Lysosomal activity maintains glycolysis and cyclin E1 expression by mediating Ad4BP/SF-1 stability for proper steroidogenic cell growth

Syu, Jhih-Siang; Baba, Takashi; Huang, Jyun-Yuan; Ogawa, Hidesato; Hsieh, Chi-Han; Hu, Jin-Xian; Chen, Ting-Yu; Lin, Tzu-Chien; Tsuchiya, Megumi; Morohashi, Ken-Ichirou; Huang, Bu-Miin; Lu, Fu-l.; Wang, Chia-Yih

doi:10.1038/s41598-017-00393-4

Download PDF

Article
Open access
Published: 21 March 2017

Lysosomal activity maintains glycolysis and cyclin E1 expression by mediating Ad4BP/SF-1 stability for proper steroidogenic cell growth

Jhih-Siang Syu^1,2,
Takashi Baba^3,4^na1,
Jyun-Yuan Huang⁵^na1,
Hidesato Ogawa⁶^na1,
Chi-Han Hsieh^7,8,
Jin-Xian Hu^7,8,
Ting-Yu Chen^1,2,
Tzu-Chien Lin¹,
Megumi Tsuchiya⁹,
Ken-Ichirou Morohashi^3,4,
Bu-Miin Huang^1,10,
Fu-l. Lu^7,8 &
…
Chia-Yih Wang^1,2

Scientific Reports volume 7, Article number: 240 (2017) Cite this article

1815 Accesses
12 Citations
3 Altmetric
Metrics details

Subjects

Abstract

The development and differentiation of steroidogenic organs are controlled by Ad4BP/SF-1 (adrenal 4 binding protein/steroidogenic factor 1). Besides, lysosomal activity is required for steroidogenesis and also enables adrenocortical cell to survive during stress. However, the role of lysosomal activity on steroidogenic cell growth is as yet unknown. Here, we showed that lysosomal activity maintained Ad4BP/SF-1 protein stability for proper steroidogenic cell growth. Treatment of cells with lysosomal inhibitors reduced steroidogenic cell growth in vitro. Suppression of autophagy did not affect cell growth indicating that autophagy was dispensable for steroidogenic cell growth. When lysosomal activity was inhibited, the protein stability of Ad4BP/SF-1 was reduced leading to reduced S phase entry. Interestingly, treatment of cells with lysosomal inhibitors reduced glycolytic gene expression and supplying the cells with pyruvate alleviated the growth defect. ChIP-sequence/ChIP studies indicated that Ad4BP/SF-1 binds to the upstream region of Ccne1 (cyclin E1) gene during G1/S phase. In addition, treatment of zebrafish embryo with lysosomal inhibitor reduced the levels of the interrenal (adrenal) gland markers. Thus lysosomal activity maintains steroidogenic cell growth via stabilizing Ad4BP/SF-1 protein.

Novel regulation mechanism of adrenal cortisol and DHEA biosynthesis via the endogen ERAD inhibitor small VCP-interacting protein

Article Open access 18 January 2022

Recep Ilhan, Göklem Üner, … Petek Ballar Kirmizibayrak

Loss of SUMO-specific protease 2 causes isolated glucocorticoid deficiency by blocking adrenal cortex zonal transdifferentiation in mice

Article Open access 21 December 2022

Damien Dufour, Typhanie Dumontet, … Antoine Martinez

CRHBP is degraded via autophagy and exerts anti-hepatocellular carcinoma effects by reducing cyclin B2 expression and dissociating cyclin B2-CDK1 complex

Article 27 January 2022

Zhiwei Wang, Mingxing Li, … Tao Bai

Introduction

Steroid hormones, such as adrenocorticoids (glucocorticoid and mineralocorticoid), and sex steroids, are mainly produced by the adrenal cortex and gonads; the former steroids maintain energy as well as ionic homeostasis, while the latter steroids are required for sex differentiation and reproductive function¹. All these steroids are synthesized from the common precursor cholesterol. The production of steroids, also known as steroidogenesis, is regulated by several steroidogenic enzymes². Cholesterol is transported into mitochondrial inner membrane by StAR protein. In the mitochondria, pregnenolone is synthesized through side-chain cleavage of cholesterol by CYP11A1 mediating the rate-limiting step of steroidogenesis. Thereafter, the pregnenolone is catalyzed by other steroidogenic enzymes to produce kinds of steroids³. All these steroidogenic enzymes are mainly controlled by adrenal 4 binding protein/steroidogenic factor 1 (Ad4BP/SF-1, NR5A1)⁴.

Ad4BP/SF-1 is a tissue type-specific transcription factor belonging to nuclear receptor superfamily⁵. It is mainly expressed in the steroidogenic adrenal gland and gonads, and whereby regulate steroidogenic gene expression. In addition to the implication of Ad4BP/SF-1 into steroidogenic regulation, Ad4BP/SF-1 plays an essential role in the development of steroidogenic organs. Indeed, Ad4BP/SF-1 knockout mice failed to develop the adrenal gland and gonads⁶. Although the reason why the steroidogenic organs disappeared from the KO mice was unclear, recent studies provided clues to uncover the issue. A study demonstrated that Ad4BP/SF-1 regulates the expressions of glycolytic genes, and thus providing energy for cell proliferation⁷. In addition to the function as a transcription factor, Ad4BP/SF-1 localizes to the centrosome⁸, and thus maintains centrosome configuration and homeostasis for proper mitosis and genomic integrity^9,10,11. Thus, precis control of Ad4BP/SF-1 functions is required for proper steroidogenic organ development.

Lysosomes are membrane-bound organelles which contain several kinds hydrolases. With regulation of acidification, activated hydrolases degrade several substrates which derived from endocytic and autophagic pathways¹². In the lysosomes, cholesteryl esters are hydrolyzed by a lysosomal acid lipase to produce free cholesterol for steroidogenesis. Inhibition of lysosomal activity by chloroquine reduces the degradation of cholesteryl ester to free cholesterol and resulted in decrease of low-density lipoprotein-induced progesterone production^{13, 14}. In addition to releasing free cholesterol, with unknown mechanism, lysosomal activity also participates in controlling steroidogenic enzyme expressions¹⁵. Besides, a recent study shows that lysosomal activity enables adrenocortical cells to survive during DNA damage response¹⁶, however, whether lysosomal activity plays an essential role for proper steroidogenic organ development is still unclear. Here we show that lysosomal activity maintains steroidogenic cell growth in vitro and in vivo by controlling Ad4BP/SF-1 protein stability. Reduced Ad4BP/SF-1 stability leads to suppression of glycolytic genes and abnormal centrosome amplification followed by reduced S phase entry. In addition, Ad4BP/SF-1 binds to the promoter region of Ccne1 gene thus regulating its expression during G1/S transition. These data reveal the molecular mechanism by which lysosomal activity regulates steroidogenic cell growth via controlling Ad4BP/SF-1 stability.

