Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Technical Report
  • Published:

Chemical RNA digestion enables robust RNA-binding site mapping at single amino acid resolution

Nature Structural & Molecular Biology volume 27, pages 678–682 (2020)Cite this article

Subjects

Abstract

RNA-binding sites (RBSs) can be identified by liquid chromatography and tandem mass spectrometry analyses of the protein–RNA conjugates created by crosslinking, but RBS mapping remains highly challenging due to the complexity of the formed RNA adducts. Here, we introduce RBS-ID, a method that uses hydrofluoride to fully cleave RNA into mono-nucleosides, thereby minimizing the search space to drastically enhance coverage and to reach single amino acid resolution. Moreover, the simple mono-nucleoside adducts offer a confident and quantitative measure of direct RNA–protein interaction. Using RBS-ID, we profiled ~2,000 human RBSs and probed Streptococcus pyogenes Cas9 to discover residues important for genome editing.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Fig. 1: RBS-ID robustly identifies RBSs at the proteome level.
Fig. 2: Domain and site-level analysis of identified RBSs.
Fig. 3: RBS-ID identifies functionally important residues in spCas9.

Similar content being viewed by others

Data availability

MS data have been deposited at the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) via the PRIDE partner repository with dataset identifier PXD016254. Source data for Figs. 2a, 2d, 2e, 3c and 3d and Extended Data Figs. 9a, 9b and 10a are available with the paper online.

References

  1. Castello, A. et al. Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell 149, 1393–1406 (2012).

    Article  CAS  Google Scholar 

  2. Baltz, A. G. et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol. Cell 46, 674–690 (2012).

    Article  CAS  Google Scholar 

  3. Leitner, A., Dorn, G. & Allain, F. H. T. Combining mass spectrometry (MS) and nuclear magnetic resonance (NMR) spectroscopy for integrative structural biology of protein–RNA complexes. Cold Spring Harb. Perspect. Biol. 11, a032359 (2019).

    Article  CAS  Google Scholar 

  4. Castello, A. et al. Comprehensive identification of RNA-binding domains in human cells. Mol. Cell 63, 696–710 (2016).

    Article  CAS  Google Scholar 

  5. He, C. et al. High-resolution mapping of RNA-binding regions in the nuclear proteome of embryonic stem cells. Mol. Cell 64, 416–430 (2016).

    Article  CAS  Google Scholar 

  6. Kramer, K. et al. Photo-cross-linking and high-resolution mass spectrometry for assignment of RNA-binding sites in RNA-binding proteins. Nat. Methods 11, 1064–1070 (2014).

    Article  CAS  Google Scholar 

  7. Panhale, A. et al. CAPRI enables comparison of evolutionarily conserved RNA interacting regions. Nat. Commun. 10, 2682 (2019).

    Article  Google Scholar 

  8. Shchepachev, V. et al. Defining the RNA interactome by total RNA-associated protein purification. Mol. Syst. Biol. 15, e8689 (2019).

    Article  Google Scholar 

  9. Jeong, K., Kim, S. & Bandeira, N. False discovery rates in spectral identification. BMC Bioinformatics 13(Suppl. 16), S2 (2012).

    Article  CAS  Google Scholar 

  10. Bogdanow, B., Zauber, H. & Selbach, M. Systematic errors in peptide and protein identification and quantification by modified peptides. Mol. Cell Proteom. 15, 2791–2801 (2016).

    Article  CAS  Google Scholar 

  11. Trendel, J. et al. The human RNA-binding proteome and its dynamics during translational arrest. Cell 176, 391–403 (2019).

    Article  CAS  Google Scholar 

  12. Crean, C., Uvaydov, Y., Geacintov, N. E. & Shafirovich, V. Oxidation of single-stranded oligonucleotides by carbonate radical anions: generating intrastrand cross-links between guanine and thymine bases separated by cytosines. Nucleic Acids Res. 36, 742–755 (2008).

    Article  CAS  Google Scholar 

  13. Woo, E. M., Fenyo, D., Kwok, B. H., Funabiki, H. & Chait, B. T. Efficient identification of phosphorylation by mass spectrometric phosphopeptide fingerprinting. Anal. Chem. 80, 2419–2425 (2008).

    Article  CAS  Google Scholar 

  14. Na, S., Bandeira, N. & Paek, E. Fast multi-blind modification search through tandem mass spectrometry. Mol. Cell Proteom. 11, 010199 (2012).

    Article  Google Scholar 

  15. Kong, A. T., Leprevost, F. V., Avtonomov, D. M., Mellacheruvu, D. & Nesvizhskii, A. I. MSFragger: ultrafast and comprehensive peptide identification in mass spectrometry-based proteomics. Nat. Methods 14, 513–520 (2017).

