure 5

Co-evolution of V. cholerae O1 and their phages in the PLE versus CRISPR-Cas mediated arms’ race. Heat chart showing the susceptibility of a chronological collection of V. cholerae O1 isolated during seasonal epidemics of cholera during 2001 through 2015 in Bangladesh to 7 different phages. Phages shown with asterisk are positive for the CRISPR-Cas system.

Phage susceptibility of V. cholerae and CRISPR-Cas target sites in the PLEs

We compared the sequence of PLEs carried by various V. cholerae strains and identified sequences which matched the spacer sequences in the CRISPR array carried by different phages, in an attempt to explain the observed phage-susceptibility patterns of the V. cholerae strains. In this analysis, we identified multiple regions in both PLE1 and PLE2 that would be potentially targeted by the CRISPR-Cas system of different phages based on the sequence of the spacers (Fig. 4). In all of these instances the PLEs were targeted within one or more ORFs and not in intergenic regions. Phages JSF5 and JSF6 carried spacers which matched with 3 different loci within two ORFs in PLE1; 2 of these 3 loci were also shared by PLE2. Spacer sequences of JSF13 phage correspond to sequences within 5 different ORFs of PLE2 and one ORF of PLE1. Phage JSF14 carried spacers corresponding to sequences located within 4 different ORFs of PLE2 and 2 ORFs of PLE1, whereas JSF17 phage carried spacers matching sequences within 4 different ORFs of PLE2 and 3 ORFs of PLE1. Notably, there have been a temporal increase in number of ORFs of the two PLEs that were targeted by the CRISPR-Cas system carried by different phages. Apparently, this also increased susceptibility of the PLE positive V. cholerae strains to phages carrying increasing number of spacers targeting the PLEs. Presumably, targeting multiple protospacers in PLEs might have increased the chance of cleaving the PLE DNA and thus more efficiently diminish the function of PLEs. A semi- quantitative estimate of phage susceptibility of various V. cholerae strains based on plaques formed by different phages are presented in Table S3 (see Supplementary Table S3).

Presence of CRISPR-Cas system in V. cholerae non-O1 non-O139 strains

The presence of CRISPR-Cas system has not yet been detected in the El Tor biotype strains of V. cholerae, although classical strains of V. cholerae have been reported to carry a CRISPR-Cas system belonging to the I-E subtype6,19,20. The CRISPR-Cas found in the classical strains thus belong to a different type than that of the cholera phages, which carry a CRISPR-Cas system belonging to subtype I-F6,21. We screened a collection of V. cholerae non-O1-non-O139 strains for the presence of CRISPR-Cas loci. Of 20 randomly sequenced V. cholerae non-O1 non-O139 strains, 8 were found to be CRISPR-Cas positive. However, there were wide differences in the nucleotide sequence of different cas genes carried by the V. cholerae non-O1 non-O139 strains and corresponding genes carried by the phages. Primers for cas1 and cas3 genes derived from the sequence of the non-O1 non-O139 strains were used in PCR analysis of a further 45 V. cholerae non-O1 non-O139 isolates, and 23 of these were found to be positive. This data suggested that the occurrence of the CRISPR-Cas system is common among non-O1 non-O139 V. cholerae. Unlike the phages the CRISPR-Cas locus in V. cholerae non-O1 non-O139 strains were found to have the features of a genomic island (Fig. 6) as described previously22,23.

Figure 6

Schematic diagram showing the organization of the CRISPR-Cas loci carried by different cholera phages and V. cholerae strains. Cas genes are shown with colored arrows whereas black rectangles represent the CRISPR locus. The CRISPR-Cas in V. cholerae non-O1 non-O139 strains are located in a putative transmissible element adjacent to genes for a type VI secretion system. The integrase gene and the attachment sites attL and attR are also shown.