Results

Lysosomal activity maintains steroidogenic cell growth

Lysosomal activity is required for steroidogenesis¹⁵. However, its role on steroidogenic cell growth is unclear. To examine it, mouse adrenocortical tumor Y1, progenitor Leydig TM3, and Leydig tumor MA-10 cells were treated with lysosomal inhibitors, chloroquine (CQ), ammonium chloride (NH₄Cl) and bafilomycin A1 (Baf), and the growth rates were measured. When TM3 cells were treated with CQ and NH₄Cl, LC3 (a substrate of lysosome) puncta scatted in the cytoplasm were increased (Fig. S1A). In addition, when TM3, MA-10 and Y1 cells were treated with CQ or NH₄Cl, the amounts of LC3 and another lysosomal substrate p62 were increased in a dose-dependent manner (Fig. S1B–D). These data indicated that lysosomal activities were blocked efficiently by these reagents. The effect of the lysosomal inhibitors on steroidogenic cell growth was further examined. By counting cell numbers and performing MTT assay, we found that CQ, NH₄Cl, and Baf reduced a number of all cell lines tested dose- and time-dependently (Fig. 1A–F and S2A). In addition, CQ hardly induced cell death (Fig. S2C and F). Thus, pharmacological inhibition of lysosomes suppressed steroidogenic cell growth in vitro.

Autophagy is a lysosomal-degradation process whereby cells degrade and reutilize old organelles and proteins to maintain metabolic homeostasis¹⁷. Since inhibition of lysosomes blocks autophagic flux¹⁸, the effect of autophagy on steroidogenic cell growth was examined. Beclin1 encoded by Becn 1 is a critical factor for autophagy initiation. Depletion of Beclin1 by siRNA did not affect the growth of TM3 and Y1 cells (Fig. 2A–D). To further confirm this, the expression of Atg7, which encodes an E1-like activating enzyme that is essential for autophagy, was inhibited by infected cells with lentivirus-containing shRNA against Atg7. Four shRNA sequences were analyzed and found the shAtg7#3 and shAtg7#4 inhibited Atg7 expression efficiently (Fig. 2E). Then we tested whether depletion of Atg7 affected steroidogenic cell growth. In consistent with the result obtained from beclin1 deficient cells, depletion of Atg7 did not affect steroidogenic cells growth (Fig. 2F). These were further confirmed by treating cells with 3-Methyladenine (3-MA), an autophagic inhibitor blocks autophagosome formation. In the presence of 3-MA at 2 mM concentration, Y1 cell growth was not affected (Fig. 2G and S2B). However, higher concentration of 3-MA treatment (5 or 10 mM) induced cell death, this result is consistent with previous study that 3-MA inhibits autophagy at lower concentration but induces cellular apoptosis at higher concentration (5 or 10 mM)¹⁹. Collectively, these data indicates that the steroidogenic cell growth reduced by lysosome inhibitors was not due to deficient autophagic flux. This result is consistent with recent studies showing that ablation of Beclin 1 did not affect the growth of steroidogenic granulosa and luteal cells in the ovary, even though the steroidogenesis is inhibited^{20, 21}. Taken together, autophagy seems to be dispensable for steroidogenic cell growth.

Pharmacological inhibition of lysosomes leads to reduced S phase entry in steroidogenic cells

Since cell growth was affected by the treatment of lysosomal inhibitors, we analyzed the cell cycle profile. When cells were treated with CQ, the population of cells at G1 phase was increased whereas that at S phase was reduced (Fig. 3A and S2C). The ability of cells to enter into S phase was studied by EdU incorporation assay. Consistent with our flow cytometry analysis, inhibition of lysosomes reduced EdU incorporation dose-dependently in TM3 cells (Fig. 3B,C). Similar effect of lysosomal inhibition was observed in MA-10 and Y1 cells (Fig. S2D,E). Then we checked the ability of cells entered M phase by examining mitotic index. The mitotic index was reduced (Fig. 3D) when the cells were treated with lysosomal inhibitor. We further checked whether inhibition of lysosomes induced cell death. Treatment with CQ at low doses (10 and 50 μM) did not induce cell death (Fig. 3A, S2C and S2F), while treatment with higher concentration of CQ (100 μM) modestly induced cell death as shown by an increase of cleaved caspase 3 in Y1 cells (Fig. S2G). Thus the ability of cells enters S phase is reduced in the presence of lysosomal inhibitors.

Since cyclin and CDK complexes are important for cell cycle progression²², we checked the expression of cyclins and the activation of CDK2. CKD2 has been known to be active when Thr160 is phosphorylated (pCDK2). The expression levels of cyclin D, cyclin A, and CDK2 were not affected when cells were treated with CQ. However, the amounts of cyclin E1 and pCDK2, which are crucial for G1/S transition^{23, 24}, were reduced by the treatment (Fig. 3E–G). Reduced EdU incorporation and cyclin E/CDK2 activation supported the notion that lysosomal activity is required for G1/S transition in steroidogenic cell growth.

Lysosomal activity maintains steroidogenic cell growth by controlling Ad4BP/SF-1

Since Ad4BP/SF-1 is required for proper growth of steroidogenic organs such as adrenal gland and gonads⁶, its expression was examined in the cells treated with lysosomal inhibitor. The amount of Ad4BP/SF-1 in TM3, Y1, and MA-10 cells treated with CQ was reduced in a dose-dependent manner (Fig. 4A and S3A–C). Similar effect was observed by an NH₄Cl treatment (Fig. S3D). Consistent with it, the expression of downstream target genes of Ad4BP/SF-1, Star and Cyp11a1, were decreased in CQ-treated Y1 and TM3 cells (Fig. 4A and S2E–G). These data indicate that Ad4BP/SF-1-regulated steroidogenic genes are downregulated by lysosomal inhibitors.

To further investigate whether Ad4BP/SF-1 is required for G1/S transition, the EdU incorporation assay was performed with the cells in which Ad4BP/SF-1 was depleted by shRNAs. The expression of Ad4BP/SF-1 was reduced efficiently by shRNA-containing lentivirus infection (Fig. 4B). The number of cells to enter into S phase was reduced by the treatment (Fig. 4C,D), indicating that Ad4BP/SF-1 is required for G1/S transition. To confirm it, wild-type (WT) Ad4BP/SF-1 or GFP were overexpressed in CQ-treated Y1 cells. As the consequence, we found that the overexpression of Ad4BP/SF-1, but not GFP, rescued cell growth affected by CQ treatment (Fig. 4E). To examine whether the transcriptional activity of Ad4BP/SF-1 is required for the rescue, the DNA-binding domain-depleted Ad4BP/SF-1 (D70) was used. This D70 truncated form was transcriptionally inactive (Fig. 4F,G), and its overexpression did not rescue the CQ-induced growth defect (Fig. 4H). These results strongly suggests that Ad4BP/SF-1 regulates G1/S transition possibly through transcription activity.

