NKX6.3 Regulates Reactive Oxygen Species Production by Suppressing NF-kB and DNMT1 Activities in Gastric Epithelial Cells

Yoon, Jung Hwan; Kim, Olga; Nam, Suk Woo; Lee, Jung Young; Park, Won Sang

doi:10.1038/s41598-017-02901-y

Download PDF

Article
Open access
Published: 05 June 2017

NKX6.3 Regulates Reactive Oxygen Species Production by Suppressing NF-kB and DNMT1 Activities in Gastric Epithelial Cells

Jung Hwan Yoon¹,
Olga Kim¹,
Suk Woo Nam^1,2,
Jung Young Lee^1,2 &
…
Won Sang Park^1,2

Scientific Reports volume 7, Article number: 2807 (2017) Cite this article

1571 Accesses
8 Citations
1 Altmetric
Metrics details

Subjects

Abstract

NKX6.3 plays an important role in gastric epithelial differentiation and also acts as a gastric tumor suppressor. The specific aim of this study was to determine whether NKX6.3 contributes to gastric mucosal barrier function by regulating reactive oxygen species (ROS) production. NKX6.3 reduced ROS production and regulated expression of anti-oxidant genes, including Hace1. In addition, NKX6.3 reduced DNMT1 expression and activity by down-regulating NF-kB family gene transcription. Silencing of Hace1 recovered ROS production, whereas knock-down of DNMT1 and NF-kB reduced ROS production and induced Hace1 expression by hypomethylating its promoter region. In addition, NKX6.3 inhibited CagA effects on cell growth, ROS production, and NF-kB and DNMT1 activity. In gastric mucosae and cancers, NKX6.3 and Hace1 expression was significantly reduced. The NKX6.3 expression was positively correlated with Hace1 and Nrf2 genes, but negatively correlated with DNMT1. Hypermethylation of Hace1 gene was observed only in gastric mucosae with H. pylori, atrophy and intestinal metaplasia. Thus, these results suggest that NKX6.3 inhibits ROS production by inducing the expression of Hace1 via down-regulating NF-kB and DNMT1 activity in gastric epithelial cells.

KDM6B promotes gastric carcinogenesis and metastasis via upregulation of CXCR4 expression

Article Open access 23 December 2022

Fen Liu, Yue Wang, … Jihui Jia

RNA methyltransferase NSUN2 promotes gastric cancer cell proliferation by repressing p57Kip2 by an m5C-dependent manner

Article Open access 24 April 2020

Lin Mei, Cheng Shen, … Ji-Fu Wei

DNMT3A-mediated silence in ADAMTS9 expression is restored by RNF180 to inhibit viability and motility in gastric cancer cells

Article Open access 30 April 2021

Weilin Sun, Gang Ma, … Jingyu Deng

Introduction

Gastric cancer has a high incidence in Asia and is a leading cause of cancer death in the region¹. Cellular damage from various agents and chronic infection with H. pylori most likely influence the risk of gastric carcinogenesis through inflammation-induced reactive oxygen species (ROS) and reactive nitrogen species (RNS) leading to DNA damage in gastric epithelial cells and precancerous cascade including atrophic gastritis, intestinal metaplasia and dysplasia^2,3,4.

The ROS, including superoxide anion radical (•O₂ ⁻), hydrogen peroxide (H₂O₂), and hydroxyl radical (•OH), are highly reactive, diffusible, and ubiquitous molecules generated as inevitable by-products of aerobic respiration and metabolism⁵. In stomach, H. pylori infection induces a strong inflammatory host response, leading to the generation of several ROS and RNS via neutrophils and macrophages⁶. Imbalance between ROS production and the capacity for detoxification induces an alteration of gene expression⁷, increased cell death and proliferation, and induction of DNA mutation⁸. Notably, cancer cells augment intracellular ROS, which contributes to tumorigenesis and cancer progression by promoting genomic instability through increased DNA damage and reduced mismatch repair⁹. However, as excessive levels of ROS stress can induce cancer cell cycle arrest and apoptosis, cancer cells also increase expression of anti-oxidant proteins to detoxify from ROS and anti-apoptotic proteins¹⁰. Thus, manipulating the unique redox regulatory mechanisms of cancer cells might be an effective strategy to eliminate these cells¹¹.

Previously, we and others have reported that the novel transcription factor, NKX6.3¹², is a key factor for gastric differentiation and prevention of intestinal metaplasia and acts as a tumor suppressor for gastric cancer^13,14,15,16. ROS is reportedly involved in the development of precancerous gastritis and gastric cancer, hence, we hypothesized that NKX6.3 may protect the gastric mucosal epithelia from harmful ROS.

Herein, we examined the effects of NKX6.3 on ROS production and Hace1, Nrf2, mnSOD, catalase, GSH, Nqo1, and Ho-1 expression in mock and NKX6.3 stable AGS and MKN1 cells. In addition, the expression of NKX6.3, Hace1, Nrf2, and DNMT1 was compared between non-neoplastic gastric mucosae and gastric cancers. Overall, we found that NKX6.3 significantly decreased ROS production and regulated the expression of ROS-related genes, including Hace1, by suppressing DNMT1 and NF-kB activity. These results suggest that NKX6.3 plays an important role in gastric epithelial protection and gastric cancer prevention by regulating the ROS levels.

