Abstract
Gene-editing technologies, which include the CRISPR–Cas nucleases1,2,3 and CRISPR base editors4,5, have the potential to permanently modify disease-causing genes in patients6. The demonstration of durable editing in target organs of nonhuman primates is a key step before in vivo administration of gene editors to patients in clinical trials. Here we demonstrate that CRISPR base editors that are delivered in vivo using lipid nanoparticles can efficiently and precisely modify disease-related genes in living cynomolgus monkeys (Macaca fascicularis). We observed a near-complete knockdown of PCSK9 in the liver after a single infusion of lipid nanoparticles, with concomitant reductions in blood levels of PCSK9 and low-density lipoprotein cholesterol of approximately 90% and about 60%, respectively; all of these changes remained stable for at least 8 months after a single-dose treatment. In addition to supporting a ‘once-and-done’ approach to the reduction of low-density lipoprotein cholesterol and the treatment of atherosclerotic cardiovascular disease (the leading cause of death worldwide7), our results provide a proof-of-concept for how CRISPR base editors can be productively applied to make precise single-nucleotide changes in therapeutic target genes in the liver, and potentially in other organs.
This is a preview of subscription content, access via your institution
Relevant articles
Open Access articles citing this article.
-
Gene Modulation with CRISPR-based Tools in Human iPSC-Cardiomyocytes
Stem Cell Reviews and Reports Open Access 19 January 2023
-
Improved cytosine base editors generated from TadA variants
Nature Biotechnology Open Access 09 January 2023
-
CRISPR/Cas systems usher in a new era of disease treatment and diagnosis
Molecular Biomedicine Open Access 14 October 2022
Access options
Subscribe to Nature+
Get immediate online access to Nature and 55 other Nature journal
$29.99
monthly
Subscribe to Journal
Get full journal access for 1 year
$199.00
only $3.90 per issue
All prices are NET prices.
VAT will be added later in the checkout.
Tax calculation will be finalised during checkout.
Buy article
Get time limited or full article access on ReadCube.
$32.00
All prices are NET prices.




Data availability
DNA and RNA sequencing data that support the findings of this study have been deposited in the NCBI Sequence Read Archive with the accession code PRJNA716270. All other data supporting the findings of this study (Figs. 1–4, Extended Data Figs. 1–9) are available within the Article and its Supplementary Information. The GRCh38 reference human genome (ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/405/GCA_000001405.15_GRCh38/seqs_for_alignment_pipelines.ucsc_ids/GCA_000001405.15_GRCh38_no_alt_analysis_set.fna.gz, ftp://ftp.ensembl.org/pub/release-98/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna.chromosome.{1-22,X,Y,MT}.fa and ftp://ftp.ensembl.org/pub/release-98/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna.nonchromosomal.fa) and Gencode v.34 (ftp://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_34/gencode.v34.primary_assembly.annotation.gtf.gz) and Ensembl v.98 (ftp://ftp.ensembl.org/pub/release-98/gtf/homo_sapiens/Homo_sapiens.GRCh38.98.gtf.gz) annotations were used. The macFas5 cynomolgus monkey reference genome (ftp://ftp.ensembl.org/pub/release-98/fasta/macaca_fascicularis/dna/Macaca_fascicularis.Macaca_fascicularis_5.0.dna.chromosome.{1-20,X,MT}.fa.gz and ftp://ftp.ensembl.org/pub/release-98/fasta/macaca_fascicularis/dna/Macaca_fascicularis.Macaca_fascicularis_5.0.dna.nonchromosomal.fa.gz) was used. Source data are provided with this paper.
Code availability
Custom codes used to analyse Digenome-seq data are provided in the Supplementary Information (files named digenome_step1.sh and digenome_step2.R), as are instructions (file named README.txt).
References
Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821 (2012).
Zetsche, B. et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759–771 (2015).