Since Ad4BP/SF-1 maintains steroidogenic cell growth and proper mitotic entry by controlling centriole homeostasis^{8, 10} and inhibition of lysosome also leads to mitotic delay, we then examined the numbers of centriole. During interphase, untreated cells contained 2 (unduplicated, G1 phase) or 4 (duplicated, S/G2 phase) centrioles. Upon CQ-treated, the population of abnormal cells with multiple centrioles (>4 centrioles) was increased in TM3 cells (Fig. S4A,B), indicating that Ad4BP/SF-1-controlled centriole homeostasis was disturbed.

In addition to controlling centriole homeostasis, Ad4BP/SF-1 regulates glycolytic genes, and thereby providing energy sufficient for cell cycle progression⁷. Glycolytic gene expression was examined in the cells treated with lysosomal inhibitors. As expected, treatment of cells with CQ, NH₄Cl, and Baf reduced the expression of glycolytic genes, such as Pfk1, Tpi1, Pgk1, Pgam1, and Pkm2, suggesting that Ad4BP/SF-1-regulated glycolysis was impaired by lysosome inhibition (Fig. 5A). Interestingly, it was shown that Ad4BP/SF-1 knockdown led to drastic reduction of the amount of a glycolytic end-product, pyruvate⁷. Then, we checked whether pyruvate supplementation could rescue the growth defect induced by lysosomal inhibitors. Addition of pyruvate ameliorated the growth defect of TM3, Y1, and MA-10 cells induced by the CQ treatment (Fig. 5B–D). Likewise, EdU incorporation and the expression of cyclin E and pCDK2 were restored by the pyruvate supplementation to the CQ treated cells (Fig. 5E,F). Thus, our data suggests that lysosome inhibition down-regulates Ad4BP/SF-1 expression followed by inducing abnormal centriole amplification and reducing glycolysis.

We then re-analyzed our previously published ChIP-sequence data⁷ and found that Ad4BP/SF-1 binds to an upstream region of Ccne1 gene. Within the ChIP-peak region at the Ccne1 gene upstream, we found a consensus Ad4BP/SF-1-binding sequence conserved between mouse and human (Fig. 6A). As these observations strongly suggested that Ad4BP/SF-1 directly regulated Ccne1 gene, we performed luciferase reporter assays by using reporter gene harboring Ccne1 gene promoter²⁵. As the results, the reporter activity was decreased by the knockdown of Ad4BP/SF-1 (Fig. 6B,C), while increased by its overexpression (Fig. 6D). These results indicate that Ccne1 gene expression is, at least in part, controlled by Ad4BP/SF-1. Next, we tested whether Ad4BP/SF-1 bound to Ccne1 promoter in a cell cycle-dependent manner. When the cells are arrested in G0 phase by serum starvation, Ad4BP/SF-1 did not bind to the Ccne1 promoter (Fig. 6E). Interestingly, the binding appeared during G1/S phase transition, suggesting that Ad4BP/SF-1 plays a critical role for G1/S phase transition by regulating Ccne1 gene. To further confirm this, Ad4BP/SF-1 was overexpressed in CQ-treated cells. Inhibition of lysosomes reduced the expression of Cyclin E1, and its expression was restored by Ad4BP/SF-1 overexpression (Fig. 6F). Expectedly, the enforced expression of Ad4BP/SF-1 increased S phase entry of the CQ-treated cells (Fig. 6G). Thus Ad4BP/SF-1 directly regulates the expression of Cyclin E1 for proper G1/S transition.

Next we investigated how lysosomal activity affected Ad4BP/SF-1 expression. When lysosomal activity was inhibited, the mRNA level of Ad4BP/SF-1 was not affected (Fig. 7A). Nevertheless, lysosome inhibition reduced Ad4BP/SF-1 protein level, suggesting that Ad4BP/SF-1 protein stability might be affected. To confirm the possibility, 3xFLAG-tagged Ad4BP/SF-1 was expressed in Y1 cells. The ectopically expressed Ad4BP/SF-1 was largely reduced by CQ treatment (Fig. 7B). Moreover, the cycloheximide chase assay was performed. In the presence of CQ, exogenous Ad4BP/SF-1 was degraded faster than that of control treatment (Fig. 7C,D, the half-life of exogenous Ad4BP/SF-1 was 3.9 h; however, it was reduced to 2.3 h when treated with CQ). In addition, this was also observed in the endogenous Ad4BP/SF-1 when cells were treated with CQ or NH₄Cl (Fig. 7E,F, the half-life of endogenous Ad4BP/SF-1 was 3.6 h; however, it was reduced to 2.0 h and 1.9 h when treated with CQ or NH₄Cl, respectively). Thus, inhibition of lysosomes decreases Ad4BP/SF-1 protein stability.

Next we checked the effect of lysosomal activity on the development of the adrenal gland (interrenal gland) in zebrafish in vivo. Ff1b, the zebrafish homologue of Ad4BP/SF-1, is required for the development of steroidogenic component of the zebrafish interrenal gland²⁶. Treatment of zebrafish embryo with CQ inhibited the growth of the interrenal gland dose-dependently as shown by reduced Ff1b staining (Fig. 8A–C). In addition, the expression of a steroidogenic gene, Star, was also reduced (Fig. 8D,E), indicating that lysosomal activity is required for adrenal gland development in zebrafish. To further confirm the role of Ff1b in this phenotype, Ff1b mRNA was injected into the zebrafish embryo in the presence of CQ and found the growth of interrenal gland was rescued (Fig. 8C and E). Taken together, inhibition of lysosomal activity reduces the levels of Ff1b and Star, the markers of interrenal gland.

