Fig. 5: AAV-PHP.B and AAV-PHP.eB can be used in several mouse and rat strains. | Nature Protocols

Fig. 5: AAV-PHP.B and AAV-PHP.eB can be used in several mouse and rat strains.

From: Systemic AAV vectors for widespread and targeted gene delivery in rodents

Fig. 5

a, AAV-PHP.B transduces the brain more efficiently than AAV9 in C57BL/6J, FVB/NCrl, and 129S1/SvImJ mice, but not in BALB/cJ mice. ssAAV9:CAG-mNeonGreen or ssAAV-PHP.B:CAG-mNeonGreen were systemically delivered to 6- to 8-week-old C57BL/6J (n = 1–2 mice per group), FVB/NCrl (n = 2 mice per group), 129S1/SvImJ (n = 2 mice per group), and BALB/cJ mice (n = 2 mice per group) at 1 × 1012 vg/mouse. 3 weeks later, sagittal brain sections were mounted in Vectashield and imaged using confocal microscopy. Imaging and display parameters are matched across all panels. Scale bar, 2 mm. be, Examples of AAV-PHP.B- and AAV-PHP.eB-mediated brain transduction for fluorescent labeling (b,c) and calcium imaging (d,e) in different mouse and rat strains. Gene expression was evaluated using confocal microscopy. b, ssAAV-PHP.eB:CAG-tdTomato (Addgene) was delivered by retro-orbital injection to a 10-week-old 129T2/SvEmsJ mouse at 3 × 1011 vg; tdTomato fluorescence (red) was examined 2 weeks later. Scale bars, 1 mm (top) and 100 µm (insets). c, ssAAV-PHP.eB:CAG-mRuby2 was administered by tail-vein injection to a 6-week-old female Fischer rat at 3 × 1012 vg; 3 weeks later, brain slices were mounted in Prolong Diamond Antifade for imaging. Scale bars, 2 mm (top) and 100 µm (insets). d, ssAAV-PHP.eB:CMV-hSyn1-GCaMP6f-3x-miR122-TS was delivered by tail-vein injection to a 4-week-old female Long-Evans rat at 1 × 1013 vg; 3 weeks later, brain slices were stained with a GFP antibody (green) for imaging. Scale bars, 1 mm (top left) and 100 µm (insets). The vector contained three tandem copies of miRNA target sequence (TS) miR-122 (CAAACACCATTGTCACACTCCA) to reduce expression in hepatocytes78. Images in d courtesy of M. Fabiszak/W. Freiwald lab, Rockefeller University. e, ssAAV-PHP.B:CaMKIIa-CaMPARI (calcium-modulated photoactivatable ratiometric integrator79) was administered by retro-orbital injection to a 8-week-old FVB/NCrl mouse at 3 × 1011 vg and cortical expression was assessed 2 weeks later. Images are a 50-µm maximum-intensity projection of the cortex (left) and 500-µm-thick ScaleSQ64-cleared 3D volume (right). Scale bars, 100 µm. Experiments on vertebrates conformed to all relevant governmental and institutional regulations and were approved by the Institutional Animal Care and Use Committee (IACUC) and the Office of Laboratory Animal Resources at the California Institute of Technology. In our primary publication2, results were obtained using the C57BL/6J mouse line. CaMKIIa, calcium/calmodulin-dependent protein kinase type IIa; CMV, cytomegalovirus early enhancer element.

Back to article page