The CRISPR-Cas region in 7 of 8 CRISPR-Cas positive non-O1 non-O139 strains sequenced in our study were found to be identical with that of strain HC-36A1 described previously23. However, comparisons of the entire sequence of the islands in our strains with those of previously described CRISPR-Cas containing genomic islands of strains S12, RC385, RC586 TM 11079-80, and HC-36A122,23, showed that the islands found in 3 of our strains were > 95% identical to that found in strain HC-36A123, whereas the islands in 4 of the strains were 70–74% identical to that in strain HC-36A1. The cas genes in one of our strains 173V1015 were found to share no sequence homology with that of the other islands analyzed, although the predicted protein sequence show more than 82% identity with Cas proteins of Salinivibrio costicola (Accession no. OOF32727.1, WP_077670175.1) and Vibrio cholerae (Accession no. WP_088136878.1, WP_088136879.1, WP_088136862.1), with quarry coverage ranging from 74% to 100%. In all the islands analyzed, Integrase, CRISPR-array and Type VI secretion system genes were found to be conserved with > 95% identity.


In the present study we conducted genomic analysis of representative phages and V. cholerae strains collected during cholera epidemics in Bangladesh to monitor the distribution and emerging diversity of the CRISPR-Cas system carried by the phages, in view of recurring and extensive phage-bacterial interactions during seasonal epidemics of cholera1,3. The unique ecology and socio-economic setting in Bangladesh fostering seasonal cholera outbreaks also provide an opportunity to test predictions into the emergence, co-evolution and diversity of genetic elements involved in the “arms-race” among V. cholerae and their phages under natural conditions. The CRISPR-Cas system has been described as a microbial adaptive immune system in that the system extends its range of targets by continually acquiring new spacers matching protospacer regions in the invading nucleic acids. The remarkable evolutionary success of the CRISPR-Cas positive phages in countering the PLE mediated defense of V. cholerae is thus expected to be sustained by further diversification of the CRISPR arrays in terms of number and variety of their spacers.

The nucleotide sequences of the spacers in a CRISPR array carried by the phages should be identical to a region (protospacer) in the target PLE responsible for interfering with reproduction of the invading phage, in order to recognize, and subsequently inactivate the function of the anti-phage system in the bacteria. The genomes of these phages carry a cluster of six cas genes and two CRISPR loci, identified as a CRISPR-Cas subtype I-F system21. A number of spacers in these CRISPR arrays are identical to sequences within the PLE resident in the V. cholerae host genome (Fig. 4, and Table 1). Our results further showed that the number of spacers matching the PLEs has progressively increased in phages isolated in different years. Moreover, phages with increased number of spacers were able to form more plaques on PLE positive V. cholerae strains (see supplementary Table S3). These findings suggest that having more than one spacer targeting the PLE provides increased fitness to the phage in surviving PLE mediated elimination. Since the phages included in this study were isolated during seasonal epidemics of cholera in Bangladesh, these results provide important evidence in support of the adaptive immunity developed by phages through their resident CRISPR-Cas system under natural conditions of phage bacterial interactions, during seasonal cholera epidemics.

Upon infection by ICP1 related phages, the mechanism used by PLEs to resist predation presumably involve excision from the bacterial chromosome, replication, and packaging of PLE DNA into the phage heads, resembling the mechanisms used by Staphylococcus aureus pathogenicity islands (SaPIs)16,17,18. Interestingly, we found that all spacers in the phage-encoded CRISPR arrays target various ORFs of the PLE, and not the intergenic regions. While most of these ORFs encode hypothetical proteins of unknown function, we propose that one or more of these gene products may influence the process that restricts phage replication and involves spread of the PLEs instead of the phage genome through heterologous packaging. However, functional studies involving deletion of these target ORFs of PLE would be required to verify this assumption.