Results

NKX6.3 attenuates ROS production by regulating ROS-responsive genes

To determine whether NKX6.3 contributes to ROS production, we performed in vitro ROS analysis in AGS^Mock, MKN1^Mock, AGS^NKX6.3 and MKN1^NKX6.3 cells using DCFDA staining assay. Stable NKX6.3 expression in AGS and MKN1 cells showed reduced cellular ROS levels in a time-dependent manner, as compared to mock stable AGS and MKN1 cells (Fig. 1A–C). To further confirm these initial observations, we measured the expression levels of ROS-related genes, including Hace1, Nox1, Noxa1 and Nrf2, and oxidative stress-responsive genes, including catalase, mnSOD, GSH, Nqo1 and Ho-1 by real-time RT-PCR and western blotting. Interestingly, NKX6.3 induced the expression of Hace1, Nrf2, catalase, and mnSOD, while decreasing the expression of Nox1 and Noxa1 proteins. In addition, it also reduced the expression of GSH, Nqo1 and Ho-1 at the mRNA level (Fig. 1D and E). To further support our results, we recapitulated NKX6.3, Hace1 and Nrf2 gene expression patterns from large cohorts of gastric cancer patients available from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) database (accession numbers GSE27342). Interestingly, NKX6.3 expression was positively correlated with Hace1 and Nrf2 expression in gastric cancer cohort (Supplementary Figure S1A). In addition, Hace1 and Nrf2 expression showed a positive correlation (Supplementary Figure S1A). Next, we aimed to determine whether the anti-oxidant activity of NKX6.3 is dependent on Hace1 expression. In AGS and MKN1 cells, treatment with siHace1 partially recovered ROS production (Fig. 2A) and markedly reduced Nrf2 expression (Fig. 2B). Also, Hace1 silencing in NKX6.3 stable cells decreased GSH, Nqo1 and Ho-1 mRNA expression (Fig. 2C) and showed moderate ablation of NKX6.3-induced cell growth inhibition (Fig. 2D). Thus, it is likely that NKX6.3 attenuates ROS production by Hace1-dependent or –independent regulation of ROS-mediated gene expression.

NKX6.3 induces expression of Hace1-HECT E3 ligase

The Hace1-HECT E3 ligase is a tumor suppressor that directly regulates ROS production, and its reduced expression due to promoter hypermethylation is frequently observed in several cancers^{17, 18}. Since NKX6.3 induced re-expression of Hace1 protein (Fig. 1D), we hypothesized that NKX6.3 functions as a hypomethylating agent. Expectedly, expression of Hace1 mRNA was markedly increased in NKX6.3 stable transfectants (Fig. 2E). Notably, hypermethylation of CpG islands on Hace1 promoter was observed in mock stable AGS and MKN1 cells, whereas de-methylation on Hace1 promoter was detected in NKX6.3 stable transfectants (Fig. 2F). Next, we evaluated the regulatory role of NKX6.3 in DNMT1 expression. As shown in Fig. 3A, NKX6.3 significantly down-regulated expression of DNMT1 mRNA and protein in AGS^NKX6.3 and MKN1^NKX6.3 cells. Knockdown of NF-kB, a transcription factor for DNMT1¹⁹, with siNF-kB markedly decreased DNMT1 expression at the mRNA and protein levels (Fig. 3B). ChIP assay results indicated that p50 binding to the DNMT1 gene promoter was significantly inhibited by NKX6.3, comparable with the effect of siNF-kB (Fig. 3C). In addition, NKX6.3 expression as well as NF-kB silencing significantly decreased DNMT1 activity (Fig. 3D). Knock-down of DNMT1 with shDNMT1 increased Hace1 mRNA and protein expression (Fig. 3E) and induced de-methylation of Hace1 gene in AGS and MKN1 cells (Fig. 3F). These findings collectively suggest that NKX6.3 induces Hace1 expression by suppressing DNMT1 activity.

NKX6.3 down-regulates NF-kB expression and activity

Next, we investigated whether NKX6.3 regulates NF-kB activity. Interestingly, NKX6.3 markedly down-regulated NF-kB p65 and p50 at the mRNA and protein levels (Fig. 4A–C). We performed ChIP assay, followed by PCR and real-time QPCR, to identify NKX6.3 binding activity within promoter sequences of the NF-kB p65 and p50 genes in AGS^Mock, MKN1^Mock, AGS^NKX6.3 and MKN1^NKX6.3 cells. We defined regions upstream of the NF-kB p65 (between −1872 to −1662 bp) and p50 (between −3640 to −3371 bp) genes, overlapping with the transcription start site (TSS) designated 0 bp with 6 and 5 NKX6.3 candidate binding sites (TAAT), respectively. NKX6.3 showed binding activity in these promoter regions of p65 and p50 in AGS and MKN1 cells (Fig. 4D and E). To further confirm that NKX6.3 down-regulates NF-kB expression, we analyzed NF-kB downstream target genes, including interleukin (IL)-6, IL-1β, and TNF-α. As expected, stable NKX6.3 expression markedly reduced IL-6, IL-8 and TNF-α mRNA expression (Supplementary Figure S2), indicating that NKX6.3 inhibits DNMT1 activity by down-regulating NF-kB activity at the transcriptional level.

Hace1 regulates NF-kB expression and activity

Next, we determined the regulatory role of Hace1 in NF-kB expression. As shown in Figure 5A–D, silencing of Hace1 with siHace1 increased expression of p65, p50 and DNMT1 at the mRNA and protein levels in NKX6.3 stable transfectants. In addition, DNMT1 activity was also increased in siHace1 transfected AGS^NKX6.3 and MKN1^NKX6.3 cells (Fig. 5E), suggesting that Hace1 is involved in NF-kB inactivation.