Strecker, J. et al. Engineering of CRISPR–Cas12b for human genome editing. Nat. Commun. 10, 212 (2019).
Komor, A. C., Kim, Y. B., Packer, M. S., Zuris, J. A. & Liu, D. R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533, 420–424 (2016).
Gaudelli, N. M. et al. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551, 464–471 (2017).
Doudna, J. A. The promise and challenge of therapeutic genome editing. Nature 578, 229–236 (2020).
GBD 2017 Causes of Death Collaborators. Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet 392, 1736–1788 (2018).
Anzalone, A. V. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149–157 (2019).
Yin, H. et al. Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype. Nat. Biotechnol. 32, 551–553 (2014).
Ding, Q. et al. Permanent alteration of PCSK9 with in vivo CRISPR-Cas9 genome editing. Circ. Res. 115, 488–492 (2014).
Yin, H. et al. Structure-guided chemical modification of guide RNA enables potent non-viral in vivo genome editing. Nat. Biotechnol. 35, 1179–1187 (2017).
Finn, J. D. et al. A single administration of CRISPR/Cas9 lipid nanoparticles achieves robust and persistent in vivo genome editing. Cell Rep. 22, 2227–2235 (2018).
Chadwick, A. C., Wang, X. & Musunuru, K. In vivo base editing of PCSK9 (proprotein convertase subtilisin/kexin type 9) as a therapeutic alternative to genome editing. Arterioscler. Thromb. Vasc. Biol. 37, 1741–1747 (2017).
Ryu, S. M. et al. Adenine base editing in mouse embryos and an adult mouse model of Duchenne muscular dystrophy. Nat. Biotechnol. 36, 536–539 (2018).
Rossidis, A. C. et al. In utero CRISPR-mediated therapeutic editing of metabolic genes. Nat. Med. 24, 1513–1518 (2018).
Abifadel, M. et al. Mutations in PCSK9 cause autosomal dominant hypercholesterolemia. Nat. Genet. 34, 154–156 (2003).
Cohen, J. C., Boerwinkle, E., Mosley, T. H., Jr & Hobbs, H. H. Sequence variations in PCSK9, low LDL, and protection against coronary heart disease. N. Engl. J. Med. 354, 1264–1272 (2006).
Rao, A. S. et al. Large-scale phenome-wide association study of PCSK9 variants demonstrates protection against ischemic stroke. Circ. Genom. Precis. Med. 11, e002162 (2018).
Zhao, Z. et al. Molecular characterization of loss-of-function mutations in PCSK9 and identification of a compound heterozygote. Am. J. Hum. Genet. 79, 514–523 (2006).
Hooper, A. J., Marais, A. D., Tanyanyiwa, D. M. & Burnett, J. R. The C679X mutation in PCSK9 is present and lowers blood cholesterol in a southern African population. Atherosclerosis 193, 445–448 (2007).
Ray, K. K. et al. Inclisiran in patients at high cardiovascular risk with elevated LDL cholesterol. N. Engl. J. Med. 376, 1430–1440 (2017).
Brandts, J. & Ray, K. K. Low density lipoprotein cholesterol-lowering strategies and population health: time to move to a cumulative exposure model. Circulation 141, 873–876 (2020).
Choudhry, N. K. et al. Full coverage for preventive medications after myocardial infarction. N. Engl. J. Med. 365, 2088–2097 (2011).
Rodriguez, F. et al. Association of statin adherence with mortality in patients with atherosclerotic cardiovascular disease. JAMA Cardiol. 4, 206–213 (2019).
Hines, D. M., Rane, P., Patel, J., Harrison, D. J. & Wade, R. L. Treatment patterns and patient characteristics among early initiators of PCSK9 inhibitors. Vasc. Health Risk Manag. 14, 409–418 (2018).
Zafrir, B., Egbaria, A., Stein, N., Elis, A. & Saliba, W. PCSK9 inhibition in clinical practice: treatment patterns and attainment of lipid goals in a large health maintenance organization. J. Clin. Lipidol. 15, 202–211.e2 (2021).