V. cholerae specific phages encoding their own functional CRISPR-Cas system to neutralize a bacterial defense mechanism against phages has been discovered recently6, but the origin of the CRISPR-Cas system carried by the phages remains unknown. Mechanisms such as genome rearrangements, and genomic exchange with other viral or microbial genomes to acquire new traits allow phages to evolve rapidly, facilitated by their genomic plasticity and fast multiplication rates. However, the CRISPR-Cas systems carried by V. cholerae O1 classical biotype strains or V. cholerae non-O1 non-O139 strains, were found to differ widely from that carried by the phages (Fig. 6). Moreover, the CRISPR-Cas carried by the V. cholerae non-O1 non-O139 strains were found to be located in a chromosomal island which also carry genes for the Type VI secretion system, as described previously22,23. The marked difference at the nucleotide level and absence of features associated with horizontal transfer, suggest that its highly unlikely that the phage encoded CRISPR-Cas was derived from that found in the V. cholerae non-O1 non-O139 strains. Thus the origin of the CRISPR-Cas locus in cholera phages remains to be identified.

The use of phages as bio-control agents in the environment or in potential phage therapy in patients requires a more clear understanding of the mechanisms causing selection of phage resistant bacteria and the co-evolution of bacteria and phages. The interactions between epidemic strains of V. cholerae and their lytic phages is known to modulate seasonal epidemics of cholera1,3,4. In this process, V. cholerae undergo genetic modifications to escape phage predation, resulting in a heterogeneous mix of many unique mutants24. Thus predatory phages can shape microbial community structure during the natural course of self-limiting epidemics. The acquisition of a CRISPR-Cas system by phages and subsequent evolution of the system to counter bacterial PLE add additional challenges in phage mediated control of cholera. However, monitoring of the CRISPR-Cas arrays in phages, and the bacterial PLE allows to understand the genetic variability and phage-bacterial co-evolution. This knowledge may be useful in designing engineered phages targeting various regions of the bacterial anti-phage genomic determinants, in potential phage therapy or environmental interventions to control cholera.

In summary, we have demonstrated the emerging diversity of the CRISPR-Cas system in cholera phages by acquisition of new spacers to expand their ability to counter PLE-mediated phage defense of diverse V. cholerae strains. We also showed the presence of a CRISPR-Cas system in a number of V. cholerae non-O1 non-O139 strains. However, features of the CRISPR-Cas carried by the phages and that of the V. cholerae non-O1 non-O139 strains differ considerably, and hence do not support a direct relationship in terms of their origin. On the other hand, extensive phage-bacterial interactions during seasonal epidemic cycles of cholera might have contributed to rapid evolution of the CRISPR-Cas system in phages and deviate considerably from the original source. The antagonistic interaction between a genetic determinant of phage resistance in V. cholerae, and the evolving phage encoded CRISPR that neutralize the bacterial defense, represent a continuing arms’ contest that is occurring between V. cholerae and its phages. In addition to a better understanding of the evolution of CRISPR-Cas systems in phages, these results may have relevance in developing engineered phages and strategies for phage mediated control of cholera.

Materials and Methods

V. cholerae strains and Phages

Vibrio cholerae and phage strains were of environmental or clinical origin and were isolated during different seasonal epidemics of cholera in Bangladesh1,3,25,26. These phages were initially selected from numerous isolates based on a preliminary analysis of their DNA restriction patterns and host range1,25, and hence represented distinct groups. Phages were isolated from surface water samples in Dhaka city or stools collected anonymously from cholera victims reporting to the hospitals of the International Centre for Diarrhoeal Disease Research, Bangladesh (icddr,b). One or more of the indicator strains including G-3669 (El Tor), P-27457 (El Tor), AI 1852 (O139), and MO1220 (O139) were used as host bacteria for purification and amplification of different phages for the present study. Phages were stored in SM buffer (100 mM NaCl, 8.1 mM MgSO4, 0.05 mM Tris-Cl [pH 7.5], 0.01% gelatin) at 4 °C.

Plaque assay for detection and quantification of phages

The soft agar plaque assay27 was used to detect and estimate phage concentration in samples. Briefly, logarithmic-phase cells (500 µl) of a host bacterial strain in nutrient broth (Difco, Detroit, Mitch.) were mixed with 3.5 ml aliquots of soft agar (nutrient broth containing 0.8% Bactoagar, Difco), and the mixture was overlaid on nutrient agar plates. Samples tested for the presence of phages including aliquots of water, cholera stool supernatants, or bacterial culture supernatants, were pre-filtered through 0.22 μm pore size filters (Millipore Corporation, Bedford, MA) to make them bacteria-free, inoculated on the plates, and incubated for 16 h at 37 °C. A sample was scored positive for phages when a plaque was observed on the bacterial lawn in the plates. Plaques were counted to estimate the concentration of phage particles in the sample.