Discussion

In this study, we demonstrated that lysosomal activity is relevant to steroidogenesis and steroidogenic organ development by the maintenance of Ad4BP/SF-1 protein stability (Fig. S5). Ad4BP/SF-1 is critical for adrenal gland and gonads development⁶. Here, we show that, upon treatment of lysosomal inhibitors, the protein stability of Ad4BP/SF-1 was reduced, thus leading to lower glycolysis and abnormal centrosome amplification followed by G1 arrest and reduced mitosis entry. Furthermore, we found that the expression of cyclin E1 encoded by Ccne1 gene was directly regulated by Ad4BP/SF-1. Ad4BP/SF-1 bound to the promoter region of Ccne1 gene thus regulating its expression during G1/S transition. The expression of cyclin E at G1/S transition is required for initiation of DNA replication²⁷. In addition, higher ATP production is known to boost cyclin E level for S phase entry²⁸. Taken together, through regulation of ATP production by controlling glycolysis and cyclin E1 expression during G1/S transition, Ad4BP/SF-1 seems to cooperate these two biological events at the level of gene expression.

In our cell model, we found that the mRNA level of Ad4BP/SF-1 was not affected whereas the protein stability was reduced when lysosome was inhibited. However, by using in situ hybridization, we found that the expression of Ff1b, the homology of Ad4BP/SF-1 in the mammalian, in the zebrafish was reduced when treated with CQ. Due to the limitation of available antibody, so far detection of the mRNA of Ff1b or its downstream genes, such as Cyp11a1 or Star, is the best method to observe the development of zebrafish adrenal gland. As we only observed the protein stability, but not mRNA, of Ad4BP/SF-1 was reduced in the cell model, we speculate that in the zebrafish model, at least in part, the reduced Ff1b and Star signals represent as reduced cell number.

Lysosome is the degradation center for the maintenance of intra-cellular homeostasis. In addition, it also contributes to the cell cycle progression. In the budding yeast, Saccharomyces cerevisiae, the vacuole/lysosome is required for proper growth; loss of functional vacuole leads to G1 phase arrest²⁹. Here we provide further evidence to support the importance of lysosomal activity in maintaining cell cycle progression. In the steroidogenic cells, lysosomal activity maintains the protein level of Ad4BP/SF-1 thus inducing glycolysis and cyclin E1 expression for proper S phase entry. We have also tested the effect of lysosomal inhibitor on the growth of non-steroidogenic cells. As expected, the non-steroidogenic cells also show reduced S phase entery when treated with lysosomal inhibitors (data not shown). As Ad4BP/SF-1 is a tissue-type specific transcription factor, it reasons to speculate that there might be a nuclear receptor involved in the function similar to that of Ad4BP/SF-1 in non-steroidogenic cells. The estrogen-related receptor alpha (ERRα, NR3A1) is one of the candidates. It is expressed in several tissues and regulates genes involved in glucose metabolism and fatty acid oxidation³⁰. In addition, ERRα binds to the same nucleotide sequence as Ad4BP/SF-1 to activate transcription⁷. Thus, it might be interesting to examine, in those non-steroidogenic cells, whether the level of the ERRα is affected, leading to reduced glycolysis followed by reduced S phase entry upon lysosomal inhibition.

Enhanced expression of Ad4BP/SF-1 has been observed frequently in steroidogenic tumors³¹. Here we show that inhibition of lysosome suppresses Ad4BP/SF-1 stability thus reducing cell cycle progression. When adrenocortical tumor cells are treated with sub-lethal dose of anti-cancer drug, chloroquine can promote apoptosis thus these tumors are less susceptible to malignancy¹⁶. Chloroquine is an anti-malarial drug by inhibiting lysosomal acidification in clinics³². Thus, we consider that lysosomal inhibitor can be used in combination with other anti-cancer drugs such as etoposide in the treatment of steroidogenic tumors; it can either reduce the amount of Ad4BP/SF-1 or improve the cytotoxicity of anti-cancer drugs thus getting better therapeutic effects.

Although the protein stability of several nuclear receptors or its transcriptional co-regulators, such as androgen receptor or androgen receptor-interacting protein 4, are regulated by autophagy during stress responses^{33, 34}, whether Ad4BP/SF-1 stability is also regulated by this pathway is as yet unclear. In this study we found that the amount of Ad4BP/SF-1 was not affected by inhibition of autophagy but was reduced by lysosomal inhibition. It is known that the protein stability of Ad4BP/SF-1 is regulated by proteasome degradation pathway with Skp1/Cul1/F-box protein (SCF) family³⁵. In addition, some E3 ligase, such as RING finger protein 152 (RNF152), localize to lysosome, implying that lysosomal activity might regulate E3 ligase activity³⁶. Thus we speculated that when lysosomal activity is inhibited, the E3 ligase regulating Ad4BP/SF-1 stability might be activated thus leading to downregulation of Ad4BP/SF-1 via proteasome degradation pathway, but this hypothesis still need to be tested.

Previous study shows that treatment of ovarian granulosa cells with lysosomal inhibitor, chloroquine, reduces steroidogenic gene expressions¹⁵. However, the underlying molecular mechanism was unknown. In this study, we found that inhibition of lysosomal activity suppressed the expression of steroidogenic genes by down-regulating Ad4BP/SF-1. Ad4BP/SF-1 is the master regulator in controlling steroidogenesis³⁷, besides, autophagy may also contribute to this process. In the ovary of Becn 1 conditional knockout mice, the growth and differentiation of granulosa and luteal cells are normal. However, these mice suffered from lowered progesterone production due to less lipid droplets accumulation, thus leading to preterm labor. As lysosomal activity regulates autophagic flux, thus we consider that lysosomal activity contributes to steroidogenesis in multiple pathways, including regulating autophagy for lipid droplets accumulation, promoting free cholesterol catalysis, and, more importantly, maintaining Ad4BP/SF-1 protein stability. Once the lysosomal activity is inhibited, the autophagic flux is reduced leading to less lipid droplet accumulation; the source of free cholesterol is reduced; and the amount of Ad4BP/SF-1 is also reduced. Thus the steroidogenic pathway is disturbed leading to lower steroid production.

In summary, here we uncovered the novel function of lysosome in controlling steroidogenic gene expression and maintaining the steroidogenic cell growth by regulating Ad4BP/SF-1 protein stability.

Methods

Cell culture and Drug treatment

Mouse adrenocortical Y1 and mouse progenitor Leydig TM-3 and Leydig MA-10 cell lines were grown in Dulbecco’s modified Eagle medium (DMEM)-F12 medium supplemented with 10% fetal bovine serum at 37 °C in a humidified atmosphere at 5% CO2. These cells were regularly examined for the presence of Ad4BP/SF-1and free of mycoplasma contamination by immunoblot, immunofluorescence, and DAPI staining according to the guidelines. HEK 293 cells were grown in DMEM supplemented with 10% fetal bovine serum and 1x penicillin-streptomycin-glutamine at 5% CO2 and 37 °C. For drug treatment, cells were incubated with or without 10, 50, or 100 μM chloroquine (Novus Biologicals, Littleton, CO, USA), 10 or 20 mM ammonium chloride (Sigma, St. Louis, MO, USA), 1, 5, or 10 nM bafilomycin A1(Enzo Life Sciences, Farmingdale, NY, USA), 2, 5, or 10 mM 3-methyladenine (Sigma, St. Louis, MO, USA), and 1 mM sodium pyruvate (Caisson Laboratories, Logan, UT, USA) for 16 or 24 h before analysis. 50 μg/ml cycloheximide(Sigma, St. Louis, MO, USA) for 2, 4, 6, or 8 h before analysis; 20 ng/ml platelet-derived growth factor alpha polypeptide (Cell Guidance Systems, Cambridge, UK) for 24 h before analysis.

