Plasmodium falciparum GPCR-like receptor SR25 mediates extracellular K+ sensing coupled to Ca2+ signaling and stress survival

Moraes, Miriam S.; Budu, Alexandre; Singh, Maneesh K.; Borges-Pereira, Lucas; Levano-Garcia, Julio; Currà, Chiara; Picci, Leonardo; Pace, Tomasino; Ponzi, Marta; Pozzan, Tullio; Garcia, Célia R. S.

doi:10.1038/s41598-017-09959-8

Download PDF

Article
Open access
Published: 25 August 2017

Plasmodium falciparum GPCR-like receptor SR25 mediates extracellular K⁺ sensing coupled to Ca²⁺ signaling and stress survival

Miriam S. Moraes^1,2^na1,
Alexandre Budu^1,2^na1,
Maneesh K. Singh^1,2^na1,
Lucas Borges-Pereira^1,2,
Julio Levano-Garcia ORCID: orcid.org/0000-0001-8140-5568¹,
Chiara Currà^1,3,
Leonardo Picci⁴,
Tomasino Pace⁴,
Marta Ponzi⁴,
Tullio Pozzan⁵ &
…
Célia R. S. Garcia¹

Scientific Reports volume 7, Article number: 9545 (2017) Cite this article

2783 Accesses
24 Citations
1 Altmetric
Metrics details

Subjects

Abstract

The malaria parasite Plasmodium falciparum is exposed, during its development, to major changes of ionic composition in its surrounding medium. We demonstrate that the P. falciparum serpentine-like receptor PfSR25 is a monovalent cation sensor capable of modulating Ca²⁺ signaling in the parasites. Changing from high (140 mM) to low (5.4 mM) KCl concentration triggers [Ca²⁺]_cyt increase in isolated parasites and this Ca²⁺ rise is blocked either by phospholipase C (PLC) inhibition or by depleting the parasite’s internal Ca²⁺ pools. This response persists even in the absence of free extracellular Ca²⁺ and cannot be elicited by addition of Na⁺, Mg²⁺ or Ca²⁺. However, when the PfSR25 gene was deleted, no effect on [Ca²⁺]_cyt was observed in response to changing KCl concentration in the knocked out (PfSR25 ⁻) parasite. Finally, we also demonstrate that: i) PfSR25 plays a role in parasite volume regulation, as hyperosmotic stress induces a significant decrease in parasite volume in wild type (wt), but not in PfSR25 ⁻ parasites; ii) parasites lacking PfSR25 show decreased parasitemia and metacaspase gene expression on exposure to the nitric oxide donor sodium nitroprusside (SNP) and iii), compared to PfSR25 ⁻ parasites, wt parasites showed a better survival in albumax-deprived condition.

Co-option of Plasmodium falciparum PP1 for egress from host erythrocytes

Article Open access 15 July 2020

A non-canonical sensing pathway mediates Plasmodium adaptation to amino acid deficiency

Article Open access 21 February 2023

Plasmodium falciparum sexual parasites regulate infected erythrocyte permeability

Article Open access 01 December 2020

Introduction

Malaria is responsible for 2–3 million deaths annually^{1, 2}. The etiological agent of the most aggressive form of the disease, Plasmodium falciparum, upon RBC invasion resides inside a vacuole and undergoes various developmental changes, through the stages R (Ring), T (Trophozoite) and S (Schizont). Subsequent to nuclear division, several merozoites are generated, which upon release into the blood invade new RBCs³.

In the course of infection, P. falciparum is exposed to different microenvironments, in particular the ionic composition. We have shown previously that the Plasmodium vacuolar membrane is endowed with the capacity to generate a microenvironment around the parasites⁴ with a sufficient Ca²⁺ concentration to allow Ca²⁺ signaling to persist in the intracellular stage⁵.

In addition to the changes in Ca²⁺ levels, during the period spent in the mammalian host, Plasmodia must also deal with dramatic changes in K⁺ concentration, i.e. from 5 mM usually found in the blood stream, to 140 mM when the parasite resides inside the cytosol of host cells. Evidence has been presented over the last few years indicating that the changes in the different microambient of K⁺ concentration may affect several of the parasite functions. For example, exposure of liver-cell invading P. berghei parasites to high K⁺ stimulates cell invasion by the rodent malaria sporozoite⁶; along the same line, reducing K⁺ from 140 mM to 5 mM K⁺ in P. falciparum merozoites causes a rise in [Ca²⁺]_cyt, leading to microneme secretion and merozoite egress from RBCs⁷. The microneme is a parasite organelle important for the parasite invasion and the release of its content was suggested to depend on [Ca²⁺]_cyt rise through PLC activation, but the molecular mechanisms that trigger K⁺ dependent effects in Plasmodia remain largely undefined. Here, we demonstrate that PfSR25 (PlasmoDB number PF3D7_0713400), a member of a family of putative G protein-coupled receptors (GPCRs), which includes PfSR1, PfSR10, PfSR12, and PfSR25 that were recently identified in Plasmodium database⁸, couples changes in extra parasitic K⁺ levels to PLC activation and intracellular Ca²⁺ mobilization. To the best of our knowledge, this is the only GPCR in any eukaryotic cell type with the capacity to respond to changes in environmental K⁺ concentration. Other possible functional roles of PfSR25 have been investigated by comparing wild type (wt) and PfSR25 ⁻ parasites. In particular, focusing on programmed cell death (PCD). It has been shown that many of the key apoptotic markers present in mammals do also exist in Plasmodium ⁹ and several research groups have demonstrated the participation of metacaspase in PCD of Plasmodium ^{10, 11}. We hereby demonstrate that PfSR25 ⁻ parasites are more susceptible to stress induced by NO production compared to wt cells, with a much larger increase in metacaspase expression. Finally, PfSR25 ⁻ parasites also appear to be more sensitive than wt cells to chloroquine induced death and to stress induced by albumax removal from the medium. We also observed that PfSR25 ⁻ parasites show higher inhibition in hemozoin formation after piperaquine treatment in comparison to wt parasites.

Results

PfSR25 expression through RBC cycle

We have recently identified four potential GPCRs in Plasmodium falciparum genome and antibodies against these proteins have been generated. In particular, Western blots analysis with a specific anti-PfSR25 polyclonal antibody revealed the expression in the parasite blood stages (R, T and S) of a specific ~43 kDa band (consistent with the predicted molecular mass of PfSR25). Of interest, this band was stronger in more mature parasites, i.e., at the T and S stages and very faint at the R stage (Fig. 1A). Analysis of immunofluorescence images at different time points revealed the presence of PfSR25 in R and T phase parasites with a diffused staining pattern. Interestingly, a particularly intense labeling was detected in schizonts, i.e. the stage prior to parasite egress from RBC. Finally, and most importantly, PfSR25 was clearly detected in RBC-infective parasite stage, i.e. the merozoite. Co-localization with Plasmodium surface protein MSP-1 reveals that SR25 expression at parasite membrane (Fig. 1B).