Phage production and testing host specificity

A single discrete phage plaque was purified three times by the soft agar (0.7%) overlay method27 with a susceptible V. cholerae strain. For growing the phage in liquid medium, an overnight culture of the host strain was diluted 1:100 in fresh nutrient broth and grown at 37 °C for 4 h. The culture was then inoculated with phages from a single plaque. The bacterium-phage culture was incubated at 37 °C for 16 h, when lysis of most of the bacteria occurred. The culture was centrifuged at 10,000 x g for 20 min, and the supernatant was filtered through a 0.22 μm pore size filter (Millipore). The number of phage particles in the filtered supernatant was determined by testing serial dilutions of the supernatant by the soft agar overlay method with the propagating strain. The host range for the phage was tested at a titer of 103 pfu/ml using a variety of bacterial strains. For a semi-quantitative comparison of susceptibility of different bacterial strains to particular phages, susceptibility was scored as −, +, + and +++, based on the number of plaques formed with an equal titer of phage particles used in the soft-agar assay.

Isolation and analysis of phage nucleic acids

For isolation and analysis of phage nucleic acids, culture supernatants containing phage particles were filtered through 0.22 μm pore-sized filters (Millipore). The filtrates were mixed with one-fourth volume of a solution containing 20% polyethylene glycol (PEG-6000) and 10% NaCl, and centrifuged at 12000 x g to precipitate phage particles. The precipitate was dissolved in a solution containing 20 mM Tris-Cl (pH 7.5), 60 mM Kcl, 10 mM MgCl, 10 mM NaCl, and digested with pancreatic DNAseI (100 units/ml) and RNAse A (50 μg/ml) at 37 °C for 2 hours. The solution was extracted with phenol-chloroform, and the total nucleic acids were precipitated with ethanol. Phage nucleic acids were suspended in deionized water and purified using the SV Minipreps DNA purification system (Promega Madison, USA). The phage nucleic acid was digested with restriction endonucleases (Invitrogen Corporation, Carlsbad, CA) and analyzed by agarose gel electrophoresis following standard procedures to initially check for diversity and select different phages for sequencing.

PCR Assays

Two different PCR assays were used for screening of V. cholerae strains for the presence of PLE and CRISPR-Cas related sequences. The sequence of primers used for PLE 1 were F-TGCTAGAAGCTGCCAAAGGT, and R-TTGTTGTCCAGCTTCCACTG, and those for PLE2 were F- CAACAGGAATTGCAAGCAGA, and R- CTCCAAACCTGCAAACCATT. Sequence of primers used for cas1 were F- GCT GGC TCT CAT TCT GGT T, and R- GCT GGC GAA ACT CTT GTT C, and those for cas3 were F-GCTAAACACCAGCACCACAA, and R- GCGACTTTTCATCCACCAAC. PCR amplification was performed using a Bio-Rad PCR machine, in a 25 ml reaction volume consisting of 12.5 µL Taq master mix, 0.5 µL forward primer, 0.5 µL reverse primer, 10 µL nuclease free water, 0.5 µLDMSO, and 1 µL template DNA. Thermocycle parameters for PLE PCR were 90 seconds at 95 °C for initial denaturation, followed by 35 cycles of 30 sec at 95 °C, 30 sec at 55 °C (primer annealing), and 90 sec at 72 °C; plus a final extension at 72 °C for 5 min. Thermocycle parameters for cas1 and cas3 PCR were same as above except that the annealing temperature used was 57 °C. Expected sizes of the PCR products were verified by agarose gel electrophoresis with appropriate DNA size markers using standard methods21.

