Table 1 Summary of six miRNAs selected as candidates for EMT-suppressive miRNAs in functional-based screening using stable Panc1 clones transfected with a reporter construct containing a promoter sequence of CDH1/E-cadherin in the upstream region of the ZsGreen1 reporter gene and Pre-miRTM miRNA Precursor Library - Human V15 (Ambion).

From: miR-509-5p and miR-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer

Pre-miRTM miRNA Precursor Mature Sequence Ratio of fluorescence intensity of ZsGreen1 (RFI)# Ratio of growth level (RG)## Relative fluorescence intensity (RFI/RG)
Panc1#1 Panc1#2 Panc1#1 Panc1#2 Panc1#1 Panc1#2
hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA 3.362 1.594 1.072 0.941 3.121 1.825
hsa-miR-367* ACUGUUGCUAAUAUGCAACUCU 2.176 1.206 0.939 0.754 2.317 1.620
hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG 1.153 1.237 0.691 0.740 1.671 1.659
hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA 1.603 1.136 0.980 0.810 1.635 1.405
hsa-miR-660 UACCCAUUGCAUAUCGGAGUUG 1.153 1.481 0.804 1.036 1.438 1.439
hsa-miR-1243 AACUGGAUCAAUUAUAGGAGUG 1.247 1.118 0.799 0.656 1.600 1.705
  1. #RFI in cells 72 hours after transfection with each miRNA was normalized to that in miR-NC transfectants.
  2. ##RG of viable cells assessed by cristal biolet staining 72 hours after transfection with miRNAs. This assay was employed to normalize the number of viable cells relative to the control transfectants.