    Article  CAS  Google Scholar 

  16. Kim, S. & Pevzner, P. A. MS-GF+ makes progress towards a universal database search tool for proteomics. Nat. Commun. 5, 5277 (2014).

    Article  CAS  Google Scholar 

  17. Edwards, N. J. PepArML: a meta-search peptide identification platform for tandem mass spectra. Curr. Protoc. Bioinformatics 44, 13.23.1–13.23.23 (2013).

    Article  Google Scholar 

  18. Chalkley, R. J. & Clauser, K. R. Modification site localization scoring: strategies and performance. Mol. Cell Proteom. 11, 3–14 (2012).

    Article  CAS  Google Scholar 

  19. Chang, C. et al. PANDA: a comprehensive and flexible tool for quantitative proteomics data analysis. Bioinformatics 35, 898–900 (2019).

    Article  CAS  Google Scholar 

  20. UniProt Consortium. UniProt: a worldwide hub of protein knowledge. Nucleic Acids Res. 47, D506–D515 (2019).

  21. Huang, D. W., Sherman, B. T. & Lempicki, R. A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4, 44–57 (2009).

    Article  CAS  Google Scholar 

  22. Schafer, I. B. et al. Molecular basis for poly(A) RNP architecture and recognition by the Pan2-Pan3 deadenylase. Cell 177, 1619–1631 (2019).

    Article  Google Scholar 

  23. Kuhn, U. & Pieler, T. Xenopus poly(A) binding protein: functional domains in RNA binding and protein–protein interaction. J. Mol. Biol. 256, 20–30 (1996).

    Article  CAS  Google Scholar 

  24. Hawley, B. R., Lu, W. T., Wilczynska, A. & Bushell, M. The emerging role of RNAs in DNA damage repair. Cell Death Differ. 24, 580–587 (2017).

    Article  CAS  Google Scholar 

  25. Shetlar, M. D., Carbone, J., Steady, E. & Hom, K. Photochemical addition of amino acids and peptides to polyuridylic acid. Photochem. Photobiol. 39, 141–144 (1984).

    Article  CAS  Google Scholar 

  26. Hornbeck, P. V. et al. PhosphoSitePlus, 2014: mutations, PTMs and recalibrations. Nucleic Acids Res. 43, D512–D520 (2015).

    Article  CAS  Google Scholar 

  27. Yoon, J. H. et al. Tyrosine phosphorylation of HuR by JAK3 triggers dissociation and degradation of HuR target mRNAs. Nucleic Acids Res. 42, 1196–1208 (2014).

    Article  CAS  Google Scholar 

  28. Jiang, F., Zhou, K., Ma, L., Gressel, S. & Doudna, J. A. A Cas9–guide RNA complex preorganized for target DNA recognition. Science 348, 1477–1481 (2015).

    Article  CAS  Google Scholar 

  29. Anders, C., Niewoehner, O., Duerst, A. & Jinek, M. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease. Nature 513, 569–573 (2014).

    Article  CAS  Google Scholar 

  30. Ran, F. A. et al. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281–2308 (2013).

    Article  CAS  Google Scholar 

  31. Leonetti, M. D., Sekine, S., Kamiyama, D., Weissman, J. S. & Huang, B. A scalable strategy for high-throughput GFP tagging of endogenous human proteins. Proc. Natl Acad. Sci. USA 113, E3501–3508 (2016).

    Article  CAS  Google Scholar 

  32. He, L., Diedrich, J., Chu, Y. Y. & Yates, J. R. III. Extracting accurate precursor information for tandem mass spectra by RawConverter. Anal. Chem. 87, 11361–11367 (2015).

    Article  CAS  Google Scholar 

  33. Chambers, M. C. et al. A cross-platform toolkit for mass spectrometry and proteomics. Nat. Biotechnol. 30, 918–920 (2012).

    Article  CAS  Google Scholar 

  34. Vizcaino, J. A. et al. The PRoteomics IDEntifications (PRIDE) database and associated tools: status in 2013. Nucleic Acids Res. 41, D1063–D1069 (2013).

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We thank S. Shin, K. Baeg and S. Lee for insightful comments and discussion. We are also grateful to J. Kim, J. Yang, D. Choi and E. Kim for technical help, and all members of our laboratories for helpful discussion. We thank J. S. Kim (Seoul National University), Pacific Northwest National Laboratory and the OMICS.PNL.GOV for providing valuable plasmid and software. This work was supported by IBS-R008-D1 of the Institute for Basic Science from the Ministry of Science and ICT of Korea (J.W.B., S.-C.K., Y.N., V.N.K. and J.-S.K.) and BK21 Research Fellowships (J.W.B.) from the Ministry of Education, Science and Technology of Korea.

