Table 2 Primers used to detect the male-specific gene sry.

From: Oral Mucosal Epithelial Cells Grown on Porous Silicon Membrane for Transfer to the Rat Eye

Primer Sequence (5′ → 3′) Description
SRY1for TGCATTTATGGTGTGGTCCCG sry multiplex primer
SRY1rev CTGTGTAGGGTCTTCAGTCTCTGC sry multiplex primer
SRY2for TGTCTAGATAGCATGGAGGGC Second round primer
SRY2rev CCTCTGTGGCACTTTAACCCTT Second round primer
ARBPfor CCATCTGCATTTGCGGC Housekeeping gene
ARBPrev GCAGGCTGACTTGGTGTGA Housekeeping gene