To further investigate the functional role of PfSR25 in P. falciparum, we generated and characterized knockout parasite clones (Fig. 1C–F). Gene disruption was verified by PCR (Fig. 1D) and Southern blot analysis (Fig. 1E) and protein expression by Western blot (Fig. 1F). As expected, neither the SR25 gene nor the protein was detected in the PfSR25 ⁻ samples.

In order to study the functional role of SR25 in vivo and not in vitro only, we also generated PbSR25 knockout parasites in the rodent malaria model P. berghei (see Supplementary Fig. S1). Interestingly, in P. berghei transfected parasites that received the plasmid – thus GFP expressing (about the 0.3% of total parasites obtained after pyrimethamine selection) could be selected by fluorescence sorting by FACS but following purification and new injection in mice, they were not able to grow (see Supplementary Table S1).

Changes in medium of KCl concentration modulate P. falciparum Ca²⁺ signaling

In order to functionally characterize the role of PfSR25, the differential response to a series of different stimuli of wt and PfSR25 ⁻ cells were compared. In particular, we addressed our attention to the Ca²⁺ signaling of the isolated late trophozoit/early schizont stage parasites. In a preliminary screen, we verified that some basic features of the Ca²⁺ signaling characteristics of P. falciparum are not affected by PfSR25 ⁻, i.e., the basal Ca²⁺ level and the response to melatonin were indistinguishable in the two parasite strains (see Supplementary Fig. S2A and B). We next tested the effect on [Ca²⁺]_cyt when changing the extracellular K⁺ concentration. To this end P. falciparum cells, at the late T stages, were isolated from RBCs, loaded with the fluorescent Ca²⁺ indicator Fluo4-AM and incubated in the respective buffers with high K⁺/low Na⁺ (140 mM KCl, 5.4 mM NaCl) and low K⁺/high Na⁺ (5.4 mM KCl, 140 mM NaCl) supplemented with 2 mM CaCl₂. We observed a fluorescent shift when parasites were transferred from high K⁺ to low K⁺ buffer but no difference in shift was found in the opposite condition i.e. low K⁺ to high K⁺ for wt parasites (Fig. 2A,C and see Supplementary Fig. S5). We also found that the KCl dose-response curve of the Ca²⁺-response was bell shaped as it was maximal at close to 30 mM KCl and then subsequent decreased at higher concentration of KCl (see Supplementary Fig. S2G).

The same protocol was then employed in the PfSR25 ⁻, these parasites failed to respond to changes in KCl concentration when switched from high to low K⁺ buffer (Fig. 2B,G and see Supplementary Fig. S6). When the PfSR25 ⁻ parasites were transferred from high to low K⁺ and treated with 5 μM thapsigargin (THG), an increase in [Ca²⁺]_cyt was however observed, indicating that internal Ca²⁺ stores are normally filled (Fig. 2H). We next investigated whether the [Ca²⁺]_cyt rise upon change in KCl depends on Ca²⁺ influx from the extracellular medium or on release from intracellular Ca²⁺ stores, or both. To this end, the same experiment of Fig. 2C was performed without extracellular Ca²⁺ (and in the presence of 2 mM EGTA). The KCl-induced [Ca²⁺]_cyt rise persisted under these latter conditions, clearly indicating that changes in KCl concentration in the extracellular medium mobilize Ca²⁺ from intracellular pools (Fig. 2E and see Supplementary Fig. S7). To further confirm this conclusion, cells were treated with cyclopiazonic acid (CPA, 10 µM) to deplete internal stores¹² and no difference was observed in high or high to low [KCl]. Treatment with CPA was sufficient to completely prevent the KCl-induced [Ca²⁺]_cyt rise (Fig. 2F and see Supplementary Fig. S8). Along the same line, the PLC inhibitor U73122 abrogated the [Ca²⁺]_cyt rise caused by KCl (Fig. 2D and see Supplementary Fig. S9). On the other hand, the inactive analogue U73343 did not modify the [Ca²⁺]_cyt response to KCl (Fig. 2A and see Supplementary Fig. S10).

The [Ca²⁺]_cyt rise did not depend on osmotic effects or on Cl⁻ concentration, as: i) it is not elicited by addition of an equivalent dose of Na-Gluconate (Fig. 2A and see Supplementary Fig. S11); ii) the effect was indistinguishable using KCl or K-gluconate (Fig. 2A and see Supplementary Fig. S12). Finally, the effect is specific for K⁺, as changes in concentration of either Ca²⁺ or Mg²⁺ had no effect on [Ca²⁺]_cyt up to 5 mM, (see Supplementary Fig. S2C,D). Moreover when parasites where incubated in 5 mM and then KCl was increased to 50 mM we still observed a rise in [Ca²⁺]_cyt but similarly increase in concentration of other monovalent cation Na⁺ had no effect on [Ca²⁺]_cyt rise (see Supplementary Fig. S2E,F).

PfSR25 expression and parasite volume regulation

We then investigated whether the PfSR25 ⁻ had other functional effects in the parasites. In particular, we found that: (i) the growth rate of PfSR25 ⁻ parasites within RBC is indistinguishable from that of wt parasites (Fig. 3A); (ii) the merozoite number produced by schizonts is similar between the two parasite strains (Fig. 3B) and (iii) the invasion of RBC is not affected by PfSR25 ⁻.

On the contrary, some differences were observed between wt and PfSR25 ⁻ parasites in terms of volume regulation when exposed to hyperosmotic buffer. Figure 3C shows that volume decrease was clearly observed upon exposure to hyperosmotic medium in wt parasites while this were largely blocked in PfSR25 ⁻ parasites. To further explore this result, forward light scatter (FSC) characteristics were used to quantify cell volume in isosmotic buffer as illustrated in Fig. 3D. Under these conditions, significant differences were observed in forward scatter between wt and PfSR25 ⁻, the volume of mutant parasites being significantly larger than that of wt parasites.