Gaudelli, N. M. et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat. Biotechnol. 38, 892–900 (2020).
Hendel, A. et al. Chemically modified guide RNAs enhance CRISPR–Cas genome editing in human primary cells. Nat. Biotechnol. 33, 985–989 (2015).
Conway, A. et al. Non-viral delivery of zinc finger nuclease mRNA enables highly efficient in vivo genome editing of multiple therapeutic gene targets. Mol. Ther. 27, 866–877 (2019).
Villiger, L. et al. In vivo cytidine base editing of hepatocytes without detectable off-target mutations in RNA and DNA. Nat. Biomed. Eng. 5, 179–189 (2021).
Petri, K. et al. Global-scale CRISPR gene editor specificity profiling by ONE-seq identifies population-specific, variant off-target effects. Preprint at https://doi.org/10.1101/2021.04.05.438458 (2021).
Liang, P. et al. Genome-wide profiling of adenine base editor specificity by EndoV-seq. Nat. Commun. 10, 67 (2019).
Kim, D., Kim, D. E., Lee, G., Cho, S. I. & Kim, J. S. Genome-wide target specificity of CRISPR RNA-guided adenine base editors. Nat. Biotechnol. 37, 430–435 (2019).
Grünewald, J. et al. Transcriptome-wide off-target RNA editing induced by CRISPR-guided DNA base editors. Nature 569, 433–437 (2019).
Zhou, C. et al. Off-target RNA mutation induced by DNA base editing and its elimination by mutagenesis. Nature 571, 275–278 (2019).
Wang, L. et al. Long-term stable reduction of low-density lipoprotein in nonhuman primates following in vivo genome editing of PCSK9. Mol. Ther. https://doi.org/10.1016/j.ymthe.2021.02.020 (2021).
Villiger, L. et al. Treatment of a metabolic liver disease by in vivo genome base editing in adult mice. Nat. Med. 24, 1519–1525 (2018).
Song, C. Q. et al. Adenine base editing in an adult mouse model of tyrosinaemia. Nat. Biomed. Eng. 4, 125–130 (2020).
Koblan, L. W. et al. In vivo base editing rescues Hutchinson–Gilford progeria syndrome in mice. Nature 589, 608–614 (2021).
Clement, K. et al. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat. Biotechnol. 37, 224–226 (2019).
Magoč, T. & Salzberg, S. L. FLASH: fast length adjustment of short reads to improve genome assemblies. Bioinformatics 27, 2957–2963 (2011).
Concordet, J. P. & Haeussler, M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res. 46, W242–W245 (2018).
Van der Auwera, G. A. et al. From FastQ data to high confidence variant calls: the Genome Analysis Toolkit best practices pipeline. Curr. Protoc. Bioinformatics 43, 11.10.1–11.10.33 (2013).
Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120 (2014).
Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357–359 (2012).
Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
Bae, S., Park, J. & Kim, J. S. Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30, 1473–1475 (2014).
Acknowledgements
Conception and design of the work was performed and supported by Verve Therapeutics. Acquisition, analysis and interpretation of the data was performed and supported by Verve Therapeutics, with some aspects being performed on behalf or at the direction of Verve Therapeutics. Acuitas Therapeutics supported the work by providing Verve Therapeutics with LNP reagents and manufacturing the LNP formulations. Beam Therapeutics supported the work by developing the ABE8.8-m protein sequence. We are grateful to J. K. Joung for critical reading of the manuscript.