Zebrafish maintenance and drug treatment

The Zebrafish (AB) was obtained from Taiwan Zebrafish Core Facility and maintained following the condition of zebrafish care as described in zebrafish book (ZFIN). The experimental procedures were performed under the Institutional Animal Care and Use protocol from National Cheng Kung University, ROC. These procedures were approved by the Institutional Animal Care and Use Committee (IACUC) for the Use of Animal Subjects of National Cheng Kung University, ROC. The 3R animal use policy (Reduce, Replace and Refine) was reviewed and followed by the guidance from Ministry of Science and Technology, ROC.

The zebrafish embryos were incubated in chloroquine (CQ, Sigma, St. Louis, MO) which was dissolved in 0.3X Danieau zebrafish buffer with 0.003% 1-phenyl-2-thiourea (PTU) from dome stage (4.5 hour post fertilization, hpf). The CQ incubated embryos were collected at 32 hpf and fixed in 4% paraformaldehyde for overnight at 4 °C and then dehydrated in methanol. The dehydrated embryos were then performing whole mount in situ hybridization with different genes.

Whole mount in situ hybridization (WISH)

The whole mount in situ hybridization in zebrafish embryo with ff1b ^{26, 38} or star (BioCat GmbH) was done as described before^{39, 40}. Briefly, the embryos were fixed with 4% paraformaldehyde in PBS for overnight at 4 °C and then dehydrated by 100% methanol and stored at −20 °C. Before hybridization with probes, the dehydrated embryos were rehydrated with successive dilution of methanol by PBS, washed 5 times with PBST(PBS with 0.1% tween-20), digestion with proteinase K (10 μg/mL) for 2 minutes, re-fixed with 4% paraformaldehyde and washed 5 times with PBST. After rehydration and digestion, the embryos were incubated in prehybridization buffer for 2 hours and then transferred into hybridization buffer with antisense RNA probe at 70 °C for overnight. The hybridized embryos were washed with successive dilution of 0.2xSSC in PBST and stayed at 70 °C for 1 hour. The washed embryos were transferred into successive dilution of 0.2x SSC in PBST and finally incubated in blocking buffer with anti-dig antibody (1:10,000) for overnight at 4 °C. The antibody stained embryos were washed with 1XPBST for 6 time and then transferred into alkaline Tris buffer for 3 times. The embryos were stained with labeling mix contained Nitro Blue Tetrazolium (NBT) and 5-Bromo 4-Chloro 3-indolyl Phosphate (BCIP). After staining, the reaction was ceased by stop solution (1XPBS with 1 mM EDTA, pH 5.5). All the CQ incubated and ff1b mRNA injected experiments were performed 3 times (N = 3) independently. In each experiment, at least 30 embryos (n) were used in each different groups. The signal less than 50% compared with control group was defined as reduced signal in the interrenal gland tissue and the quantitative results were calculated by double blind test.

Antibodies

The following antibodies were obtained commercially: anti-γ-tubulin (T6557), anti-cyclin A (C4710), and anti-α-tubulin (T9026) (Sigma, St. Louis, MO), anti-CDK2 (#2546), anti-CDK2 phospho-Thr160 (#2561), anti-Cleaved Caspase-3 (Asp175) (#9661), anti-CYP11A1 (D8F4F) (#14217), anti-Ad4BP/SF-1 (STF-1, D1Z2A) (#12800), and anti-LC3A/B (#12741) (Cell Signaling, Beverly, MA), anti-H2AX phospho-Ser139 (ab2893, Abcam, Cambridge, UK), anti- Beclin 1/ATG6 (NB500-249) (Novus, Littleton, CO), anti-cyclin E1 (HE-12, GTX23927), anti-actin (GTX109639) and anti-GAPDH (GTX100118) (Genetex, Irvine, CA).

Plasmids, Luciferase reporter assay, and RNAi

Mammalian expression plasmids for mouse Ad4BP/SF-1 were constructed by subcloning the cDNA provided by Dr. Keith Parker (University of Texas Southwestern Medical Center, Dallas, TX) into pCMX⁴¹. pGL3-mCyclin E1-Luc reporter vector have mouse cyclin E1 promoter, located 5′ upstream of the lucifrerase gene provided by Dr. Johan Auwerx (Université Louis Pasteur, Illkirch, France)²⁵. The luciferase reporter plasmids, Ad4 × 3, have three Ad4 sites, located 5′ upstream of the tk basal promoter. HEK293 or Y1 cells were seeded in 24-well dishes and transfected using Lipofectamine2000 (Invitrogen, Carlsbad, CA) with 200 ng of luciferase reporter plasmid (pGL3-mCyclin E1-Luc and pAd4 × 3-Luc reporter vector), 100 ng of pCMX-ß-gal, and control or Ad4BP/SF-1 siRNA oligonucleotides (100 nM). The cells were harvested 48 h after transfection, and the cell lysates were subjected to luciferase and ß-galactosidase assays as described previously. Ad4BP/SF-1 and Beclin 1 of adrenocortical Y1 and progenitor Leydig TM3 cell lines were depleted using annealed siRNA with the target sequence:

siAd4BP #1: 5′-AUGUGUGACAGCAUAGACUGCCACC [dt] [dt]-3′

siAd4BP #2: 5′-AUAAAGGUCUGGUCGGCCAUUCUGC [dt] [dt]-3′

siBeclin1: 5′-GAGUUGCCGUUAUACUGUU [dt] [dt]-3′ (Ambion, Life Technologies, Grand Island, NY).

Scrambled siRNA with the target sequence: 5′-GAUCAUACGUGCGAUCAGA [dt] [dt]-3′ was purchased from Sigma (Sigma, St. Louis, MO).

For siRNA transfection, 10 μl of Lipofectamine 2000 (Invitrogen, Carlsbad, CA) were mixed first with 500 μl Opti-MEM medium (Life Technologies, Grand Island, NY) for 5 min, then with 2 μl siRNA (100 μM) in 500 μl Opti-MEM medium, incubated at room temperature for 20 min before the mixture was layered onto cells in 1 ml DMEM/F12 medium (100 nM working concentration). Cells were harvested for further experiments 72 h after transfection.