The PfSR25 pathway modulates stress-induced parasite death

To determine the role of PfSR25 in the resistance to toxic agents, P. falciparum synchronized 3D7 wt and PfSR25 ⁻ parasites were treated with the NO donor, sodium nitroprusside (SNP) and the parasitemia were determined by flow cytometry. Exposure of P. falciparum to increasing doses of SNP (0–0.50 mM) demonstrated that PfSR25 ⁻ is more sensitive to SNP toxicity than wt parasites (Fig. 4A and D). Giemsa stained smears showing the decreased parasitemia when treated with SNP (see Supplementary Fig. 3A and B). It has been shown that chloroquine is able to stimulate NO synthesis in human monocytes as well as in endothelial cells¹³. We thus next examined whether the survival effect was differentially affected by chloroquine treatment. The parasitemia observed in PfSR25 ⁻ after exposure to chloroquine for 24 hr was consistently less than that produced by wt parasites (Fig. 4C and E) along with the giemsa stained smears (see Supplementary Fig. 3C), indicating decreased parasite viability. Reduced parasitemia could result from decreased cell proliferation and/or increased cell death. In addition, by analysing the levels of metacaspase after treatment of parasites for 3 hours with 0.5 mM of SNP, we found that PfSR25 ⁻ parasites showed a 72% increase in metacaspase expression compared with wt parasites (Fig. 4B). To demonstrate that the action of SNP on P. falciparum was really due to its released NO, rather than other metabolite products, we have observed the ability of other NO donor at similar concentration in inducing cell death in P. falciparum. The effects of nitrosothiol derivative (SNAP) – NO donor on P. falciparum wt and PfSR25 ⁻ were shown in Supplementary Fig. S4A. Treatment of parasites with SNAP at micromolar concentrations, decreased the parasitemia by 80% and 59%, respectively, in KO parasites compared to wt parasites, confirming the data obtained using SNP. These findings suggest that PfSR25 may influence parasite susceptibility to SNP toxicity.

Nicotinamide adenine dinucleotide phosphate (NADPH) is a critical product of Glucose-6-phosphate dehydrogenase (G6PD), and is of central importance to the regulation of antioxidant system. Many studies have shown that G6PD deficiency renders cells extremely sensitive to oxidative stress^14,15,16. Therefore, we were interested in studying the impact of PfSR25 ⁻ in G6PD activity. G6PD activities were measured in samples from wt and PfSR25 ⁻. The basal level of G6PD activity in PfSR25 ⁻ was comparable to wt parasites, indicating that PfSR25 ⁻ parasites respond under basal conditions with the same degree of NADPH production as wt parasites (see Supplementary Fig. S4C).

With the aim of better understanding how the PfSR25 ⁻ parasites manage to survive under stress conditions we measured growth of PfSR25⁻ and wt parasites after albumax deprivation. For these experiments, PfSR25 ⁻ and wt parasites were synchronized and maintained in albumax media for 24 h before switching to albumax-deprived media for 72 h without medium change. To assess whether all the remaining parasites were in fact dead, the percentages of parasites that continued to proliferate upon return to albumax-supplemented conditions was analysed. Parasites were switched back to albumax media for additonal 72 h. Medium was not renewed during the 72-hour incubation. We observed that parasitemia was significantly lower in PfSR25 ⁻ parasites after being exposed to these stress conditions compared to wt cells (Fig. 5A,B and see Supplementary Fig. 4D). However, survival of parasites after albumax-deprivation was further ameliorated when the media was changed daily, even though the difference observed in parasitemia between PfSR25 ⁻ and wt was still maintained (Fig. 5C,D).

Direct role of SR25 when treated with antimalarial drug would give better perspective since its function is still not clear. We have treated both PfSR25 ⁻ and wt trophozoites (32-34 hours post infection) with piperaquine (PQ) for 2 hours and measure the hemozoin formation. Interestingly, we found that PfSR25 ⁻ parasites were very susceptible to drug treatment and after 2 hours, the hemozoin size formation was inhibited by approximately 69.9 ± 2.1% (Fig. 6).

Discussion

Though separated by many million years of evolution, Plasmodia share with mammalian cells most of the functional characteristics of their signaling machinery. In particular, the malaria parasites use the same second messengers signaling principles of mammalian cells, i.e., the cAMP-protein kinase A and the IP₃-Ca²⁺ signaling cascades^{5, 17, 18}. Not surprisingly, however, many of the proteins involved in these processes are, at least in terms of primary sequence, totally different in the two types of cells. For example, though functionally and thanks to the work of several groups, conclusive evidence has been obtained in favor of the existence in Apicomplexa of an IP₃ receptor linked to Ca²⁺ mobilization from stores^19,20,21. Recently IP₃R was identified in T. brucei and T. cruzi ^{22, 23} but no analogue of the mammalian protein has been found in the Plasmodia genome. Similarly, though searched intensively, proteins similar to mammalian GPCRs have been discovered in Plasmodia only very recently. We have described the expression in Plasmodium falciparum of four proteins that have the key characteristics of GPCRs, i.e., 7 potential transmembrane domains and relatively large extra and intracellular domains⁸. In the attempt of identifying the signaling pathway(s) controlled by these Plasmodia putative GPCRs (and their natural ligands) we discovered that one of them, PfSR25, is coupled to increases of [Ca²⁺]_cyt in response to changes of extracellular K⁺ concentrations. Changes in extracellular ion concentration (and in particular of K⁺) are relatively small (and either spatially very restricted, e.g. around active synapses, or linked to pathological conditions) in mammals, but are relatively frequent in unicellular eukaryotes and particularly in parasites such as Plasmodia, that spend part of their life cycle within cells (with high [K⁺]) and part in the blood stream, (with low [K⁺])⁶. By directly monitoring the [Ca²⁺]_cyt of isolated Plasmodium falciparum we here provide direct evidence for the existence of an extracellular K⁺ sensing mechanism. In particular we show that, among physiologically abundant cations, only changes in medium K⁺ concentrations are capable of modifying [Ca²⁺]_cyt in these cells. This finding is consistent with a previous report demonstrating that K⁺ was able to modulate, through undefined mechanisms, Ca²⁺ signaling in the blood stages of Plasmodium falciparum ⁷. Noteworthy, increases in extracellular K⁺ concentrations that are capable of rapidly increasing the parasite [Ca²⁺]_cyt are within the range that could be experienced by Plasmodia during their intra and extracellular life in the host. Under more physiological conditions, however, increases in [Ca²⁺]_cyt are observed also when P. falciparum are preincubated in medium with the physiological K⁺ concentrations of the blood (5 mM). One may thus speculate that P. falciparum undergo a rise in [Ca²⁺]_cyt both when invading the RBC (from low to high K⁺) and when released from RBC into the blood (from high to low K⁺). The effect of K⁺ is neither due to effects on membrane potential (and activation of voltage gated Ca²⁺ channels) nor to osmotic effects, as i) it is not elicited by equimolar concentration of other cations, ii) it occurs in the absence of extracellular Ca²⁺ and iii) it is inhibited by pre-depletion of intracellular Ca²⁺ pools and by addition of phospholipase C inhibitors, that block IP₃ generation. Accordingly, we conclude that Plasmodium IP₃ sensitive internal Ca²⁺ pools are the source of [Ca²⁺]_cyt rises induced by changes in K⁺ concentration. Most relevant, K⁺ dependent [Ca²⁺]_cyt increases are eliminated by knocking out the putative GPCR PfSR25. The simplest explanation for these data is that PfSR25 is a K⁺ sensor itself, coupled via a G protein to phospholipase C activation. Alternatively, it may be speculated that, in order to act as a K⁺ sensor, PfSR25 needs coupling to another, yet unidentified, Plasmodium specific protein.