H. pylori CagA is an important factor for ROS production

Here, we examined the effects of H. pylori CagA on ROS production and expression of ROS-related genes. Expectedly, CagA significantly increased cell growth and ROS production in AGS and MKN1 cells, whereas NKX6.3 ablated the effects of CagA (Fig. 6A–C). To further confirm that CagA induces ROS production, we examined ROS levels in AGS cells by using the strain of H. pylori with or without CagA. As shown in Figure 6D, H. pylori with CagA significantly increased ROS production, but H. pylori without CagA did not affect ROS levels in AGS cells. Additionally, CagA increased the expression of NF-kB p65, p50 and DNMT1 proteins and induced loss of Hace1 expression, whereas NKX6.3 markedly inhibited CagA effects on protein expression (Fig. 6E). Furthermore, NKX6.3 suppressed CagA-induced DNMT1 activity and hypermethylation of Hace1 gene in AGS^NKX6.3 and MKN1^NKX6.3 cells (Fig. 6F,G). Our data suggest that NKX6.3 inactivates stimulatory effects of CagA on cell growth, ROS production, NF-kB signaling pathway, and DNMT1 activity in gastric epithelial cells.

Expression of NKX6.3, Hace1, and DNMT1 is closely associated in gastric mucosae and cancers

In 65 gastric cancer tissues, DNMT1 expression was significantly increased, whereas Hace1 expression was significantly reduced (Fig. 7A and B). NKX6.3 and Hace1 expression were positively correlated, while DNMT1 expression was inversely correlated with NKX6.3 and Hace1 expression in gastric cancer tissues (Fig. 7C–E). Consistently, NKX6.3, Hace1, and Nrf2 expression was reduced and showed positive correlation in the large cohorts of gastric cancer patients available from the NCBI GEO database (accession numbers GSE27342; Supplementary Figure S1).

In 55 non-neoplastic gastric mucosae, DNMT1 and Hace1 expression was increased and reduced, respectively, in gastric mucosae with H. pylori infection, atrophy and intestinal metaplasia (Fig. 7F and G). Non-neoplastic gastric mucosae also showed positive correlation between NKX6.3 and Hace1 expression and inverse correlation between DNMT1 and NKX6.3 expression (Fig. 7H and I). The methylation status of Hace1 promoter region was examined by MSP to confirm that reduced Hace1 mRNA expression in gastric mucosae is caused by hypermethylation of Hace1. Interestingly, Hace1 hypermethylation was observed only in the gastric mucosae with H. pylori infection, atrophy, and/or intestinal metaplasia (Fig. 7J), suggesting that NF-kB-induced DNMT1 expression caused by NKX6.3 inactivation may reduce Hace1 expression by hypermethylating the promoter region of Hace1 in the gastric mucosa.

Discussion

Gastric cancers develop as a consequence of chronic inflammation from persistent mucosal or epithelial cell colonization by microorganisms, including H. pylori ²⁰. Chronic inflammatory cells such as macrophages/monocytes, lymphocytes, and plasma cells are present in the gastric mucosa of chronic gastritis and lead to the generation of several ROS and RNS²¹. Persistent ROS can damage cellular DNA, RNA, and proteins by chemical reactions, which subsequently cause proto-oncogene activation, oncogene/tumor suppressor gene mutations, and chromosomal aberrations^{22, 23}. In stomach, H. pylori and ROS collaborate in the gastric epithelium to activate the NF-κB and AP-1 transcription factors that up-regulate the expression of chemokines, including IL-8^{24, 25}, and in turn, NF-kB-dependent genes play a major role in regulating the cellular ROS levels²⁶. Recently, we and others reported that NKX6.3 acts as a master regulator in gastric differentiation and proliferation^12,13,14. Since the gastric mucosal barrier may protect the host from potentially harmful agents to maintain cell survival, we focused on the role of NKX6.3 in the protection of the gastric mucosal epithelia from harmful ROS.

It is well known that Hace1 functions as an important component of the cellular ROS detoxification and anti-oxidative stress responses by facilitating optimal activation of Nrf2²⁷. Here, we showed that NKX6.3 reduced intracellular ROS and modulated the expression of ROS-related genes (Fig. 1). Of these, NKX6.3 induced expression of Hace1 and Nrf2 proteins in gastric cancer cells (Fig. 1D) and showed positive correlation with Hace1 and Nrf2 in the gastric cancer cohort (Supplementary Figure S1). In addition, Hace1 silencing with siHace1 recovered ROS production and reduced Nrf2, GSH, Nqo and Ho-1 expression (Fig. 2A–C). Furthermore, knock-down of Hace1 ablated NKX6.3-induced cell growth inhibitory activity (Fig. 2D). Taken together, these results suggest that NKX6.3 plays an important role in suppression of ROS production by regulating expression of ROS-related genes, especially Hace1.

NKX6.3 increased Hace1 expression and was positively correlated with Hace1, suggestive of direct regulation of Hace1 expression. Since Hace1 expression is significantly reduced by promoter hypermethylation in most cancer patients¹⁷, we investigated whether DNMT1 regulates Hace1 expression in gastric epithelial cells. NF-kB reportedly binds to one possible NF-kB binding element in the DNMT1 promoter and DNMT1 mediates NF-kB-dependent p16 gene promoter hypermethylation¹⁹. Here, we showed that NKX6.3 induced Hace1 promoter demethylation and increased its expression (Fig. 2E and F) by down-regulating DNMT1 expression via inhibiting p50 binding in the promoter region of DNMT1 gene (Fig. 3C). In addition, the effect of NKX6.3 on DNMT1 activity was comparable with that of siNF-kB treatment (Fig. 3D). Furthermore, DNMT1 silencing with siDNMT1 led to demethylation of Hace1 and increased its expression at the mRNA and protein levels (Fig. 3E and F). These results suggest that NKX6.3 induces Hace1 expression by inhibiting DNMT1 expression and activity.