A lentiviral system for Atg7 and Ad4BP gene silencing was obtained from the National RNAi Core Facility (Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan). Short hairpin RNA (shRNA)-encoding pLKO.1 vectors were as follows:

pLKO.1-shluc (target sequence: 5′-CCTAAGGTTAAGTCGCCCTCG-3′)

pLKO.1-shsf1#2 (target sequence: 5′-CGCACCATCAAGTCTGAGTAT-3′)

pLKO.1-shsf1#3 (target sequence: 5′-CGTCTGTCTCAAGTTCCTCAT-3′)

Lentiviruses were produced by cotransfection with pLKO.1, pCMVdelR8.91 and pMD.G for shRNA production in 293FT cells (Invitrogen, Carlsbad, CA) according to the protocols provided by the Taiwan National RNAi Core Facility.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed basically with the procedure described by Winnay et al.^{42, 43}. In brief, after cross-linking Y1 cells with 1% formaldehyde for 10 min at room temperature, they were rinsed twice with cold PBS, harvested in lysis buffer containing 20 mM Tris-HCl (pH 8.0), 10 mM EDTA 1% SDS, and incubated for 5 min at 4 °C. Next, their chromatin was sonicated to generate DNA fragments of 500–1000 bp. To reduce nonspecific background, the samples were precleared with normal rabbit IgG (1 μg/mL), salmon sperm DNA (100 mg/mL), BSA (10 mg/mL), and protein A agarose (50% slurry in PBS) for 60 min at 4 °C. After centrifugation at 1,000× g for 20 min, the supernatants were incubated with normal rabbit IgG or anti-Ad4BP/SF-1³⁷ overnight at 4 °C. Next, protein A beads adsorbed to the immunocomplexes were collected by centrifugation, washed with 50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 0.5% Nonidet P-40, 0.1% SDS, and Complete Protease Inhibitor Cocktail (Roche), and then washed again with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 250 mM LiCl, and 0.1% Nonidet P-40. The beads were further washed three times with 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA, and finally the chromatin fragments were eluted from the beads with 1% SDS in 0.1 M NaHCO3. After the cross-linking was reverted by heating at 65 °C 8 hr, DNA fragments were recovered using the QIAquick PCR purification system (Qiagen). The purified DNAs were resuspended in 100 μL water and 5 μL aliquots were used for PCR. Presence of the Ccne1 promoter region was determined by PCR with the appropriate primer sets, indicated below. The PCR was carried out for 30 cycles and the products were resolved on 2% agarose gels to visualize the SYBR Green staining.

Primer pairs used for ChIP assays were as follows:

CyclinE1-1: 5′ GGTGAGGGTCACTTCACGTT 3′

CyclinE1-2: 5′ CAGCAGCAGGTCCTTTAACC 3′

Cycloheximide chase assay

The expression plasmid of 3xFLAG-SF-1 (2.5 μg) was transfected into Y1 cells. 16 h after transfection in the presence or absence of CQ (100 μM), cells were treated with 50 μg/ml cycloheximide for different time periods and then harvested by CelLytic^TM M cell lysis reagent (Sigma, St, Louis, MO) with cocktail protease inhibitors. Cell extract was cleared by centrifugation for 10 min at 13000 rpm and supernatant was analyzed by immunoblotting.

Statistical analysis

All results are expressed as the mean +/− S.D. from at least three independent experiments, more than 100 cells were counted in each individual group. Differences between two groups were compared using unpaired two-tailed t-tests, for which a p-value of less than 0.05 was considered to be statistically significant.