Author information

Authors and Affiliations

  1. Center for RNA Research, Institute for Basic Science, Seoul, Korea

    Jong Woo Bae, S. Chul Kwon, Yongwoo Na, V. Narry Kim & Jong-Seo Kim

  2. School of Biological Sciences, Seoul National University, Seoul, Korea

    Jong Woo Bae, S. Chul Kwon, Yongwoo Na, V. Narry Kim & Jong-Seo Kim

Authors
  1. Jong Woo Bae
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. S. Chul Kwon
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yongwoo Na
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. V. Narry Kim
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Jong-Seo Kim
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

J.W.B., V.N.K. and J.-S.K. conceived the project and designed the experiments. J.W.B. developed the protocol and performed all biochemical experiments with the support of S.C.K. and Y.N. J.W.B. generated and analyzed all LC-MS/MS datasets. J.W.B., V.N.K. and J.-S.K. wrote the manuscript.

Corresponding authors

Correspondence to V. Narry Kim or Jong-Seo Kim.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Peer review information Peer reviewer reports are available. Anke Sparmann was the primary editor on this article and managed its editorial process and peer review in collaboration with the rest of the editorial team.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended Data Fig. 1 HF treatment on RNA and peptides.

a, Schematic illustration of HF treatment on RNA (left) and the resulting products (right). HF-mediated cleavage sites are highlighted. b, UV-absorbance chromatogram of 20-mer RNA (AUGCAUGCAUGCAUGCAUGC) digested with HF (black solid and dashed lines from duplicate experiments), merged with those of undigested RNA (gray) and reference chemicals (colored, solid). Peaks of reference chemicals were re-sized for better visualization. The black solid line is the source data for Fig. 1b. c, UV-absorbance chromatogram of HeLaT total RNA digested with HF (black, solid or dashed lines from duplicate experiments), merged with those of reference chemicals (colored, solid). Peaks of reference chemicals were re-sized for better visualization. d, Proportion of semi-tryptic PSM identified from HeLaT digest peptides upon HF treatment, compared to negative control treated with H2O. Two-sided unpaired Student’s T-test was performed between n = 3 biologically independent samples (H2O vs. HF), assuming equal variance. The mean values were depicted with error bars that indicate standard deviation between replicates. P-value, rounded up to the fourth decimal point: 0.0258. e, Proportion of identified PSM (below PSM-level FDR = 0.01) upon HF treatment, compared to H2O treatment. Two-sided unpaired Student’s T-test was performed as described above. The mean values were depicted with error bars that indicate standard deviation between replicates. P-value, rounded up to the fourth decimal point: 0.1359.

Extended Data Fig. 2 Open search on total RNA-RBS and mRNA-RBS using MODa and MSFragger.

a, MODa14 search for modified mass on mRNA-RBS. The y-axis indicates mean spectral counts from duplicate experiments. b-c, MSFragger15 search for modified mass on total RNA-RBS (b) and mRNA-RBS (c). d, Mean percentage of Uracil modification over Uridine modification, a highly likely in-source fragmentation product, between replicate experiments, calculated from MSFragger search results as (#PSM with Uracil adduct: 112 & 55 to account for Cys)/(#PSM with Uracil or Uridine adduct: 244, 112 & 187, 55 to account for Cys). The error bars indicate standard deviation. Free Cys was carbamidomethylated, so the corresponding adduct mass was used as a fixed modification. Owing to mutually exclusive U-crosslinking and carbamidomethylation on Cys, the observed conjugate mass of uridine on Cys (187) was smaller than that of other amino acids (244) by the difference of mass of carbamidomethyl group (57). Thus, modification mass on Cys was corrected by adding the mass of carbamidomethyl group. The percentages were rounded up to the second decimal point. e, Comparison of closed search results on total RNA and mRNA RBS-ID experiments, allowing up to one or two modifications per peptide. Modification-specific peptide-level FDR was set to 0.01. PSM counts for peptides with two modifications were depicted.

Extended Data Fig. 3 Comparison between RBS-ID and previous RBS- or RBD-profiling studies.

a, Comparison of the position of RBS in peptides shared between RBS-ID and RNPxl Venn diagram (left) shows the overlap between the peptides with uniquely localized RBS in RBS-ID (1,972) and those in human proteins of RNPxl (29)6. Please note that most peptides from RNPxl are also detected by RBS-ID, demonstrating the comprehensiveness of our method. The Pie chart (right) displays that among 25 common peptides, 24 peptides show consistent localization of RBS between the datasets, indicating the accuracy of the methods. b, Relative position of the peptides identified as ‘RBDpep’4. X-axis shows the position of the terminus of peptides relative to RBSs identified by RBS-ID (n = 1,478). c, Relative position of the peptides identified as ‘XL-peptide’7. X-axis shows the position of the terminus of peptides relative to RBSs identified by RBS-ID (n = 869).