One may have anticipated that an extracellular K⁺ sensor, never described before in any eukaryotic cell, should be of primary relevance in malaria parasite characteristics. On the contrary, and rather surprisingly, the key feature of P. falciparum, at least in vitro, is not significantly affected by genetic ablation of PfSR25. However, in the in vivo model P. berghei, the rodent malaria parasite, the deletion of the PbSR25 orthologue gene was not possible. In fact, the percentage of KO parasites GFP expressing was very low (about 0.3% of the parasitemia) and purified mutant parasites (efficiently purified at 90%) injected to naïve mice did not lead to infection. However, if wt parasite contamination was at least the 20%, mutants could replicate with a multiplication rate of the 35% comparing to wild type parasites. The PbSR25 ⁻ in P. berghei is not the first parasite line described in literature as non-vital. The database available at http://pberghei.eu/index.php also reports a similar result for the KO line of PBANKA_0915000 (AMA1), expressing as well GFP but impossible to clone (ID = 953) and purify (data

supported by Menard et al.)²⁴. In particular, the invasion in vitro of RBC, parasite cell cycle progression and the release of merozoites is indistinguishable in wt and PfSR25 ⁻ parasites. In PfSR25 ⁻ cells we observed only marginal differences concerning volume regulation characteristics.

We thus considered two, non-mutually exclusive, explanations for this unexpected finding: i) KO of PfSR25 may result in the activation of alternative pathways capable of compensating the absence of the K⁺ sensor; ii) the in vitro culture conditions may not mimic the in vivo situation where the K⁺ sensing mechanism may play a more essential role. To test this latter possibility we investigated whether PfSR25 ⁻ parasites were more sensitive than wt cells under stress conditions. The parasites were thus challenged with NO (as induced by SNP treatment), the classical anti malaria drug chloroquine and albumax deprivation to induce parasite starvation. In all these three stress conditions PfSR25 ⁻ parasites appear to be more sensitive than wt cells, suggesting that PfSR25 could contribute to parasite survival under unfavourable conditions. Of interest, and particularly upon NO dependent stress, PfSR25 ⁻ parasites responded to the toxic insult with a dramatic increase in metacaspase expression. Transcriptional profiling on lumefantrine (LM) selective resistant P. falciparum when kept in constant drug pressure for long time (16 months) has shown higher SR25 expression along with other transporters suggests that SR25 plays crucial role during drug-induced pressure (Mwai et al., 2012). Towards this end, we have measured the hemozoin size (Alves et al., 2015) in both wt and PfSR25 ⁻ parasite after PQ treatment and our experiment shows that PfSR25 ⁻ parasites were more sensitive to the PQ treatment than wt parasites and hemozoin formation was inhibited by 28% in PfSR25 ⁻ parasites. This experiment is in agreement with Mwai et al. and gives direct evidence of SR25 during drug pressure.

Based on our study, we have proposed the following model where we found that PfSR25 is present on parasite surface. When the parasites are switched from high to low K⁺ environment, it elicits PLC-mediated Ca²⁺ release from parasite’s internal store. Cytosolic Ca²⁺ rise further activate multiple Ca²⁺-mediated intracellular signaling pathway necessary for new infection cycle^{25, 26}. How PfSR25 is transducing change in K⁺ to increase in Ca²⁺ could be a general mechanism for pathogen invasion in other biological models and deserves to be more fully exploited in the future. On the other hand, PfSR25 ⁻ parasites are more susceptible to SNP treatment and exhibit reduced hemozoin formation when treated with antimalarial PQ (Fig. 7). The molecular mechanism(s) through which PfSR25 improves parasite survival to stress is however not clear and requires further investigation. In addition, the involvement of two cellular mechanisms of action may explain the response of PfSR25 ⁻ to starvation and chloroquine, since besides starvation, chloroquine also can activate autophagy process in Plasmodium ^{27, 28}.

Materials and Methods

Materials

All cell culture reagents were obtained from Cultilab (Brazil). Fluo4-AM was from Molecular Probes. All other reagents were of the highest obtainable grade.

Cell culture, synchronization and preparation of isolated parasites

The P. falciparum strain 3D7 was cultured at 37 °C in RPMI 1640 medium supplemented with 0.5% Albumax II (Gibco)^{29, 30}. Cultures were grown under a 5% CO₂, 5% O₂, and 90% N₂ atmosphere. The culture was synchronized with 5% sorbitol³¹ and parasitemia of 5–10% were obtained after 48 h of incubation. RBC-free parasites were prepared by using a previously published method³².

Plasmodium berghei ANKA 8417HP strain was used throughout the study³³ and was maintained in CD1 mice (Harlan Sprague Dawley Inc). Purification of blood stages were performed as described³⁴. Schizonts were isolated from cultures 23 h after set up and removal of uninfected red blood cells by density gradient centrifugation using Nycodenz.

Protein extraction and western blot

For stage specific analysis of PfSR25 expression, in vitro cultures were synchronized with two consecutive incubations in 5% sorbitol, and four protein points were collected: the rings were collected 6 h after synchronization, a mixture of trophozoites and early schizont forms were collected 24 h after synchronization, a mixture of late schizont forms and rings were collected 30 h after synchronization, and a mixture of late schizont forms and rings were collected 36 h after synchronization. At each time point, the cells were harvested, and the cell pellets were lysed for 60 s in ten volumes of 0.05% saponin prepared in PBS. The parasite pellet was recovered by centrifugation at 8,000 g for 10 min at 4 °C, washed and resuspended in lysis buffer (in mM): 50 Tris, pH 8.0, 150 NaCl, 5 EDTA, and 0.5% Nonidet P40 supplemented with the following mixture of protease inhibitors: 1 mM PMSF, 0.01 mM benzamidine, 10 µg ml⁻¹aprotinin, 10 µg ml⁻¹, leupeptin, 10 µg ml⁻¹ pepstatin, 10 µg ml⁻¹ chymostatin, 100 µM sodium orthovanadate, and 20 µM sodium fluoride. Particulate material was removed by centrifugation at 14,000 g for 30 min. Protein fractions were separated on 10% SDS-PAGE gels under reducing conditions, transferred to nitrocellulose, blocked with 5% powdered milk, and probed with PfSR25 specific polyclonal antibody (epitope sequence GTGEVKW) at a 1:2000 dilution. After extensive washing, the blots were incubated with HRP-conjugated goat anti-rabbit IgG (GE Healthcare) at a dilution of 1:10000 for 1 h, washed, and visualized using Plus ECL (GE Healthcare).