References

Hsu, H. J., Hsu, N. C., Hu, M. C. & Chung, B. C. Steroidogenesis in zebrafish and mouse models. Mol. Cell. Endocrinol. 248, 160–163 (2006).
Article CAS PubMed Google Scholar
Omura, T. & Morohashi, K. Gene regulation of steroidogenesis. J. Steroid Biochem. Mol. Biol. 53, 19–25 (1995).
Article CAS PubMed Google Scholar
Erickson, L. A., Rivera, M. & Zhang, J. Adrenocortical carcinoma: review and update. Adv. Anat. Pathol. 21, 151–159 (2014).
Article CAS PubMed Google Scholar
Morohashi, K. I. & Omura, T. Ad4BP/SF-1, a transcription factor essential for the transcription of steroidogenic cytochrome P450 genes and for the establishment of the reproductive function. FASEB journal 10, 1569–1577 (1996).
CAS PubMed Google Scholar
Hoivik, E. A., Lewis, A. E., Aumo, L. & Bakke, M. Molecular aspects of steroidogenic factor 1 (SF-1). Mol. Cell. Endocrinol. 315, 27–39 (2010).
Article CAS PubMed Google Scholar
Luo, X., Ikeda, Y. & Parker, K. L. A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 77, 481–490 (1994).
Article CAS PubMed Google Scholar
Baba, T. et al. Glycolytic genes are targets of the nuclear receptor Ad4BP/SF-1. Nat. Commun. 5, 3634, doi:10.1038/ncomms4634 (2014).
Article ADS CAS PubMed Google Scholar
Lai, P. Y. et al. Steroidogenic Factor 1 (NR5A1) resides in centrosomes and maintains genomic stability by controlling centrosome homeostasis. Cell Death. Differ. 18, 1836–1844 (2011).
Article CAS PubMed PubMed Central Google Scholar
Wang, C. Y., Lai, P. Y., Chen, T. Y. & Chung, B. C. NR5A1 prevents centriole splitting by inhibiting centrosomal DNA-PK activation and ss-catenin accumulation. Cell Commun. Signal 12, 55 (2014).
PubMed PubMed Central Google Scholar
Wang, C. Y., Kao, Y. H., Lai, P. Y., Chen, W. Y. & Chung, B. C. Steroidogenic Factor-1 (NR5A1) Maintains Centrosome Homeostasis in Steroidogenic Cells by Restricting Centrosomal DNA-PK Activation. Mol. Cell. Biol. 33, 476–484 (2013).
Article CAS PubMed PubMed Central Google Scholar
Wang, C. Y., Chen, W. Y., Lai, P. Y. & Chung, B. C. Distinct functions of steroidogenic factor-1 (NR5A1) in the nucleus and the centrosome. Mol. Cell. Endocrinol. 371, 148–153 (2013).
Article CAS PubMed Google Scholar
Settembre, C., Fraldi, A., Medina, D. L. & Ballabio, A. Signals from the lysosome: a control centre for cellular clearance and energy metabolism. Nat. Rev. Mol. Cell Biol. 14, 283–296 (2013).
Article CAS PubMed PubMed Central Google Scholar
Savion, N., Laherty, R., Lui, G. M. & Gospodarowicz, D. Modulation of low density lipoprotein metabolism in bovine granulosa cells as a function of their steroidogenic activity. J. Biol. Chem. 256, 12817–12822 (1981).
CAS PubMed Google Scholar
Goldstein, J. L., Brunschede, G. Y. & Brown, M. S. Inhibition of proteolytic degradation of low density lipoprotein in human fibroblasts by chloroquine, concanavalin A, and Triton WR 1339. J. Biol. Chem. 250, 7854–7862 (1975).
CAS PubMed Google Scholar
Zhang, J. Y. et al. Lysosomes are involved in induction of steroidogenic acute regulatory protein (StAR) gene expression and progesterone synthesis through low-density lipoprotein in cultured bovine granulosa cells. Theriogenology 84, 811–817 (2015).
Article CAS PubMed Google Scholar
Chen, T. Y. et al. Chloroquine alleviates etoposide-induced centrosome amplification by inhibiting CDK2 in adrenocortical tumor cells. Oncogenesis 4, e180, doi:10.1038/oncsis.2015.37 (2015).
Article CAS PubMed PubMed Central Google Scholar
Hoyer-Hansen, M. & Jaattela, M. Autophagy: an emerging target for cancer therapy. Autophagy 4, 574–580 (2008).
Article PubMed Google Scholar
Kroemer, G. & Jaattela, M. Lysosomes and autophagy in cell death control. Nat. Rev. Cancer 5, 886–897 (2005).
Article CAS PubMed Google Scholar
Hou, H. et al. Inhibitors of phosphatidylinositol 3′-kinases promote mitotic cell death in HeLa cells. PloS one 7, e35665, doi:10.1371/journal.pone.0035665 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar
Gawriluk, T. R. & Rucker, E. B. BECN1, corpus luteum function, and preterm labor. Autophagy 11, 183–184 (2015).
Article PubMed PubMed Central Google Scholar
Gawriluk, T. R., Ko, C., Hong, X., Christenson, L. K. & Rucker, E. B. 3rd Beclin-1 deficiency in the murine ovary results in the reduction of progesterone production to promote preterm labor. Proc. Natl. Acad. Sci. USA 111, E4194–4203 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Gu, Y., Rosenblatt, J. & Morgan, D. O. Cell cycle regulation of CDK2 activity by phosphorylation of Thr160 and Tyr15. EMBO J 11, 3995–4005 (1992).
CAS PubMed PubMed Central Google Scholar
Koff, A. et al. Formation and activation of a cyclin E-cdk2 complex during the G1 phase of the human cell cycle. Science 257, 1689–1694 (1992).
Article ADS CAS PubMed Google Scholar
Li, Y. et al. HOXA7 stimulates human hepatocellular carcinoma proliferation through cyclin E1/CDK2. Oncology reports 33, 990–996 (2015).
CAS PubMed Google Scholar
Botrugno, O. A. et al. Synergy between LRH-1 and beta-catenin induces G1 cyclin-mediated cell proliferation. Mol. Cell 15, 499–509 (2004).
Article CAS PubMed Google Scholar
Chai, C., Liu, Y. W. & Chan, W. K. Ff1b is required for the development of steroidogenic component of the zebrafish interrenal organ. Dev. Biol. 260, 226–244 (2003).
Article CAS PubMed Google Scholar
Murray, A. W. Recycling the cell cycle: cyclins revisited. Cell 116, 221–234 (2004).
Article CAS PubMed Google Scholar
Mitra, K., Wunder, C., Roysam, B., Lin, G. & Lippincott-Schwartz, J. A hyperfused mitochondrial state achieved at G1-S regulates cyclin E buildup and entry into S phase. Proc. Natl. Acad. Sci. USA 106, 11960–11965 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Jin, Y. & Weisman, L. S. The vacuole/lysosome is required for cell-cycle progression. eLife 4, doi:10.7554/eLife.08160 (2015).
Giguere, V. Transcriptional control of energy homeostasis by the estrogen-related receptors. Endocr. Rev. 29, 677–696 (2008).
Article CAS PubMed Google Scholar
Almeida, M. Q. et al. Steroidogenic factor 1 overexpression and gene amplification are more frequent in adrenocortical tumors from children than from adults. J. Clin. Endocrinol. Metab. 95, 1458–1462 (2010).
Article CAS PubMed Google Scholar
Chen, P. M., Gombart, Z. J. & Chen, J. W. Chloroquine treatment of ARPE-19 cells leads to lysosome dilation and intracellular lipid accumulation: possible implications of lysosomal dysfunction in macular degeneration. Cell Biosci 1, 10, doi:10.1186/2045-3701-1-10 (2011).
Article CAS PubMed PubMed Central Google Scholar
Tsuchiya, M. et al. Selective autophagic receptor p62 regulates the abundance of transcriptional coregulator ARIP4 during nutrient starvation. Sci. Rep 5, 14498, doi:10.1038/srep14498 (2015).
Article ADS CAS PubMed PubMed Central Google Scholar
Mitani, T., Minami, M., Harada, N., Ashida, H. & Yamaji, R. Autophagic degradation of the androgen receptor mediated by increased phosphorylation of p62 suppresses apoptosis in hypoxia. Cell. Signal. 27, 1994–2001 (2015).
Article CAS PubMed Google Scholar
Chen, W. Y., Weng, J. H., Huang, C. C. & Chung, B. C. Histone deacetylase inhibitors reduce steroidogenesis through SCF-mediated ubiquitination and degradation of steroidogenic factor 1 (NR5A1). Mol. Cell. Biol. 27, 7284–7290 (2007).
Article CAS PubMed PubMed Central Google Scholar
Zhang, S. et al. RNF152, a novel lysosome localized E3 ligase with pro-apoptotic activities. Prot. Cell 1, 656–663 (2010).
Article CAS Google Scholar
Morohashi, K. et al. Activation of CYP11A and CYP11B gene promoters by the steroidogenic cell-specific transcription factor, Ad4BP. Mol. Endocrinol. 7, 1196–1204 (1993).
CAS PubMed Google Scholar
Liu, Y. W. Interrenal organogenesis in the zebrafish model. Organogenesis 3, 44–48 (2007).
Article PubMed PubMed Central Google Scholar
Lu, F. I., Sun, Y. H., Wei, C. Y., Thisse, C. & Thisse, B. Tissue-specific derepression of TCF/LEF controls the activity of the Wnt/beta-catenin pathway. Nat. Commun. 5, 5368, doi:10.1038/ncomms6368 (2014).
Article ADS CAS PubMed Google Scholar
Thisse, C. & Thisse, B. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3, 59–69, doi:10.1038/nprot.2007.514 (2008).
Article CAS PubMed Google Scholar
Umesono, K., Murakami, K. K., Thompson, C. C. & Evans, R. M. Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65, 1255–1266 (1991).
Article CAS PubMed Google Scholar
Shang, Y., Hu, X., DiRenzo, J., Lazar, M. A. & Brown, M. Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103, 843–852 (2000).
Article CAS PubMed Google Scholar
Winnay, J. N. & Hammer, G. D. Adrenocorticotropic hormone-mediated signaling cascades coordinate a cyclic pattern of steroidogenic factor 1-dependent transcriptional activation. Mol. Endocrinol. 20, 147–166 (2006).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank Dr. Bon-chu Chung for providing Ad4BP/SF-1 constructs; Dr. Yang-Kao Wang for providing sodium pyruvate; Dr. Yi-wen Liu for providing Ff1b construct. We acknowledge the TZCF(Taiwan Zebrafish Core Facility) which is supported by grant 104-2319-B-400 -001 from Ministry of Science and Technology (MOST), Taiwan for the zebrafish whole mount in situ hybridization service. We are grateful for the support from the Core Research Laboratory, College of Medicine, National Cheng Kung University. RNAi reagents were obtained from the National Core Facility for Manipulation of Gene Function by RNAi, miRNA, miRNA sponges, and CRISPR/Genomic Research Center, Academia Sinica, supported by the National Core Facility Program for Biotechnology Grants of MOST (MOST 104-2319-B-001-001 -). This study was supported by grant from Ministry of Science and Technology, MOST103-2628-B-006-001-MY3 and MOST104-2314-B-006-002 to Chia-Yih Wang; MOST103-2313-B-006-006 and MOST104-2311-B-006-005-MY3 to Fu-I Lu. This research was, in part, supported by the Ministry of Education, Taiwan, ROC. The Aim for the Top University Project to the National Cheng Kung University (NCKU). This research received funding from the Headquarters of University Advancement at the National Cheng Kung University, which is sponsored by the Ministry of Education, Taiwan, ROC. This research was supported in part by (received funding from) the Headquarters of University Advancement at the National Cheng Kung University, which is sponsored by the Ministry of Education, Taiwan, ROC.

