Table 1 Details of microsatellite loci used to amply 605 Cape vultures Gyps coprotheres.

From: Microsatellite genotypes of the South African Cape vulture, Gyps coprotheres

Locus Sequence Motif Label Allele Size range (bp) Multiplex Reaction
BV2 F: CAGCATGTTATTTTGGCTGC (CA)11 HEX 110–136 Multiplex 6
R: TTGCTAAACCGGTTAGAAGTTG
BV5 F: GTTCTGAGGGTAGAGGGACTG (CA)17 Tet 166–182 Multiplex 1
R: GCTGAGCAGCTTCAGAAAGTC
BV6 F: AATCTGCATCCCAGTTCTGC (CA)11 HEX 100–150 Multiplex 4
R: CCGGAGACTCTCAGAACTTAAC
BV9 F: ATCTAGGGACATCGAGGAGC (TA)6(CA)11 HEX 196–384 Multiplex 6
R: ACAGGGATGCAGGTAAGCC
BV11 F: TGTTTGCAAGCTGGAGACC (CA)22 HEX 146–186 Multiplex 3
R: AAAAGCCTTGGGGTAAGCAC
BV12 F: TCAGGTTTTGACGACCTTCC (CA)15 6-Fam 240–290 Multiplex 2
R: GTGGTAACGGAGGAACAAGC
BV13 F: AAAACAGAGTTTTCACATTTTCATAAG (CA)16 6-Fam 163–187 Multiplex 3
R: TTCAGGAAACAGAAGCATGAAC
BV14 F: GGCAGTGTGGAGCCTACATC (CA)16 6-Fam 148–186 Multiplex 4
R: CTCCAGGGTCCTTGTTTGC
BV20 F: GAACAGCACTGAACGTGAGC (CA)13 HEX 133–195 Multiplex 1
R: GTTTCTCCTGACAGTGAAATAACTC
Gf3H3 F: GTAGAATAATTTGCTCCTGG (CT)12 6-Fam 123–197 Multiplex 2
R: GTGAAGGCACCTCATAGACA
Gf8G F: TGAGCAGGTGAGTCCAGAAG (CT)8C (TC)2 6-Fam 226–292 Multiplex 4
R: GCTCTCCTGTCATCTTGCAT
Gf9C F: GGTGGACATTACATACACTG (TC)10 + (CT)9 C (CA)5T (AC)4 HEX 217–315 Multiplex 3
R: CAAGGAATCTGGACTACTAA
Gf11A4 F: GATCCCTTCCAACCGAAAAT (CTCTT)17 HEX 110–160 Multiplex 2
R: TGGTGACCAACGGAAGTGTG