Measurement of intracellular Ca²⁺ levels on P. falciparum synchronized culture

RBC at the late trophozoites-early schizont stage were centrifuged (2,000 rpm, 5 min), and the ~1 ml pellet was washed and isolated with 0.05% saponin in respective high (140 mM) or low K (5.4 mM) buffer so the parasites will remain in high or low potassium environment followed by loading with 10 µM Fluo4-AM for 30 min at 37 °C in high K⁺ (in mM:140 KCl, 5.4 NaCl, 0.8 MgSO₄, 5.5 D-glucose, 50 MOPS, 2 CaCl₂; pH 7.2); low K⁺ (in mM:5.4 KCl, 140 NaCl, 0.8 MgSO₄, 5.5 D-glucose, 50 MOPS, 2 CaCl₂; pH 7.2); K-gluconate (in mM:140 K-gluconate, 5.4 Na-gluconate, 0.8 MgSO₄, 5.5 D-glucose, 50 MOPS, 2 CaCl₂; pH 7.2) and Na-gluconate (in mM:5.4 K-gluconate, 140 Na-gluconate, 0.8 MgSO₄, 5.5 D-glucose, 50 MOPS, 2 CaCl₂; pH 7.2) respectively. Parasites were then washed three times in respective buffer and ~5 × 10⁷ parasites were transferred to high or low K⁺ containing vial prior to the experiment. For U73122 and U73343, parasites were pretreated for 1 min after Fluo4-AM loading. Fluo4-AM signal was measured for 2 min for each experiment by flow cytometry (FACSCalibur, Becton Dickinson, USA) excited with a 488 nm Argon laser and fluorescence emission was collected at 520–530 nm. All data were analyzed by FlowJo software with Histogram at y-axis and FL-1 at x-axis.

Cytosolic calcium dynamics were also monitored using Shimadzu spectrofluorophotometer (RF5301PC, Japan) in Fluo4-AM loaded parasite preincubated with 250 µM probenecid as described previously for calcium measurements¹².

Immunofluorescence confocal microscopy in P. falciparum

IFA was performed essentially as described previously³⁵. For co-localization parasites were first incubated overnight at 4 °C with 1:100 rabbit anti-PfSR25 in PBS containing 3% BSA and 0.01% Triton X-100. The secondary antibody anti-IgG rabbit Alexa 488 (Invitrogen) was used at 1:300 dilution in PBS containing 3% BSA for 1 h at room temperature. Parasites were rinsed in PBS, blocked in 3% BSA and 10% horse serum for 1 h and incubated with anti-MSP1 rabbit serum (1:500 dilution) for 1 h at room temperature followed by incubation with Alexa Fluor 546-conjugated anti-rabbit antibody (1:500 dilution) (Invitrogen). Parasites were incubated for 5 min with DAPI 1:1000 and washed three more times in PBS. Cells were mounted using Vectashield (Vector). Images were acquired with a Zeiss confocal microscope (LSM 780-NLO).

Construction of knockout plasmid pCAM-BSD-KO-PfSR25

The parental plasmid pCAM-BSD was kindly donated by Christian Doerig³⁶. A fragment from the PfSR25 ORF (PlasmoDB PF3D7_0713400) was amplified by PCR and inserted between the PstI and SacI sites of the pCAM-BSD plasmid, which contains a cassette conferring resistance to blasticidin. A fragment spanning nucleotides 3 to 508 (numbered according to the PlasmoDB entry) was obtained using forward (ACTGCAGGGCTAAAAGGCACAAATTAAAG) and reverse (AGAGCTCCTAAATTCATGCATATCAAC) primers carrying PstI and SacI sites (underlined), respectively, and inserted into pCAM-BSD. DNA fragments were amplified from 3D7 genomic DNA by PCR, digested with the indicated restriction enzyme and cloned in pCAM-BSD.

The PbSR25(−) parasites were generated by introducing the drug-selectable cassette linked to a high expression GFP cassette in pBAT³⁷ by double crossover. The PbSR25 construct comprised a 809 bp PCR fragment of the 5′-FR of the gene amplified with primers PbSR25S1 and PbSR25S2, inserted in the restriction sites SacII-SpeI, and an 830 bp fragment of the 3′-FR amplified with primers PbSR25D1 and PbSR25D2 inserted in the sites ApaI-XhoI. The plasmid was digested with the enzyme PvuI before transfection. The gene was replaced via a double cross-over integrating the recyclable hDHFR-yFcu cassette which encodes anti-folate resistance. GFP expression was regulated by the PbHSP70 promoter. After transfection about 2000 GFP-fluorescent red blood cells were sorted and intravenously injected into two CD1 mice. When parasitaemia was established, only the 5% of total parasitemia was depending on GFP-positive parasites. Sorting and new infections were repeated two more times, but no parasitemia was detected. All primer sequences are available upon request.

The animal work has been authorized by the Italian Ministry of Health, according to the Legislative Decree 116/92 which implemented the European Directive 86/609/EEC on laboratory animal protection. Animals used in this study were haused and treated according to Legislative Decree 116/92 guidelines.

Parasite transfection

Transfection was carried out by the electroporation of ring stage parasites at 5-10% parasitemia with 100 µg of plasmid DNA. Following transfection, parasites were maintained in drug-free medium for 48 h at which time positive selection was initiated by the addition of 2.5 µg/ml blasticidin to the medium. Blasticidin-resistant parasites appeared after 3 to 6 weeks of culture, and their genotype was evaluated by PCR to verify that integration had occurred at the target locus. The parasites were then cloned by limiting dilution in 96-well plates (0.5 to 1 parasite/well)³⁸ and their genotype was analyzed using PCR.

Genotype characterization by PCR

For the detection of integration of the plasmid pCAM-BSD-KO-PfSR25 into genomic DNA the following primers were used: primer 1, TACATATATACATGCCTTGAAC; primer 2, GAACATATTTATTAAACTGCAG; primer 3, TCACTAAAGGGAACAAAAGCT; and primer 4, GAAAGGTAATTTGGTCTGTAC. Primers 1 and 4 correspond to PfSR25 sequences, and primers 2 and 3 correspond to pCAM-BSD vector sequences flanking the insertion site.

SNP experiments

Parasites from each lineage were incubated with SNP at a concentration of 0 (basal), 100, 500, 1000 or 2000 µM for 6 hours at 37 °C in a 5% CO₂ humidified atmosphere; both the selected concentration(s) and the specific duration(s) of incubation are specified in the results section. For FACS experiments, cells were grown in a 24-well plate; whereas parasites were grown in 25 cm² plastic flasks for DNA and RNA extraction.