Genome sequencing and analysis

The phage and bacterial genomes were sequenced at the icddr,b genomics centre using Illumina based technology. Genomic fragment libraries for whole-genome sequencing were prepared using Illumina Nextera® XT DNA library Preparation Kit (Cat. no, FC-131-1024) as per manufacturer’s instructions, and sequencing was conducted with Illumina Nextseq. 500 or MiSeq sequencers. FastQC tool was used to check the quality of raw sequence. Sequence reads with average quality less than Q20 were removed using Prinseq-lite v0.20.428. Prinseq was also used to trim end bases from both ends of the reads. De Novo assemblies of reads obtained from bacterial and phage genomes were performed using Velvet29, or Spade Genome Assembler30. Assemblies were further improved by scaffolding with SSPACE v2.031 and gap filling by GapFiller v1.1032.

Bacterial De Novo assembled sequences were reordered against V. cholerae N16961 reference genome using progressive algorithm mode of Mauve v2.4.033. Assembled contigs were annotated with the Rapid Annotations using Subsystem Technology (RAST) server34 and PROKKA35. Comparison and mapping visualization was undertaken using a combination of the software Mauve33, Artemis36 and BRIG37. Bacteriophage de novo assembled sequences were searched for homology by BLAST38. Multiple bacteriophage sequence alignments were built using MAFFT v.739. From this alignment, UPMGA phylogenetic tree was constructed using MEGA40. CRSIPRfinder online tool was used to find out CRISPR sequences in the assembled genomes41.

GenBank accession numbers

The sequences reported in this paper have been deposited in the GenBank database. For a list of accession numbers, see Supplementary Table S4 and Table S5.

Institutional approvals

All experimental protocols were approved by the Research Review Committee (RRC) and the Ethics Review Committee (ERC) of the icddr,b (Protocol numbers PR-15029 and PR-07018). All methods were conducted in accordance with the guidelines of the RRC and ERC. Informed consent was obtained for using any human sample, as directed in the ERC guidelines.


  1. 1.

    Faruque, S. M. et al. Seasonal epidemics of cholera inversely correlate with the prevalence of environmental cholera phages. Proc. Natl. Acad. Sci. USA 102, 1702–1707 (2005).

    ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

  2. 2.

    Faruque, S. M. & Mekalanos, J. J. Pathogenicity islands and phages in Vibrio cholerae evolution. Trends Microbiol. 11, 505–510 (2003).

    CAS  Article  PubMed  Google Scholar 

  3. 3.

    Faruque, S. M. et al. Self-limiting nature of seasonal cholera epidemics: Role of host-mediated amplification of phage. Proc. Natl. Acad. Sci. USA 102, 6119–6124 (2005).

    ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

  4. 4.

    Nelson, E. J., Harris, J. B., Morris, J. G. Jr, Calderwood, S. B. & Cammilli, A. Cholera transmission: the host, pathogen and bacteriophage dynamic. Nat. Rev. Microbiol. 10, 693–702 (2009).

    Article  CAS  Google Scholar 

  5. 5.

    Seed, K. D. et al. Phase variable O antigen biosynthetic genes control expression of the major protective antigen and bacteriophage receptor in Vibrio cholerae O1. PLoS Pathog. 8(9), e1002917 (2012).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  6. 6.

    Seed, K. D., Lazinski, D. W., Calderwood, S. B. & Camilli, A. A bacteriophage encodes its own CRISPR/Cas adaptive response to evade host innate immunity. Nature 494, 489–491 (2012).

    ADS  Article  CAS  Google Scholar 

  7. 7.

    Horvath, P. & Barrangou, R. CRISPR/Cas, the immune system of bacteria and archaea. Science 327, 167–170 (2010).

    ADS  CAS  Article  PubMed  Google Scholar 

  8. 8.

    Samson, J. E., Magadán, A. H., Sabri, M. & Moineau, S. Revenge of the phages: defeating bacterial defences. Nat. Rev. Microbiol. 11, 675–687 (2013).

    CAS  Article  PubMed  Google Scholar 

  9. 9.