Author information

Takashi Baba, Jyun-Yuan Huang and Hidesato Ogawa contributed equally to this work.

Authors and Affiliations

Department of Cell Biology and Anatomy, College of Medicine, National Cheng Kung University, Tainan, 701, Taiwan
Jhih-Siang Syu, Ting-Yu Chen, Tzu-Chien Lin, Bu-Miin Huang & Chia-Yih Wang
Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan, 701, Taiwan
Jhih-Siang Syu, Ting-Yu Chen & Chia-Yih Wang
Division of Molecular Life Science, Graduate School of Systems Life Science, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka, 812-8582, Japan
Takashi Baba & Ken-Ichirou Morohashi
Department of Molecular Biology, Graduate School of Medical Sciences, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka, 812-8582, Japan
Takashi Baba & Ken-Ichirou Morohashi
Division of Genetics, Department of Obstetrics and Gynecology, National Cheng Kung University Hospital, Tainan, 704, Taiwan
Jyun-Yuan Huang
Advanced ICT Research Institute Kobe, National Institute of Information and Communications Technology, Iwaoka 588-2, Nishi-ku, Kobe, 651-2492, Japan
Hidesato Ogawa
Department of Biotechnology and Bioindustry Sciences, College of Bioscience and Biotechnology, National Cheng Kung University, Tainan, 701, Taiwan
Chi-Han Hsieh, Jin-Xian Hu & Fu-l. Lu
Institute of Biotechnology, College of Bioscience and Biotechnology, National Cheng Kung University, Tainan, 701, Taiwan
Chi-Han Hsieh, Jin-Xian Hu & Fu-l. Lu
Graduate School of Frontier Biosciences, Osaka University, 1-3 Yamadaoka, Suita, 565-0871, Japan
Megumi Tsuchiya
Department of Medical Research, China Medical University Hospital, China Medical University, Taichung, 404, Taiwan
Bu-Miin Huang

Authors

Jhih-Siang Syu
View author publications
You can also search for this author in PubMed Google Scholar
Takashi Baba
View author publications
You can also search for this author in PubMed Google Scholar
Jyun-Yuan Huang
View author publications
You can also search for this author in PubMed Google Scholar
Hidesato Ogawa
View author publications
You can also search for this author in PubMed Google Scholar
Chi-Han Hsieh
View author publications
You can also search for this author in PubMed Google Scholar
Jin-Xian Hu
View author publications
You can also search for this author in PubMed Google Scholar
Ting-Yu Chen
View author publications
You can also search for this author in PubMed Google Scholar
Tzu-Chien Lin
View author publications
You can also search for this author in PubMed Google Scholar
Megumi Tsuchiya
View author publications
You can also search for this author in PubMed Google Scholar
Ken-Ichirou Morohashi
View author publications
You can also search for this author in PubMed Google Scholar
Bu-Miin Huang
View author publications
You can also search for this author in PubMed Google Scholar
Fu-l. Lu
View author publications
You can also search for this author in PubMed Google Scholar
Chia-Yih Wang
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

J.S. Syu, J.Y. Huang, T.Y. Chen, T.C. Lin, and M. Tsuchiya performed cell experiments. T. Baba and H. Ogawa performed ChIP-seq/ChIP experiments. C.H. Hsieh and J.X. Hu performed zebrafish experiments. K.I. Morohashi, B.M. Huang, F.I. Lu, and C.Y. Wang designed experiments and prepared manuscript. All authors reviewed the manuscript.

Corresponding authors

Correspondence to Bu-Miin Huang, Fu-l. Lu or Chia-Yih Wang.

Ethics declarations

Competing Interests

The authors declare that they have no competing interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Supplementary Figures

Rights and permissions

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Reprints and permissions

About this article

Cite this article

Syu, JS., Baba, T., Huang, JY. et al. Lysosomal activity maintains glycolysis and cyclin E1 expression by mediating Ad4BP/SF-1 stability for proper steroidogenic cell growth. Sci Rep 7, 240 (2017). https://doi.org/10.1038/s41598-017-00393-4

Download citation

Received: 22 July 2016
Accepted: 21 February 2017
Published: 21 March 2017
DOI: https://doi.org/10.1038/s41598-017-00393-4

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.