Total RNA isolation

Total RNA was extracted from various parasites cultures using TRIZOL (Invitrogen, USA). Synchronized parasites, with or without in vitro stimulation, were lyzed directly in a culture flask by adding TRIZOL. The homogenates were incubated for five minutes at room temperature to permit complete dissociation of nucleoprotein complexes. Next, 0.2 ml chloroform was added per millilitre of extraction reagent; the mixture was shaken vigorously for 15 seconds and incubated for two to three minutes at 4 °C. Centrifugation separated the homogenates into two phases: a lower brown phenol/chloroform phase and a colourless upper aqueous phase containing RNA. The aqueous upper phase was transferred to a fresh tube, and 0.5 ml isopropanol was added per 1 mL of TRIZOL. This mixture was incubated at room temperature for 10 minutes and then centrifuged for 10 minutes at 12,000 × g. Supernatants were removed, and the RNA pellet was washed once with 75% ethanol by vortexing and subsequent centrifugation at 7500 × g for five minutes at 4 °C. The extracted RNA in the pellet was air dried and dissolved in DEPC-H₂O for use in qRT-PCR analysis.

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

RNA was extracted from synchronized schizont 46–48 h post-invasion. Total RNA was isolated and purified according to manufacturer’s instructions using TRIZOL® reagent (Invitrogen) and measured using a NanoDrop 2000c spectrophotometer (Thermo Scientific). Equal amounts of total RNA were synthesized into cDNA using a First-Strand cDNA Synthesis kit (Invitrogen). ABgene Absolute qPCR SYBR Green Master Mix (ABgene, Surrey, UK) with ROX dye was used for all PCR protocols. The following primer pairs from Extend were used: Metacaspase (PF3D7_1354800): forward 5′-GCTGTTGTAGATAGTTGTAATTCTGG-3′, reverse 5′-GGTGCAATCTGTCCTGTGTTAAC-3′. serine tRNA-ligase (PF3D7_0717700): forward 5′-TGGAACAATGGTAGCTGCAC-3′, reverse 5′-TCATGTATGGGCGCAATTT-3′. qRT-PCR reactions were run in triplicate, in 96-well plates on an ABI Prism^® 7900HT real-time PCR machine. Thermal cycling conditions were as follows: one cycle at 50 °C for 2 min for enzyme activation; one cycle at 95 °C for 15 min for enzyme activation; forty cycles at 95 °C for 15 sec for Denaturation and 60 °C for 1 min for the Anneal/Extension step. Threshold cycle number (Ct) of gene was calculated, and serine tRNA-ligase was used as reference gene. Delta–delta Ct values of genes were presented as relative fold induction.

Volume and parasitemia assessment via FACS

Flow cytometry analysis was performed essentially as described previously³⁹. For volume assessment, cells were washed in PBS buffer (pH 7.4). Infected-erythrocytes were stained with dihydroethidium (DHE-Sigma) at a 1:1000 dilution. After 30 min, samples were diluted 1:5 and measured by flow cytometric analysis (FACSCalibur, Becton Dickinson, Heidelberg, Germany). The fluorescence intensity of dihydroethidine was measured in fluorescence channel FL-2. Cell volume was determined by forward-and side-scatter analysis of unstained cells. For parasitemia assessment, parasites were incubated at 0.1% parasitemia in 0.5 mL RPMI 1640 containing 0.5% albumax for 6 days. Infected RBCs were collected each 48 h, stained with YOYO-1 and parasitemia was assessed by FACS⁴⁰. To assess the number of merozoites in each schizont, a synchronized culture was maintained in RPMI containing 0.5% albumax until the development in segmented schizonts, at least 20 schizonts were assessed in each slide. The experiment was repeated 3 independent times.

Volume assessment via spectrophotometer

The protocol used was adapted from⁴¹. Parasites were synchronized with 5% sorbitol. 24 h after synchronization, parasites were isolated from RBCs with saponin 0.3% in PBS and incubated in Buffer A with 2 mM CaCl₂ at 37 °C in Flexstation 3 fluorimeter (Molecular Devices). 50 mM sucrose in buffer A was added and absorbance at 550 nm was assessed upon sucrose addition. Data was normalized by the first absorbance reading of each graphic.

Measurement of glucose 6-phosphate dehydrogenase (G6PD)-activity

The levels of G6PDH- activity were performed according to the manufacturer’s protocols for G6PD assay kit (ab102529, Abcam, Cambridge, MA, USA.]. Sorbitol synchronized trophozoite stage parasites (haematocrit: 2.5%, parasitaemia: 5%) under normal culture conditions were washed with PBS twice and 10⁸ RBC were seeded into a poly-L-lysine-coated 96 well plate. Samples and their controls, and the standard curve for NADPH were read at 450 nm on the FlexStation3.

Hemozoin area measurements in P. falciparum-infected RBCs

The hemozoin size measurement was performed as previously described⁴². Briefly, P. falciparum-infected erythrocytes (wild type and PfSR25 ⁻ parasites) were incubated with 10 µM piperaquine for 2 hours at 37 °C. After, the parasites were washed with PBS and placed in a slide that had been previously pre-treated with poly-L-lysine to ensure adhesion of the cells. The images were acquired in an Axio Scope A.1 microscope (Carl Zeiss) and analyzed with Zen software. The objective used was a 100x N-Achroplan with immersion oil.

Statistical analyses

Each experiment was performed at least three times. The data shown are those of a representative experiment. Statistical significance was evaluated with One-Way ANOVA test and Newman-Keuls post-test, and all comparisons with p value less than 0.05 (p < 0.05) were considered statistically significant. The data are expressed as the mean ± SEM.