    Bhaya, D., Davison, M. & Barrangou, R. CRISPR-Cas systems in bacteria and archaea: versatile small RNAs for adaptive defense and regulation. Annu. Rev. Genet. 45, 273–297 (2011).

    CAS  Article  PubMed  Google Scholar 

  10. 10.

    Marraffini, L. A. & Sontheimer, E. J. CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea. Nat. Rev. Genet. 11, 181–190 (2010).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  11. 11.

    Barrangou, R. et al. CRISPR provides acquired resistance against viruses in prokaryotes. Science 315, 1709–1712 (2007).

    ADS  CAS  Article  PubMed  Google Scholar 

  12. 12.

    Wiedenheft, B., Sternberg, S. H. & Doudna, J. A. RNA-guided genetic silencing systems in bacteria and archaea. Nature. 482, 331–338 (2012).

    ADS  CAS  Article  PubMed  Google Scholar 

  13. 13.

    Mojica, F. J., Díez-Villaseñor, C., García-Martínez, J. & Almendros, C. Short motif sequences determine the targets of the prokaryotic CRISPR defence system. Microbiology. 155, 733–740 (2009).

    CAS  Article  PubMed  Google Scholar 

  14. 14.

    Novick, R. P., Christie, G. E. & Penade´s, J. R. The phage-related chromosomal islands of Gram-positive bacteria. Nat. Rev. Microbiol. 8, 541–551 (2010).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  15. 15.

    Seed, K. D. Battling phages: How bacteria defend against viral attack. PLOS Pathogens. 11, e1004847, (2011).

    Article  CAS  Google Scholar 

  16. 16.

    Ram, G. et al. Staphylococcal pathogenicity island interference with helper phage reproduction is a paradigm of molecular parasitism. Proc. Natl. Acad. Sci. USA 109, 16300–16305 (2012).

    ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

  17. 17.

    Ram, G., Chen, J., Ross, H. F. & Novick, R. P. Precisely modulated pathogenicity island interference with late phage gene transcription. Proc. Natl. Acad. Sci. USA 111, 14536–14541 (2014).

    ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

  18. 18.

    O’Hara, B. J., Barth, Z. K., McKitterick, A. C. & Seed, K. D. A highly specific phage defense system is a conserved feature of the Vibrio cholerae mobilome. PLoS Genet. 13, e1006838 (2017).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  19. 19.

    Chakraborty, S. et al. Assessment of the evolutionary origin and possibility of CRISPR-Cas (CASS) mediated RNA interference pathway in Vibrio cholerae O395. In Silico Biol. 9, 245–54 (2009).

    PubMed  Google Scholar 

  20. 20.

    Box, A. M., McGuffie, M. J., O’Hara, B. J. & Seed, K. D. Functional analysis of bacteriophage immunity through a Type I-E CRISPR-Cas system in Vibrio cholerae and its application in bacteriophage genome engineering. J. Bacteriol. 198, 578–90 (2015).

    Article  PubMed  CAS  Google Scholar 

  21. 21.

    Makarova, K. S. et al. An updated evolutionary classification of CRISPR-Cas systems. Nat. Rev. Microbiol. 13, 722–736 (2015).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  22. 22.

    Labbate, M. et al. A genomic island in Vibrio cholerae with VPI-1 site-specific recombination characteristics contains CRISPR-Cas and type VI secretion modules. Sci. Rep. 6, 36891, (2016).

    ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

  23. 23.

    Carpenter, M. R. et al. CRISPR-Cas and contact-dependent secretion systems present on excisable pathogenicity islands with conserved recombination modules. J. Bacteriol. 199, pii: e00842–16, PMID: 28264992 (2017).

    Article  Google Scholar 

  24. 24.

    Faruque, S. M. & Mekalanos, J. J. Phage bacterial interactions in the evolution of toxigenic Vibrio cholerae. Virulence 3, 1–10 (2012).

    Article  Google Scholar 

  25. 25.

    Seed, K. D. et al. Evolutionary consequences of intra-patient phage predation on microbial populations. Elife. 3, e03497 (2014).