Author information
Authors and Affiliations
Contributions
A.C.C. and K.G.R. conceived, designed and directed the gRNA design and screening. A.C.C. conceived, designed and directed the cell-based studies and off-target analyses. E.R. conceived, designed and directed the mouse and cynomolgus studies with design input from P.M. C.J.C. and C.W.R. conceived, designed and directed mRNA modification and codon optimization. C.J.C, K.B., C.W.R, A.S. and K.W. conceived, designed and/or directed mRNA processing optimization. K.M., A.C.C., T.M., J.E.D., C.W.R., K.W., C.D., V.C., M.A., A.B., K.B., S.B., M.C.B., H.-M.C., T.V.C., J.D.G., S.A.G., R.G., L.N.K., J.L., J.A.M., Y.M., A.M.M., Y.S.N., J.N., H.R., A.S., M.S., M.R.S., L.E.S., K.G.R., P.M., C.J.C. and E.R. contributed to wet laboratory experiments. K.M., S.P.G. and S.I. contributed to bioinformatic analyses. S.H.Y.F. and Y.K.T. contributed to the formulation and manufacture of LNPs. N.M.G. and G.C. contributed to the development of base-editing technology and specifically the ABE8.8-m protein sequence. K.M. wrote the manuscript, and all authors contributed to the editing of the manuscript. A.M.B. supervised the work with oversight by S.K. and advisory input from K.M.
Corresponding author
Ethics declarations
Competing interests
K.M. is an advisor to and holds equity in Verve Therapeutics and Variant Bio. A.M.B. is an employee of Verve Therapeutics and holds equity in Verve Therapeutics, Lyndra Therapeutics, Corner Therapeutics and Cocoon Biotech. S.K. is an employee of Verve Therapeutics, holds equity in Verve Therapeutics and Maze Therapeutics, and has served as a consultant for Acceleron, Eli Lilly, Novartis, Merck, Novo Nordisk, Novo Ventures, Ionis, Alnylam, Aegerion, Haug Partners, Noble Insights, Leerink Partners, Bayer Healthcare, Illumina, Color Genomics, MedGenome, Quest and Medscape. S.H.Y.F. and Y.K.T. are employees of and hold equity in Acuitas Therapeutics. N.M.G. and G.C. are employees of and hold equity in Beam Therapeutics. All other authors are employees of and hold equity in Verve Therapeutics. Verve Therapeutics has filed for patent protection related to various aspects of therapeutic base editing of PCSK9, with A.C.C., C.J.C., C.W.R., K.G.R. and E.R. as the inventors.
Additional information
Peer review information Nature thanks Kathryn Moore, Alan Tall, Fyodor Urnov and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Extended data figures and tables
Extended Data Fig. 1 Overview of base-editing approach.
a, Schematic of adenine base editing. b, Schematic showing potential splicing outcomes with disruption of splice donor or splice acceptor sequences. Other outcomes are possible, such as inclusion of part of the intron in the splicing product. c, Schematic with Sanger sequencing chromatogram, demonstrating editing of adenine base in the antisense strand at the splice donor at the end of PCSK9 exon 1 (PCR amplification from the genomic DNA of the cells transfected with a dose of 2,500 ng ml−1 in Fig. 1b), portraying how splice-site disruption results in an in-frame stop codon. Heterozygosity for a naturally occurring single-nucleotide polymorphism (SNP) is evident downstream of the editing site.
Extended Data Fig. 2 Editing of splice-site adenine bases throughout the human PCSK9 gene with first set of ten candidate gRNAs.
Primary human hepatocytes were transfected at a dose of 5,000 ng RNA per ml; the boldface underlined letter in each of the following protospacer/PAM sequences (in which the solidus indicates the division between the protospacer and PAM) indicates the target splice-site adenine base. The black box in each panel indicates the gRNA protospacer sequence. All panels were generated with CRISPResso2. a, PCSK9-1, CCCGCACCTTGGCGCAGCGG/TGG. b, PCSK9-2, GGTGGCTCACCAGCTCCAGC/AGG. c, PCSK9-3, GCTTACCTGTCTGTGGAAGC/GGG. d, PCSK9-4, TGCTTACCTGTCTGTGGAAG/CGG. e, PCSK9-5, TTGGAAAGACGGAGGCAGCC/TGG. f, PCSK9-6, GAAAGACGGAGGCAGCCTGG/TGG. g, PCSK9-7, TCCCAGGCCTGGAGTTTATT/CGG. h, PCSK9-8, AGCACCTACCTCGGGAGCTG/AGG. i, PCSK9-9, CTTTCCAGGTCATCACAGTT/GGG. j, PCSK9-10, CCTTTCCAGGTCATCACAGT/TGG.