Next, we investigated whether NKX6.3 regulates NF-kB, which is constitutively activated in most cancers²⁸. NF-κB consists of a family of transcription factors, including p65 (RelA), p50 (RelB), c-Rel, p105/p50 (NF-κB1), and p100/p52 (NF-κB2), which play critical roles in inflammation, immunity, cell proliferation and survival²⁹. The amino-terminus of the Rel homology domain in p50 homo- and p50/p65 heterodimers mediates specific DNA binding to the NF-κB consensus sequence present in regulatory elements of NF-κB target genes^30,31,32. NKX6.3 significantly reduced p65 and p50 expression at the mRNA and protein levels (Fig. 4A–C). In particular, the promoter regions of p65 and p50 have 6 and 5 NKX6.3 candidate binding sites, respectively (Fig. 4D), and the binding activity of NKX6.3 to these regions was confirmed in ChIP analysis (Fig. 4E). In addition, NKX6.3 markedly reduced the expression of NF-κB target genes including IL-6, IL-8 and TNF- α (Supplementary Figure S2). In addition, silencing of Hace1 with siHace1 increased the expression of p65, p50 and DNMT1 and activity of DNMT1 (Fig. 5). Thus, these data indicate that NKX6.3 and Hace1 negatively control NF-kB expression and activity.

It has been reported that H. pylori induces the production of ROS and DNA damage in gastric epithelial cells and frequently causes chromosomal aberrations^{33, 34}. Previously, we showed that H. pylori CagA increased the expression of NF-kB proteins and ROS levels in gastric cancer cells³⁵. In the current study, CagA significantly increased cell growth and ROS production in AGS^Mock and MKN1^Mock cells, whereas NKX6.3 ablated these CagA effects by down-regulating NF-kB p65, p50 and DNMT1 and up-regulating Hace1 expression (Fig. 6A–F). These findings suggest that NKX6.3 may counteract CagA-induced NF-kB activity in gastric epithelial cells.

Damage to cellular components results in increased mutations and altered functions of important proteins in premalignant tissues, thereby contributing to the multi-stage carcinogenesis³⁶. Chronic inflammation of gastric mucosa triggers a pathway of chronic gastritis, atrophy, intestinal metaplasia, dysplasia, which finally progress to gastric cancer³⁷. H. pylori, especially CagA strains, is considered as the most important risk factor of atrophy and intestinal metaplasia^{38, 39}. In gastric cancer tissue, NKX6.3 and Hace1 expression showed a positive correlation, while DNMT1 expression was inversely correlated with NKX6.3 and Hace1 (Fig. 7A–E). The NCBI GEO database also showed reduced NKX6.3, Hace1 and Nrf2 expression and a positive correlation between these genes (Supplementary Figure S1). In non-neoplastic gastric mucosae with H. pylori infection, atrophy and intestinal metaplasia, DNMT1 mRNA was increased, whereas Hace1 mRNA was reduced. (Fig. 7F and G). NKX6.3 expression was positively and inversely correlated with Hace1 and DNMT1, respectively (Figure H and I). Interestingly, Hace1 hypermethylation was observed only in the gastric mucosae with H. pyori infection, atrophy, and/or intestinal metaplasia (Fig. 7J). Thus, NKX6.3 inactivation in gastric mucosa may increase activity of NF-kB and DNMT1 and reduce Hace1 expression, subsequently progressing to atrophy, intestinal metaplasisa and cancer.

In conclusion, NKX6.3 induced Hace1 expression by suppressing DNMT1 expression and activity via down-regulating the NF-kB signaling pathway. In addition, NKX6.3 ablated CagA effects on cell proliferation, ROS production, and activities of DNMT1 and NF-kB signaling pathway. Overall, we conclude that NKX6.3 protects gastric mucosal epithelia by regulating harmful ROS production. Modulation of NKX6.3 anti-oxidant activity could contribute to the prevention of precancerous changes in gastric mucosa and gastric cancer.

Materials and Methods

Cell culture and generation of NKX6.3 stable cells

AGS and MKN1 gastric cancer cell lines were cultured at 37 °C in 5% CO₂ in RPMI-1640 medium (Lonza, Basel, Switzerland) with 10% heat-inactivated fetal bovine serum (FBS). NKX6.3 and CagA cDNAs were cloned into the pcDNA3.1 expression vectors (Invitrogen, Carlsbad, CA, USA) and siHACE1, siDNMT1, and siNF-kB were cloned into pSilencer neo vectors (Invitrogen, Carlsbad, CA, USA). We generated stable NKX6.3 transfectants of AGS and MKN1 cells, AGS^NKX6.3 and MKN1^NKX6.3, stably expressing human NKX6.3, as well as mock transfectants, AGS^Mock and MKN1^Mock cells, as described previously¹³. AGS^NKX6.3 and MKN1^NKX6.3 cells were transfected in 60 mm-diameter dishes with the expression plasmids (2 μg total DNA) using Lipofectamine Plus transfection reagent (Invitrogen) according to the manufacturer’s recommendations. Stable expression of NKX6.3 was confirmed in AGS^NKX6.3 and MKN1^NKX6.3 cells by western blot analysis.

Gastric mucosa and cancer tissue specimens

A total of 65 patients with sporadic gastric cancer who underwent a gastrectomy at the Chonnam National University Hwasun Hospital were enrolled. In addition, a total of 55 non-neoplastic frozen gastric mucosa remote (>5 cm) from gastric cancer were included in this study. Adjacent gastric mucosal tissues to each frozen specimen were also fixed in formalin and stained with hematoxylin-eosin. Informed consent was provided according to the Declaration of Helsinki. Written informed consent was obtained from all subjects. The study was approved by the Institutional Review Board of The Catholic University of Korea, College of Medicine (MC15SISI0015). There was no evidence of familial cancer in any of the patients.