Extended Data Fig. 4 Reproducibility of MS1 intensity-based label-free quantification.

a-b, MS1 intensity-based label-free quantification27 of RBS-containing peptides co-identified in Total RNA-RBS (a) or mRNA-RBS (b) replicate experiments. Pearson’s correlation coefficient and Spearman’s correlation coefficient were each calculated and rounded up to the second decimal point.

Extended Data Fig. 5 RBS-identified protein groups and regions.

a, Top 5 GO terms associated with proteins that are not annotated as RBPs (MF: molecular function, BP: biological process, CC: Cellular component, 5 each)20,21. b-c, Top 5 GO terms associated with proteins whose RBSs are identified exclusively in total RNA enrichment but not in poly(A) + RNA enrichment (b) or in poly(A) + RNA enrichment but not in total RNA enrichment (c) (MF, BP, CC, 5 each).

Extended Data Fig. 6 Examples of RBS-identified proteins.

a, Example of RBSs identified in distant primary sequence positions (PABPC1). Sequence homology of amino acids at -5 to +5 positions from Y194, Y297, and Y364 compared to that of Y222, F325, and Y393 in yeast Pab1 are described, respectively. Identical amino acids in the same positions are bold-faced. b, Partial structure of yeast Pab1 bound to poly(A) RNA (PDB 6R5K22). Y222, F325, and Y393 are indicated. c-h, Examples of RBSs identified in regions that are not annotated as RBDs. RBSs identified in NSUN5 (c), RTCA (d), APOBEC3C (e), TRIM25 (f), SERBP1 (g), and HNRNPA1 (h) are depicted. RBSs with high spectral counts are indicated.

Extended Data Fig. 7 Purified spCas9 protein and template DNA for sgRNA synthesis.

a, Purified His6-HA-NLS-TEV-spCas9 on SDS-PAGE gel stained with Coomassie G25. b, Template DNA prepared for T7 in vitro transcription of anti-CBX1 sgRNA.

Extended Data Fig. 8 Positions of RBS in crystal structure of spCas9 in complex with sgRNA and target DNA.

Positions of RBSs in the crystal structure of spCas9 in complex with sgRNA and target DNA (PDB 4UN329). Individual atoms of RBSs were drawn as dark blue spheres.

Extended Data Fig. 9 Impact of RBS mutagenesis on spCas9 gene editing activity.

a, EtBr-agarose gel image of cut/uncut fragments after T7E1 assay30, 48 hours after transfection of negative control (mock), non-target-wildtype (NC), wildtype (WT), Y450A, R919A spCas9. b, EtBr-agarose gel image of input PCR amplicons. c, Histograms of GFP fluorescence of msfGFP-expressing clonal stable 293 cells 96 hours after transfection with non-target-wildtype (NC), wildtype (WT), Y450A, R919A spCas9. d, Cell counts per each flow cytometry run. Uncropped images for panels a-b are available as source data.

Source data

Extended Data Fig. 10 Verification of comparable expression of spCas9.

a, Verification of comparable expression of spCas9 proteins. Western blot of msfGFP-expressing HEK293E clonal stable cell 48 hours after transfection of negative control (mock), non-target-wildtype (NC), wildtype (WT), Y450A, or R919A spCas9. b, Quantification of spCas9 protein expression level. Two-sided unpaired Student’s T-test was performed with n = 3 biologically independent samples (WT vs. Y450A; WT vs. R919A), assuming equal variance. The mean values were depicted with error bars that indicate standard deviation between replicates. P-value, rounded up to the fourth decimal point: 0.3261 (WT vs. Y450A), 0.2257 (WT vs. R919A). Uncropped image for panel a is available as source data.

Source data

Supplementary information

Supplementary Information

Supplementary Figs. 1–3.

Reporting Summary

Peer Review Information

Supplementary Table 1

Human RBS open search results.

Supplementary Table 2

Human RBS closed search results.

Supplementary Table 3

spCas9 RBS closed search results.

Source data

Source Data Fig. 2

Statistical source data

Source Data Fig. 3

Statistical source data

Source Data Extended Data Fig. 9

Unprocessed gels

Source Data Extended Data Fig. 10

Unprocessed western blots

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Bae, J.W., Kwon, S.C., Na, Y. et al. Chemical RNA digestion enables robust RNA-binding site mapping at single amino acid resolution. Nat Struct Mol Biol 27, 678–682 (2020). https://doi.org/10.1038/s41594-020-0436-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/s41594-020-0436-2

This article is cited by

Search

Advanced search

Quick links

Nature Briefing: Translational Research

Sign up for the Nature Briefing: Translational Research newsletter — top stories in biotechnology, drug discovery and pharma.

Get what matters in translational research, free to your inbox weekly. Sign up for Nature Briefing: Translational Research