References

Snow, R. W., Guerra, C. A., Noor, A. M., Myint, H. Y. & Hay, S. I. The global distribution of clinical episodes of Plasmodium falciparum malaria. Nature 434, 214–217, doi:10.1038/nature03342 (2005).
Article ADS CAS PubMed PubMed Central Google Scholar
Liu, L. et al. Global, regional, and national causes of child mortality in 2000-13, with projections to inform post-2015 priorities: an updated systematic analysis. Lancet 385, 430–440, doi:10.1016/S0140-6736(14)61698-6 (2015).
Article PubMed Google Scholar
Cowman, A. F. & Crabb, B. S. Invasion of red blood cells by malaria parasites. Cell 124, 755–766, doi:10.1016/j.cell.2006.02.006 (2006).
Article CAS PubMed Google Scholar
Gazarini, M. L., Thomas, A. P., Pozzan, T. & Garcia, C. R. Calcium signaling in a low calcium environment: how the intracellular malaria parasite solves the problem. J Cell Biol 161, 103–110, doi:10.1083/jcb.200212130 (2003).
Article CAS PubMed PubMed Central Google Scholar
Holder, A. A., Mohd Ridzuan, M. A. & Green, J. L. Calcium dependent protein kinase 1 and calcium fluxes in the malaria parasite. Microbes Infect 14, 825–830, doi:10.1016/j.micinf.2012.04.006 (2012).
Article CAS PubMed Google Scholar
Kumar, K. A. et al. Exposure of Plasmodium sporozoites to the intracellular concentration of potassium enhances infectivity and reduces cell passage activity. Mol Biochem Parasitol 156, 32–40, doi:10.1016/j.molbiopara.2007.07.004 (2007).
Article CAS PubMed Google Scholar
Singh, S., Alam, M. M., Pal-Bhowmick, I., Brzostowski, J. A. & Chitnis, C. E. Distinct external signals trigger sequential release of apical organelles during erythrocyte invasion by malaria parasites. PLoS Pathog 6, e1000746, doi:10.1371/journal.ppat.1000746 (2010).
Article PubMed PubMed Central Google Scholar
Madeira, L. et al. Genome-wide detection of serpentine receptor-like proteins in malaria parasites. PLoS One 3, e1889, doi:10.1371/journal.pone.0001889 (2008).
Article ADS PubMed PubMed Central Google Scholar
Al-Olayan, E. M., Williams, G. T. & Hurd, H. Apoptosis in the malaria protozoan, Plasmodium berghei: a possible mechanism for limiting intensity of infection in the mosquito. Int J Parasitol 32, 1133–1143 (2002).
Article CAS PubMed Google Scholar
Picot, S., Burnod, J., Bracchi, V., Chumpitazi, B. F. & Ambroise-Thomas, P. Apoptosis related to chloroquine sensitivity of the human malaria parasite Plasmodium falciparum. Trans R Soc Trop Med Hyg 91, 590–591 (1997).
Article CAS PubMed Google Scholar
Deponte, M. & Becker, K. Plasmodium falciparum–do killers commit suicide? Trends Parasitol 20, 165–169, doi:10.1016/j.pt.2004.01.012 (2004).
Article CAS PubMed Google Scholar
Varotti, F. P., Beraldo, F. H., Gazarini, M. L. & Garcia, C. R. Plasmodium falciparum malaria parasites display a THG-sensitive Ca²⁺ pool. Cell Calcium 33, 137–144 (2003).
Article CAS PubMed Google Scholar
Ghigo, D. et al. Chloroquine stimulates nitric oxide synthesis in murine, porcine, and human endothelial cells. J Clin Invest 102, 595–605, doi:10.1172/JCI1052 (1998).
Article CAS PubMed PubMed Central Google Scholar
Xu, Y. et al. Glucose-6-phosphate dehydrogenase-deficient mice have increased renal oxidative stress and increased albuminuria. FASEB J 24, 609–616, doi:10.1096/fj.09-135731 (2010).
Article CAS PubMed PubMed Central Google Scholar
Harris, E. D. Regulation of antioxidant enzymes. FASEB J 6, 2675–2683 (1992).
CAS PubMed Google Scholar
Stanton, R. C. Glucose-6-phosphate dehydrogenase, NADPH, and cell survival. IUBMB Life 64, 362–369, doi:10.1002/iub.1017 (2012).
Article CAS PubMed PubMed Central Google Scholar
Syin, C. et al. The H89 cAMP-dependent protein kinase inhibitor blocks Plasmodium falciparum development in infected erythrocytes. Eur J Biochem 268, 4842–4849 (2001).
Article CAS PubMed Google Scholar
Lasonder, E. et al. The Plasmodium falciparum schizont phosphoproteome reveals extensive phosphatidylinositol and cAMP-protein kinase A signaling. J Proteome Res 11, 5323–5337, doi:10.1021/pr300557m (2012).
Article CAS PubMed Google Scholar
Alves, E., Bartlett, P. J., Garcia, C. R. & Thomas, A. P. Melatonin and IP3-induced Ca²⁺ release from intracellular stores in the malaria parasite Plasmodium falciparum within infected red blood cells. J Biol Chem 286, 5905–5912, doi:10.1074/jbc.M110.188474 (2011).
Article CAS PubMed Google Scholar
Lovett, J. L., Marchesini, N., Moreno, S. N. & Sibley, L. D. Toxoplasma gondii microneme secretion involves intracellular Ca(2+) release from inositol 1,4,5-triphosphate (IP(3))/ryanodine-sensitive stores. J Biol Chem 277, 25870–25876, doi:10.1074/jbc.M202553200 (2002).
Article CAS PubMed Google Scholar
Garcia, C. R. et al. InsP3 Signaling in Apicomplexan Parasites. Curr Top Med Chem (2017).
Huang, G., Bartlett, P. J., Thomas, A. P., Moreno, S. N. & Docampo, R. Acidocalcisomes of Trypanosoma brucei have an inositol 1,4,5-trisphosphate receptor that is required for growth and infectivity. Proc Natl Acad Sci USA 110, 1887–1892, doi:10.1073/pnas.1216955110 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
Hashimoto, M. et al. Inositol 1,4,5-trisphosphate receptor regulates replication, differentiation, infectivity and virulence of the parasitic protist Trypanosoma cruzi. Mol Microbiol 87, 1133–1150, doi:10.1111/mmi.12155 (2013).
Article CAS PubMed Google Scholar
Bargieri, D. Y. et al. Apical membrane antigen 1 mediates apicomplexan parasite attachment but is dispensable for host cell invasion. Nat Commun 4, 2552, doi:10.1038/ncomms3552 (2013).
Article PubMed PubMed Central Google Scholar
Vaid, A., Thomas, D. C. & Sharma, P. Role of Ca2+/calmodulin-PfPKB signaling pathway in erythrocyte invasion by Plasmodium falciparum. J Biol Chem 283, 5589–5597, doi:10.1074/jbc.M708465200 (2008).
Article CAS PubMed Google Scholar
Green, J. L. et al. The motor complex of Plasmodium falciparum: phosphorylation by a calcium-dependent protein kinase. J Biol Chem 283, 30980–30989, doi:10.1074/jbc.M803129200 (2008).
Article CAS PubMed PubMed Central Google Scholar
Warhurst, D. C. & Thomas, S. C. Pharmacology of the malaria parasite–a study of dose-response relationships in chloroquine-induced autophagic vacuole formation in Plasmodium berghei. Biochem Pharmacol 24, 2047–2056 (1975).
Article CAS PubMed Google Scholar
Totino, P. R., Daniel-Ribeiro, C. T., Corte-Real, S. & de Fatima Ferreira-da-Cruz, M. Plasmodium falciparum: erythrocytic stages die by autophagic-like cell death under drug pressure. Exp Parasitol 118, 478–486, doi:10.1016/j.exppara.2007.10.017 (2008).
Article CAS PubMed Google Scholar
Trager, W. & Jensen, J. B. Human malaria parasites in continuous culture. Science 193, 673–675 (1976).
Article ADS CAS PubMed Google Scholar
Ofulla, A. V. et al. Cultivation of Plasmodium falciparum parasites in a serum-free medium. Am J Trop Med Hyg 49, 335–340 (1993).
Article CAS PubMed Google Scholar
Lambros, C. & Vanderberg, J. P. Synchronization of Plasmodium falciparum erythrocytic stages in culture. J Parasitol 65, 418–420 (1979).
Article CAS PubMed Google Scholar
Wickham, M. E., Culvenor, J. G. & Cowman, A. F. Selective inhibition of a two-step egress of malaria parasites from the host erythrocyte. J Biol Chem 278, 37658–37663, doi:10.1074/jbc.M305252200 (2003).
Article CAS PubMed Google Scholar
Janse, C. J. et al. Plasmodium berghei: gametocyte production, DNA content, and chromosome-size polymorphisms during asexual multiplication in vivo. Exp Parasitol 68, 274–282 (1989).
Article CAS PubMed Google Scholar
Janse, C. J. & Waters, A. P. Plasmodium berghei: the application of cultivation and purification techniques to molecular studies of malaria parasites. Parasitol Today 11, 138–143 (1995).
Article CAS PubMed Google Scholar
Tonkin, C. J. et al. Localization of organellar proteins in Plasmodium falciparum using a novel set of transfection vectors and a new immunofluorescence fixation method. Mol Biochem Parasitol 137, 13–21, doi:10.1016/j.molbiopara.2004.05.009 (2004).
Article CAS PubMed Google Scholar
Dorin-Semblat, D., Sicard, A., Doerig, C., Ranford-Cartwright, L. & Doerig, C. Disruption of the PfPK7 gene impairs schizogony and sporogony in the human malaria parasite Plasmodium falciparum. Eukaryot Cell 7, 279–285, doi:10.1128/EC.00245-07 (2008).
Article CAS PubMed Google Scholar
Kooij, T. W., Rauch, M. M. & Matuschewski, K. Expansion of experimental genetics approaches for Plasmodium berghei with versatile transfection vectors. Mol Biochem Parasitol 185, 19–26, doi:10.1016/j.molbiopara.2012.06.001 (2012).
Article CAS PubMed Google Scholar
Nkhoma, S., Molyneux, M. & Ward, S. In vitro antimalarial susceptibility profile and prcrt/pfmdr-1 genotypes of Plasmodium falciparum field isolates from Malawi. Am J Trop Med Hyg 76, 1107–1112 (2007).
CAS PubMed Google Scholar
Cruz, L. N. et al. Extracellular ATP triggers proteolysis and cytosolic Ca(2)(+) rise in Plasmodium berghei and Plasmodium yoelii malaria parasites. Malar J 11, 69, doi:10.1186/1475-2875-11-69 (2012).
Article CAS PubMed PubMed Central Google Scholar
Schuck, D. C., Ribeiro, R. Y., Nery, A. A., Ulrich, H. & Garcia, C. R. Flow cytometry as a tool for analyzing changes in Plasmodium falciparum cell cycle following treatment with indol compounds. Cytometry A 79, 959–964, doi:10.1002/cyto.a.21136 (2011).
Article PubMed Google Scholar
Rohloff, P., Rodrigues, C. O. & Docampo, R. Regulatory volume decrease in Trypanosoma cruzi involves amino acid efflux and changes in intracellular calcium. Mol Biochem Parasitol 126, 219–230 (2003).
Article CAS PubMed Google Scholar
Alves, E. et al. Encapsulation of metalloporphyrins improves their capacity to block the viability of the human malaria parasite Plasmodium falciparum. Nanomedicine 11, 351–358, doi:10.1016/j.nano.2014.09.018 (2015).
Article CAS PubMed Google Scholar
Mwai, L. et al. Genome wide adaptations of Plasmodium falciparum in response to lumefantrine selective drug pressure. PLoS One 7, e31623, doi:10.1371/journal.pone.0031623 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