Histological assessment of 55 non-neoplastic gastric mucosae was performed independently by two pathologists. According to the updated Sydney system^{40, 41}, gastritis was determined by polymorphonuclear leukocyte infiltration, mononuclear cell infiltration, glandular atrophy and intestinal metaplasia, as previously described¹⁴. Infection with a CagA-positive strain of H. pylori was determined by the presence of CagA protein in 55 gastric mucosa tissue samples using western blot analysis, as described previously³⁵.

Measurement of cell viability and proliferation

Cell viability was determined in AGS and MKN1 gastric cancer cells after treatment with siHace1 or H. pylori CagA transfection. To assess cell viability, a MTT [3-(4,5 dimethylthiazol-2-yl)−2,5-diphenyltetrazoliumbromide] assay was performed at 24, 48, 72, and 96 hrs following transfection with siHace1 and CagA in mock, AGS^Mock and MKN1^Mock cells, and NKX6.3 stable transfectants, AGS^NKX6.3 and MKN1^NKX6.3 cells. Absorbance was measured at 540 nm using a spectrophotometer and viability was expressed relative to the mock control.

For cell proliferation assay, a BrdU incorporation assay was performed at 24, 48, 72, and 96 hrs following transfection with CagA in mock and NKX6.3 stable cells using the BrdU cell proliferation assay kit (Millipore, Billerica, MA, USA), according to the manufacturer’s instruction. Absorbance was measured using a spectrophotometer at 450 nm and proliferation was expressed relative to the mock control.

Expression of ROS-related genes in gastric cancer cell lines and tissues

Expression of NKX6.3, Hace1, and DNMT1 was examined in 65 frozen gastric cancers, corresponding non-cancerous gastric mucosal tissues and 2 gastric cancer cell lines by real-time RT-PCR and Western blot analysis. After quantification of mRNA extracted from cancer tissues and non-cancerous gastric mucosae, cDNA was synthesized using the reverse transcription kit from Roche Molecular System (Roche, Mannheim, Germany), according to the manufacturer’s protocol. For QPCR, 50 ng cDNA was amplified using Fullvelocity SYBR Green QPCR Master Mix (Stratagene, La Jolla, CA, USA) and 20 pmol/μl of each primer (forward and reverse) using Stratagene Mx 3000 P QPCR system, according techniques previously published³⁹. NKX6.3, Hace1, and DNMT1 mRNAs were quantified by SYBR Green Q-PCR and normalized to mRNA of the β-actin. Sequences of the primers are described in Supplementary Table S1. Data are reported as relative quantities according to an internal calibrator using the 2^−△△CT method⁴². All samples were tested in duplicate, and the mean values were used for quantification. In addition, the relation between expression levels of ROS-related genes and gastritis parameters, such as atrophy, intestinal metaplasia and H. pylori infection was also examined in 55 non-neoplastic gastric mucosae.

To investigate whether ablation of NKX6.3 is associated with ROS production, the expression of NF-kB, Hace1, DNMT1, GSH, Nqo1, and Ho-1 mRNA were analyzed using real-time RT-PCR in AGS^Mock, MKN1^Mock, AGS^NKX6.3, and MKN1^NKX6.3 cells. The effects of Hace1 silencing with siHace1 on the expression of ROS-related genes were also examined. To further confirm that NKX6.3 regulates NF-kB activity, we analyzed mRNA transcript expression of IL-6, IL-8, and TNF-α, which are downstream targets of the NF-kB⁴³. Each mRNA was quantified by SYBR Green QPCR and normalized to mRNA of the housekeeping gene, β-actin. The primer sequences are described in Supplementary Table S1.

For Western blot analysis, the samples were ground to very fine powder in liquid nitrogen using a pestle and mortar, suspended in an ice-cold Nonidet P-40 lysis buffer supplemented with a 1x protease inhibitor mix (Roche). Cell lysates were separated on 10% polyacrylamide gel and blotted onto a Hybond-PVDF transfer membrane (Amersham), which had been subsequently probed with specific antibodies, and then incubated with anti-mouse IgG conjugated with horseradish peroxidase. The list of antibodies is described in Supplementary Table S2. The protein bands were detected using enhanced chemiluminescence Western blotting detection reagents (Amersham).

Methylation status of Hace1

Methylation analysis was carried out in 55 frozen non-neoplastic gastric mucosae and 2 gastric cancer cell lines after transfection with NKX6.3. Methylation status of the promoter region of the Hace1 gene was determined using sodium bisulfite treatment of the DNA followed methylation specific PCR (MSP), as described in the literature with minor modifications¹⁷. 5 μl of the bisulfite-modified DNA was subjected to MSP using two sets of primers for methylated and unmethylated Hace1. The primer sequences are described in Supplementary Table S1. PCR was performed in a total volume of 30 μl, containing 5 μl of the template DNA, 0.5 μM of each primer, 0.2 μM of each dNTP, 1.5 mM MgCI₂, 0.4 unit of Ampli Taq gold polymerase (Perkin-Elmer) and 3 μl of 10X buffer. The reaction solution was initially denatured for 1 min at 95 °C. Amplification was carried out for 40 cycles of 30 s at 95 °C, 30 s at 58 °C and 30 s at 72 °C, followed by a final 5 min extension at 72 °C. Each PCR product was loaded directly onto 2% agarose gels, stained with ethidium bromide and visualized under UV illumination.