Extended Data Fig. 3 Editing of splice-site adenine bases throughout the human PCSK9 gene with second set of ten candidate gRNAs.
Primary human hepatocytes were transfected at a dose of 5,000 ng RNA per ml; the boldface underlined letter in each of the following protospacer/PAM sequences (in which the solidus indicates the division between the protospacer and PAM) indicates the target splice-site adenine base. The black box in each panel indicates the gRNA protospacer sequence. All panels were generated with CRISPResso2. a, PCSK9-11, TTTCCAGGTCATCACAGTTG/GGG. b, PCSK9-12, CTTACCTGCCCCATGGGTGC/TGG. c, PCSK9-13, TAAGGCCCAAGGGGGCAAGC/TGG. d, PCSK9-14, CCTCTTCACCTGCTCCTGAG/GGG. e, PCSK9-15, GCCTCTTCACCTGCTCCTGA/GGG. f, PCSK9-16, TTCACCTGCTCCTGAGGGGC/CGG. g, PCSK9-17, TCACCTGCTCCTGAGGGGCC/GGG. h, PCSK9-18, CCCAGGCTGCAGCTCCCACT/GGG. i, PCSK9-19, CCCCAGGCTGCAGCTCCCAC/TGG. j, PCSK9-20, GCAGGTGACCGTGGCCTGCG/AGG.
Extended Data Fig. 4 Editing of PCSK9 exon 1 splice-donor adenine base in mice and in cynomolgus monkeys.
a–f, Representative liver samples from mice treated with LNPs with PCSK9-1m gRNA (portrayed in Fig. 1e). Protospacer/PAM sequence, CCCATACCTTGGAGCAACGG/CGG (in which the solidus indicates the division between the protospacer and PAM, and the boldface underlined letter indicates the target splice-donor adenine base). The black box in each panel indicates the gRNA protospacer sequence. All panels were generated with CRISPResso2. LNP doses were 2.0 mg kg−1 (a), 1.0 mg kg−1 (b), 0.5 mg kg−1 (c), 0.25 mg kg−1 (d), 0.125 mg kg−1 (e) and 0.05 mg kg−1 (f). g–i, Representative liver samples from three monkeys treated with a dose of 1.0 mg kg−1 of LNPs with PCSK9-1 gRNA, portrayed in Fig. 2a–d (treated monkeys 1, 2 and 3). Protospacer/PAM sequence, CCCGCACCTTGGCGCAGCGG/TGG (in which the solidus indicates the division between the protospacer and PAM, and the boldface underlined letter indicates the target splice-donor adenine base). The black box in each panel indicates the gRNA protospacer sequence. All panels were generated with CRISPResso2.
Extended Data Fig. 5 Liver function tests in short-term cynomolgus monkey studies.
a, Absolute values of blood levels of AST, ALT, alkaline phosphatase, γ-glutamyltransferase, total bilirubin and albumin in the three LNP-treated monkeys in Fig. 2a–d, as well as a contemporaneous control monkey that received PBS, at various time points up to 15 days. n = 1 blood sample per monkey at each time point. Some values are missing for the control monkey (all day 3 values, all later γ-glutamyltransferase values). b–g, Absolute values of blood levels of AST (b), ALT (c), alkaline phosphatase (d), γ-glutamyltransferase (e), total bilirubin (f) and albumin (g) in the individual monkeys portrayed in Fig. 2e–g, as well as in non-contemporaneous control monkeys that received PBS, at various time points up to 15 days. n = 1 blood sample per monkey at each time point.