This work was supported by grants from FAPESP (Fundação de Amparo a Pesquisa de São Paulo Process 11/51295-5), NUSCEP to CRSG. AB (2006/61341-6), JLG (2008/50215-5) and LBP (2010/51593-3) are FAPESP fellows, MSM and MKS are CAPES fellows. We are grateful to Hemocentro Hospital do Servidor Público for providing blood and plasma. We thank Christian Doerig for providing the pCAM-BSD knockout plasmid for P. falciparum.

Author information

Miriam S. Moraes, Alexandre Budu and Maneesh K. Singh contributed equally to this work.

Authors and Affiliations

Departamento de Fisiologia, Instituto de Biociências, Universidade de São Paulo, Sao Paulo, SP, 05508-090, Brazil
Miriam S. Moraes, Alexandre Budu, Maneesh K. Singh, Lucas Borges-Pereira, Julio Levano-Garcia, Chiara Currà & Célia R. S. Garcia
Departamento de Parasitologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, Sao Paulo, 05508-000, Brazil
Miriam S. Moraes, Alexandre Budu, Maneesh K. Singh & Lucas Borges-Pereira
Foundation for Research and Technology-Hellas, Institute of Molecular Biology and Biotechnology, N. Plastira 100, GR 700 13, Heraklion, Greece
Chiara Currà
Istituto Superiore di Sanita, Dipartimento di Malattie Infettive, Parassitarie ed Immunomediate, 0161, Roma, Italy
Leonardo Picci, Tomasino Pace & Marta Ponzi
Department of Biomedical Sciences, University of Padova, Institute of Neuroscience, Padova, Unit, National Research Council, Venetian Institute of Molecular Medicine, Padova, Italy
Tullio Pozzan

Authors

Miriam S. Moraes
View author publications
You can also search for this author in PubMed Google Scholar
Alexandre Budu
View author publications
You can also search for this author in PubMed Google Scholar
Maneesh K. Singh
View author publications
You can also search for this author in PubMed Google Scholar
Lucas Borges-Pereira
View author publications
You can also search for this author in PubMed Google Scholar
Julio Levano-Garcia
View author publications
You can also search for this author in PubMed Google Scholar
Chiara Currà
View author publications
You can also search for this author in PubMed Google Scholar
Leonardo Picci
View author publications
You can also search for this author in PubMed Google Scholar
Tomasino Pace
View author publications
You can also search for this author in PubMed Google Scholar
Marta Ponzi
View author publications
You can also search for this author in PubMed Google Scholar
Tullio Pozzan
View author publications
You can also search for this author in PubMed Google Scholar
Célia R. S. Garcia
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

T.P. and C.R.S.G. designed research and suggested the experiments. M.S.M., A.B., M.K.S., J.L.-G., L.B.-P., C.C.L.P., and T.P. performed the experiments and analyzed the data. T.P. and C.R.S.G. discuss the results. All the authors contributed in writing the paper.

Corresponding author

Correspondence to Célia R. S. Garcia.

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Supplementary material

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Moraes, M.S., Budu, A., Singh, M.K. et al. Plasmodium falciparum GPCR-like receptor SR25 mediates extracellular K⁺ sensing coupled to Ca²⁺ signaling and stress survival. Sci Rep 7, 9545 (2017). https://doi.org/10.1038/s41598-017-09959-8

Download citation

Received: 16 May 2017
Accepted: 01 August 2017
Published: 25 August 2017
DOI: https://doi.org/10.1038/s41598-017-09959-8

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.