Generation of CagA gene deleted H. pylori strains

The isogenic mutant H. pylori 26695 (∆cagA::aphA), in which most of the cagA gene was replaced by a aphA (kanamycin resistant gene from pIP1433) cassette, was made using PCR products generated with primers “kanF” (5′-GATAAACCCAGCGAACCAT) and “aphAR” (5′-GTACTAAAACAATTCATCCAGTAA) (1402 bp; aphA kanamycin resistance cassette); “cagA F1” (5′-ATCGTTGATAAGAACGATAGGG)and “cagA R2” (5′-ATGGTTCGCTGGGTTTATCATTGATTGCTTCTTTGACATCGGTACCAAGCGACCCAAATAG) (552 bp, upstream of deleted cagA segment); “cagA F5” (5′TTACTGGATGAATTGTTTTAGTACATCAAATAGCAAGTGGTTTGGGAATGACCTACTTAACAAAATCATG-) and “cagA R6” (5′-ATTGCTATTAATGCGTGTGTGG) (425 bp; downstream of deleted cagA segment). Natural transformation was carried out by adding 7 μl of purified PCR product containing this ΔcagA::aphA allele to a lawn of cells (wild type H. pylori 26695) growing exponentially on nonselective medium, and re-streaking the population on selective medium (containing 15 μg/ml of kanamycin) after 6–8 hrs or overnight incubation to obtain transformant colonies. PCR tests and sequencing of representative kan^r transformants demonstrated expected replacement of cagA by aphA in each case.

Reactive oxygen species (ROS) analysis

ROS levels were determined in mock or NKX6.3 stable AGS and MKN1 cells using 2′-7′-dichlorodihydrofluorescein diacetate (DCFDA). The AGS and MKN1 cells were incubated with 10 uM DCFDA at 37 °C for 20 min and rinsed twice with cold PBS, then trypsinized and subjected to FACScan flow cytometer. To determine the effects of H. pylori CagA on ROS production, the ROS levels were examined in H. pylori with/without CagA- infected AGS cells at 12 hrs as well as in mock and NKX6.3 stable AGS and MKN1 cells at 72 hrs after transfection with H. pylori CagA. DCF fluorescence was measured by FACS analysis and intensity was plotted against the number of cells. Additionally, cells were incubated with 10 uM DCFDA at 37 °C for 20 min and quickly washed with cold PBS, and photos of representative fluorescent fields were taken under an inverted microscope.

Chromatin immunoprecipitation (ChIP) analysis

For assessing the NKX6.3 binding activity in the promoter region of NF-kB p65 and p50, ChIP assays were performed using the Thermo Scientific Pierce Agarose ChIP kit (Thermo Scientific Pierce, Rockford, IL, USA), as previously described¹³. Briefly, AGS^Mock, MKN1^Mock, AGS^NKX6.3 and MKN1^NKX6.3 cells were cultured in a 10-cm dish for 4 days. The cells were fixed with 1% formaldehyde in PBS for 10 min, washed twice with ice-cold PBS and re-suspended in lysis buffer. Nuclei were recovered by centrifugation and MNase digestion was carried out at 37 °C for 15 min. Nuclei were lysed and the extracts were immunoprecipitated with 4 µg of antibody against NKX6.3 at 4 °C overnight. Normal rabbit IgG was used as the negative control. Protein-bound DNA was recovered using affinity chromatography purification columns according to the manufacturer’s protocol (Thermo Scientific), and 5 µl of lysed nuclei were also purified under the same procedure and used as input. DNA amplification was performed by PCR using specific primers for the promoters of NF-kB p65, p50 and DNMT1 genes, as described in Supplementary Table S1. Amplification products were separated on a 2% agarose gel.

Measurement of DNMT1 activity

The DNMT1 activity was analyzed using the DNMT1 activity assay kit (Abcam) according to manufacturer’s instructions. Briefly, AGS and MKN1 cells were collected and suspended in PBS. After centrifugation, the pellet was lysed in lysis buffer (10 mM Tris-Hcl pH 7.5, 10 mM NaCl, 2 mM MgCl₂) containing protease inhibitor mixture (Complete; Roche Molecular Biochemicals). Then, 6 ul of 20% NP-40 was added and the mixture was incubated for 10 min at 4 °C and centrifuged for 5 min at 3000 rpm. The supernatant was collected and the pellet containing the nuclei was resuspended in 50 μl of extraction buffer (20 mM Hepes pH 7.9, 420 mM NaCl, 1.5 mM Mgcl₂, 0.2 mM EDTA and 10% glycerol) followed by incubation for 30 min at 4 °C and collection of the nuclear extract by centrifugation. All reactions were carried out in triplicate.

Statistical analysis

Student’s t-test was used to analyze the effects of NKX6.3 on cellular ROS levels, cell viability and mRNA expression changes. Two-way ANOVA test was used to analyze the expression of DNMT1 and HACE1 in normal gastric mucosae and gastric cancer tissues. Linear progression test was used to analyze correlations between DNMT1, HACE1 and NKX6.3 expression levels in normal gastric mucosae and gastric cancer tissues. Chi-square test was used to analyze correlations between H. pylori CagA, atrophy, intestinal metaplasia and methylation status of the HACE1 promoter. Data are expressed as means ± S.D. from at least three independent experiments. A P-value less than 0.05 was considered to be the limit of statistical significance. All experiments were performed in triplicate to verify the reproducibility of the findings.

References

Jemal, A. et al. Global cancer statistics. CA Cancer J Clin. 61, 69–90 (2011).
Article PubMed Google Scholar
Correa, P. Human gastric carcinogenesis: a multistep and multifactorial process–First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res 52, 6735–6740 (1992).
CAS PubMed Google Scholar
Correa, P., Haenszel, W., Cuello, C., Tannenbaum, S. & Archer, M. A model for gastric cancer epidemiology. Lancet 2, 58–60 (1975).
Article CAS PubMed Google Scholar
Correa, P. & Piazuelo, M. B. The Gastric Precancerous Cascade. J Clin Exp Pathol 3, 147 (2013).
Google Scholar
Myatt, S. S., Brosens, J. J. & Lam, E. W. F. Sense and sensitivity: FOXO and ROS in cancer development and treatment. Antioxid Redox Signal 14, 675–687 (2011).
Article CAS PubMed Google Scholar
Bagchi, D., Bhattacharya, G. & Stohs, S. J. Production of reactive oxygen species by gastric cells in association with Helicobacter pylori. Free Radic Res. 24, 439–450 (1996).
Article CAS PubMed Google Scholar
Allen, R. G. & Tresini, M. Oxidative stress and gene regulation. Free Radic Biol Med. 28, 463–499 (2000).
Article CAS PubMed Google Scholar
Toyokuni, S. Novel aspects of oxidative stress-associated carcinogenesis. Antioxid Redox Signal. 8, 1373–1377 (2006).
Article CAS PubMed Google Scholar
Singh, K. K. Mitochondria damage checkpoint, aging, and cancer. Ann N Y Acad Sci 1067, 182–190 (2006).
Article ADS CAS PubMed Google Scholar
Liou, G. Y. & Storz, P. Reactive oxygen species in cancer. Free Radic Res. 44, 479–496 (2010).
Article CAS PubMed Google Scholar
Trachootham, D., Alexandre, J. & Huang, P. Targeting cancer cells by ROS-mediated mechanisms: a radical therapeutic approach? Nat Rev Drug Discov. 8, 579–591 (2009).
Article CAS PubMed Google Scholar
Yoon, J. H. et al. NKX6.3 Is a Transcription Factor for Wnt/β-catenin and Rho-GTPase Signaling-Related Genes to Suppress Gastric Cancer Progression. EBioMedicine. 9, 97–109 (2016).
Article PubMed PubMed Central Google Scholar
Yoon, J. H. et al. NKX6.3 induces gastric differentiation and inhibits gastric carcinogenesis. Oncotarget 6, 28425–28439 (2015).
Article PubMed PubMed Central Google Scholar
Yoon, J. H. et al. Inactivation of NKX6.3 in stomach leads to abnormal expression of CDX2 and SOX2 required for gastric-to-intestinal transdifferentiation. Mod Pathol. 29, 194–208 (2016).
Article CAS PubMed Google Scholar
Choi, M. Y. et al. Requirement of the tissue-restricted homeodomain transcription factor Nkx6.3 in differentiation of gastrin-producing G cells in the stomach antrum. Mol Cell Biol. 28, 3208–3218 (2008).
Article CAS PubMed PubMed Central Google Scholar
Alanentalo, T. et al. Cloning and analysis of Nkx6.3 during CNS and gastrointestinal development. Gene Expr Patterns. 6, 162–170 (2006).
Article CAS PubMed Google Scholar
Zhang, L. et al. The E3 ligase HACE1 is a critical chromosome 6q21 tumor suppressor involved in multiple cancers. Nat Med. 13, 1060–1069 (2007).
Article CAS PubMed Google Scholar
Daugaard, M. et al. Hace1 controls ROS generation of vertebrate Rac1-dependent NADPH oxidase complexes. Nat Commun. 4, 2180 (2013).
Article PubMed PubMed Central Google Scholar
Hong, J., Li, D., Wands, J., Souza, R. & Cao, W. Role of NADPH oxidase NOX5-S, NF-κB, and DNMT1 in acid-induced p16 hypermethylation in Barrett’s cells. Am J Physiol Cell Physiol. 305, C1069–1079 (2013).
Article CAS PubMed PubMed Central Google Scholar
Blaser, M. J. & Atherton, J. C. Helicobacter pylori persistence: biology and disease. J Clin Invest. 113, 321–333 (2004).
Article CAS PubMed PubMed Central Google Scholar
Bhattacharyya, A., Chattopadhyay, R., Mitra, S. & Crowe, S. E. Oxidative stress: an essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol Rev. 94, 329–354 (2014).
Article CAS PubMed PubMed Central Google Scholar
Crowe, S. E. Helicobacter infection, chronic inflammation, and the development of malignancy. Curr Opin Gastroenterol. 21, 32–38 (2005).
PubMed Google Scholar
Du, M. Q., Carmichael, P. L. & Phillips, D. H. Induction of activating mutations in the human c-Ha-ras-1 proto-oncogene by oxygen free radicals. Mol Carcinog. 11, 170–175 (1994).
Article CAS PubMed Google Scholar
Crowe, S. E. et al. Expression of interleukin 8 and CD54 by human gastric epithelium after Helicobacter pylori infection in vitro. Gastroenterology. 108, 65–74 (1995).
Article CAS PubMed Google Scholar
Keates, S., Hitti, Y. S., Upton, M. & Kelly, C. P. Helicobacter pylori infection activates NF-kappa B in gastric epithelial cells. Gastroenterology. 113, 1099–1109 (1997).
Article CAS PubMed Google Scholar
Morgan, M. J. & Liu, Z. G. Crosstalk of reactive oxygen species and NF-κB signaling. Cell Res. 21, 103–115 (2011).
Article CAS PubMed Google Scholar
Rotblat, B. et al. HACE1 reduces oxidative stress and mutant Huntingtin toxicity by promoting the NRF2 response. Proc Natl Acad Sci USA 111, 3032–3037 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Lu, T. & Stark, G. R. NF-κB: Regulation by Methylation. Cancer Res. 75, 3692–3695 (2015).
Article CAS PubMed PubMed Central Google Scholar
Karin, M., Cao, Y., Greten, F. R. & Li, Z. W. NF-kappaB in cancer: from innocent bystander to major culprit. Nat Rev Cancer. 2, 301–310 (2002).
Article CAS PubMed Google Scholar
Ghosh, G., van Duyne, G., Ghosh, S. & Sigler, P. B. Structure of NF-kappa B p50 homodimer bound to a kappa B site. Nature. 373, 303–310 (1995).
Article ADS CAS PubMed Google Scholar
Müller, C. W., Rey, F. A., Sodeoka, M., Verdine, G. L. & Harrison, S. C. Structure of the NF-kappa B p50 homodimer bound to DNA. Nature. 373, 311–317 (1995).
Article ADS PubMed Google Scholar
Chen, F. E., Huang, D. B., Chen, Y. Q. & Ghosh, G. Crystal structure of p50/p65 heterodimer of transcription factor NF-kappaB bound to DNA. Nature. 391, 410–413 (1998).
Article ADS CAS PubMed Google Scholar
Obst, B., Wagner, S., Sewing, K. F. & Beil, W. Helicobacter pylori causes DNA damage in gastric epithelial cells. Carcinogenesis. 21, 1111–1115 (2000).
Article CAS PubMed Google Scholar
Wu, C. W. et al. Clinical implications of chromosomal abnormalities in gastric adenocarcinomas. Genes Chromosomes Cancer. 35, 219–231 (2002).
Article CAS PubMed Google Scholar
Yoon, J. H. et al. Gastrokine 1 inhibits the carcinogenic potentials of Helicobacter pylori CagA. Carcinogenesis. 35, 2619–2629 (2014).
Article CAS PubMed PubMed Central Google Scholar
Ohshima, H., Tazawa, H., Sylla, B. S. & Sawa, T. Prevention of human cancer by modulation of chronic inflammatory processes. Mutat Res. 591, 110–122 (2005).
Article CAS PubMed Google Scholar
Correa, P. Chronic gastritis: a clinico-pathological classification. Am J Gastroenterol. 83, 504–509 (1988).
CAS PubMed Google Scholar
Ohata, H. et al. Progression of chronic atrophic gastritis associated with Helicobacter pylori infection increases risk of gastric cancer. Int J Cancer. 109, 138–143 (2004).
Article CAS PubMed Google Scholar
Nogueira, C. et al. Helicobacter pylori genotypes may determine gastric histopathology. Am J Pathol. 158, 647–654 (2001).
Article CAS PubMed PubMed Central Google Scholar
Dixon, M. F., Genta, R. M., Yardley, J. H. & Correa, P. Classification and grading of gastritis. The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston 1994. Am J Surg Pathol. 20, 1161–1181 (1996).
Article CAS PubMed Google Scholar
Yoon, J. H. et al. Inactivation of the Gastrokine 1 Gene in Gastric Adenomas and Carcinomas. J Pathol. 223, 618–625 (2011).
Article CAS PubMed Google Scholar
Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45 (2001).
Article CAS PubMed PubMed Central Google Scholar
Hoesel, B. & Schmid, J. A. The complexity of NF-κB signaling in inflammation and cancer. Mol Cancer. 12, 86 (2013).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2015R1A2A2A01002531, 2014R1A1A2058693). We thank Dr. Seong Yeob Ryu, Department of Gastroenterologic Surgery, Chonnam National University Hwasun Hospital, 160, Ilsim-ri, Hwasun-eup, Hwasun-gun, Jeollanam-do, 519-809, Korea, for providing the gastric cancer samples with clinical information.

