Table 1 Primers used in this study.

From: N-Glycan Modification of a Recombinant Protein via Coexpression of Human Glycosyltransferases in Silkworm Pupae

Name Sequence (5′ to 3′)
Actin-F CCGGAATATTAATAGAGGTACCACCACCCTGCC
Actin-R CTTCGGACCGGGATCTCGATATCAAGCTTATCGATAC
pFast-F GATCCCGGTCCGAAGCGCGCG
pFast-R CTATTAATATTCCGGAGTACAC
hGnT II-F CGGAATTCATGAGGTTCCGCATCTACAAAC
hGnT II-R CGTCTAGACTACTGCAGTCTTCTATAACTTTTAC
hGalT I-F CGGAATTCATGAGGCTTCGGGAGCCGCTC
hGalT I-R CGTCTAGACTAGCTCGGTGTCCCGATGTC
BmIE-F CCCGTAACGGACCTTGTGCTT
BmIE-R TTATCGAGATTTATTTACATACAACAAG