Extended Data Fig. 6 Pharmacokinetics of ABE8.8 and PCSK9-1 LNPs in cynomolgus monkeys.
a, Plasma levels of ionizable cationic lipid and PEG-lipid components of ABE8.8 and PCSK9-1 LNPs at various LNP doses in the monkeys portrayed in Fig. 2e–g (mean ± s.d. for each group, n = 3 monkeys per dose group) at various time points up to 2 weeks after treatment. llod, lower limit of detection. b, Liver ABE8.8 mRNA levels in monkeys that received a dose of 1.0 mg kg−1 LNPs (mean ± s.d. for each group, n = 4 monkeys per necropsy group) at various time points up to 2 weeks after treatment.
Extended Data Fig. 7 Long-term effects of adenine base editing of PCSK9 on lipoprotein(a) in cynomolgus monkeys.
Changes in the blood lipoprotein(a) level in the six monkeys from Fig. 3a, comparing levels at various time points up to 238 days after treatment versus the baseline level before treatment. Mean ± s.d. for the LNP-treated group (n = 4 monkeys) and mean for the control group (n = 2 monkeys) at each time point). The dotted lines indicate 100% and 65% of baseline levels.
Extended Data Fig. 8 Long-term pharmacodynamic effects of adenine base editing of PCSK9 in cynomolgus monkeys.
a–j, Absolute values of blood levels of LDL cholesterol (a), total cholesterol (b), high-density lipoprotein (HDL) cholesterol (c), triglycerides (d), AST (e), ALT (f), alkaline phosphatase (g), γ-glutamyltransferase (h), total bilirubin (i) and albumin (j) in the individual monkeys portrayed in Fig. 3 (n = 4 monkeys treated with a dose of 3.0 mg kg−1 of an LNP formulation with ABE8.8 mRNA and PCSK9-1 gRNA, and n = 2 monkeys treated with PBS) at various time points up to 238 days after treatment. Shades of red represent LNP-treated monkeys, and shades of grey represent control monkeys.
Extended Data Fig. 9 Additional studies with cynomolgus monkeys receiving a dose of 3.0 mg kg−1 of LNPs.
Levels of liver editing of the PCSK9 exon 1 splice-donor adenine base (at day 15), blood AST and blood ALT. n = 3 monkeys treated with PBS, n = 4 monkeys treated with a dose of 3.0 mg kg−1 LNPs containing ABE8.8 mRNA and non-PCSK9-targeting gRNA and n = 4 monkeys treated with a dose of 3.0 mg kg−1 ABE8.8 and PCSK9-1 LNPs. Bar indicates mean value at each time point.
Supplementary information
Supplementary Tables
This file contains Supplementary Tables 1-6.
Supplementary Data
This zipped file contains 3 files: digenome_step1.sh - custom code for step 1 of the Digenome-seq analysis described in this manuscript; digenome_step2.R custom code for step 2 of the Digenome-seq analysis described in this manuscript and a README.txt with instructions on how to run the custom code files.
Rights and permissions
About this article
Cite this article
Musunuru, K., Chadwick, A.C., Mizoguchi, T. et al. In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature 593, 429–434 (2021). https://doi.org/10.1038/s41586-021-03534-y
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/s41586-021-03534-y
This article is cited by
-
Improved cytosine base editors generated from TadA variants
Nature Biotechnology (2023)
-
Accounting for diversity in the design of CRISPR-based therapeutic genome editing
Nature Genetics (2023)
-
Engineering a precise adenine base editor with minimal bystander editing
Nature Chemical Biology (2023)
-
Gene therapy for liver diseases — progress and challenges
Nature Reviews Gastroenterology & Hepatology (2023)
-
Passive, active and endogenous organ-targeted lipid and polymer nanoparticles for delivery of genetic drugs
Nature Reviews Materials (2023)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.