Author information

Authors and Affiliations

Department of Pathology, College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Seocho-gu, Seoul, 137-701, South Korea
Jung Hwan Yoon, Olga Kim, Suk Woo Nam, Jung Young Lee & Won Sang Park
Department of Functional RNomics, College of Medicine, The Catholic University of Korea, 505 Banpo-dong, Seocho-gu, Seoul, 137-701, South Korea
Suk Woo Nam, Jung Young Lee & Won Sang Park

Authors

Jung Hwan Yoon
View author publications
You can also search for this author in PubMed Google Scholar
Olga Kim
View author publications
You can also search for this author in PubMed Google Scholar
Suk Woo Nam
View author publications
You can also search for this author in PubMed Google Scholar
Jung Young Lee
View author publications
You can also search for this author in PubMed Google Scholar
Won Sang Park
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

J.H.Y. and W.S.P. Conceptualization, J.H.Y. Investigation, J.H.Y., and O.K. Formal analysis, J.H.Y. and W.S.P. Writing-Original Draft, S.W.N. and J.Y.L. Writing-Review & Editing, J.H.Y. and W.S.P. Funding Acquisition.

Corresponding author

Correspondence to Won Sang Park.

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Supplementary information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Yoon, J.H., Kim, O., Nam, S.W. et al. NKX6.3 Regulates Reactive Oxygen Species Production by Suppressing NF-kB and DNMT1 Activities in Gastric Epithelial Cells. Sci Rep 7, 2807 (2017). https://doi.org/10.1038/s41598-017-02901-y

Download citation

Received: 18 October 2016
Accepted: 20 April 2017
Published: 05 June 2017
DOI: https://doi.org/10.1038/s41598-017-02901-y

This article is cited by

Manifold role of ubiquitin in Helicobacter pylori infection and gastric cancer
- Olga Sokolova
- Michael Naumann
Cellular and Molecular Life Sciences (2021)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.