    Article  PubMed  PubMed Central  Google Scholar 

  26. 26.

    Kamruzzaman, M. et al. Quorum-regulated biofilms enhance the development of conditionally viable, environmental Vibrio cholerae. Proc. Natl. Acad. Sci. USA 107, 1588–1593 (2010).

    ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

  27. 27.

    Maniatis, T., Fritsch, E. F. & Sambrook, J. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y (1982).

  28. 28.

    Schmieder, R. & Edwards, R. Quality control and preprocessing of metagenomic datasets. Bioinformatics 27, 863-4 (2011).

  29. 29.

    Zerbino, D. R. & Birney, E. Velvet: algorithms for de novo short reads assembly using de Bruijn graphs. Genome Res. 18, 821–829 (2008).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  30. 30.

    Anton, B. et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. Journal of Computational Biology. 19, 455–477 (2012).

    Article  MathSciNet  CAS  Google Scholar 

  31. 31.

    Boetzer, M., Henkel, C. V., Jansen, H. J., Butler, D. & Pirovano, W. Scaffolding pre-assembled contigs using SSPACE. Bioinformatics 27, 578–579 (2011).

    CAS  Article  PubMed  Google Scholar 

  32. 32.

    Boetzer, M. & Pirovano, W. Toward almost closed genomes with GapFiller. Genome Biol. 13, R56, (2012).

    Article  PubMed  PubMed Central  Google Scholar 

  33. 33.

    Darling, A. E., Mau, B. & Perna, N. T. ProgressiveMAUVE: multiple genome alignment with gene gain, loss and rearrangement. PLoS One 5, e11147, (2010).

    ADS  Article  PubMed  PubMed Central  CAS  Google Scholar 

  34. 34.

    Aziz, R. K. et al. The RAST server: rapid annotation using subsystems technology. BMC Genomics 9, 75 (2008).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  35. 35.

    Seemann, T. Prokka: rapid prokaryotic genome annotation. Bioinformatics 30, 2068–2069 (2014).

    CAS  Article  PubMed  Google Scholar 

  36. 36.

    Carver, T., Harris, S. R., Berriman, M., Parkhill, J. & McQuillan, J. A. Artemis: an integrated platform for visualization and analysis of high-throughput sequence-based experimental data. Bioinformatics (Oxford, England) 4, 464–469 (2012).

    Article  CAS  Google Scholar 

  37. 37.

    Alikhan, N. F., Petty, N. K., Ben Zakour, N. L. & Beatson, S. A. BLAST Ring Image Generator (BRIG): simple prokaryote genome comparisons. BMC Genomics. 12, 402, (2011).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  38. 38.

    Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403–410 (1990).

    CAS  Article  PubMed  Google Scholar 

  39. 39.

    Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 30, 772–780 (2013).

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  40. 40.

    Kumar, S., Stecher, G. & Tamura, K. Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874 (2016).

    CAS  Article  PubMed  Google Scholar 

  41. 41.

    Grissa, I., Vergnaud, G. & Pourcel, C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucl. Acids Res. 35, W52–W57 (2007).

    Article  PubMed  PubMed Central  Google Scholar 

Download references


This research was funded in part by the Wellcome Trust through a senior investigator award WT-105927/Z/14/Z to Shah Faruque, and the Swedish International Development Cooperation Agency (SIDA). The icddr,b receives core support from the Governments of Bangladesh, Canada, Sweden and the UK. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Author information




S.M.F., designed research; I.B.N., M.M.H., M.A.N., T.M.T. and M.K.R., performed research; S.M.F., and I.B.N., analyzed data; and S.M.F. and I.B.N. wrote the paper.

Corresponding author

Correspondence to Shah M. Faruque.

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Naser, I.B., Hoque, M.M., Nahid, M.A. et al. Analysis of the CRISPR-Cas system in bacteriophages active on epidemic strains of Vibrio cholerae in Bangladesh. Sci Rep 7, 14880 (2017).

Download citation

Further reading


By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.


Sign up for the Nature Briefing newsletter for a daily update on COVID-19 science.
Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing