Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Lymphoangiocrine signals promote cardiac growth and repair

Abstract

Recent studies have suggested that lymphatics help to restore heart function after cardiac injury1,2,3,4,5,6. Here we report that lymphatics promote cardiac growth, repair and cardioprotection in mice. We show that a lymphoangiocrine signal produced by lymphatic endothelial cells (LECs) controls the proliferation and survival of cardiomyocytes during heart development, improves neonatal cardiac regeneration and is cardioprotective after myocardial infarction. Embryos that lack LECs develop smaller hearts as a consequence of reduced cardiomyocyte proliferation and increased cardiomyocyte apoptosis. Culturing primary mouse cardiomyocytes in LEC-conditioned medium increases cardiomyocyte proliferation and survival, which indicates that LECs produce lymphoangiocrine signals that control cardiomyocyte homeostasis. Characterization of the LEC secretome identified the extracellular protein reelin (RELN) as a key component of this process. Moreover, we report that LEC-specific Reln-null mouse embryos develop smaller hearts, that RELN is required for efficient heart repair and function after neonatal myocardial infarction, and that cardiac delivery of RELN using collagen patches improves heart function in adult mice after myocardial infarction by a cardioprotective effect. These results highlight a lymphoangiocrine role of LECs during cardiac development and injury response, and identify RELN as an important mediator of this function.

Main

The molecular and functional characterization of the lymphatic vasculature has greatly improved1. Recent data suggest that natural or therapeutic formation of new lymphatics (lymphangiogenesis) correlates with improved systolic function after experimental myocardial infarction; it delays atherosclerotic plaque formation, facilitates the healing process after myocardial infarction, and can be a natural response to fluid accumulation into the myocardium during cardiac oedema2,3,4. These findings indicate that stimulation of lymphangiogenesis in the infarcted heart could improve cardiac function and prevent adverse cardiac remodelling3. Studies in mouse and zebrafish have suggested that newly formed lymphatics provided a route for the clearance of immune cells in the injured heart, and therefore promote cardiac repair5,6. However, whether lymphatics have additional functional roles during heart development and cardiac repair is not known.

Lymphatics regulate heart growth

As previously reported2, at around embryonic day (E) 14.5 cardiac lymphatics become evident, particularly over the dorsal side of the heart (Fig. 1a). As development progresses, lymphatics expand over the dorsal and ventral surfaces, and into the myocardium during embryonic and postnatal stages (Fig. 1a). To evaluate a possible developmental role of cardiac-associated lymphatics, we took advantage of Prox1 floxed mice7. Prox1 is a master regulator required to promote and maintain LEC fate identity8,9 and germline deletion of Prox1 in mice results in complete lack of LECs and embryonic lethality at around E14.58. To conditionally delete Prox1 from LECs, we crossed Cad5(PAC)-creERT2 mice10 with Prox1 floxed mice and injected pregnant females with tamoxifen (TAM) at E13.5 and E14.5. Analysis of E17.5 Cad5(PAC)-creERT2;Prox1f/f-null embryos (Prox1ΔLEC/ΔLEC) revealed the development of oedema (Fig. 1b, arrow)—a phenotype associated with defective lymphatics and death soon after birth. Notably, these mutant embryos have significantly smaller hearts than control littermates (approximately one-third smaller) (Fig. 1c, j). Most, if not all, cardiac lymphatics were missing (Fig. 1d, g, Extended Data Fig. 1a) and the blood vasculature was not affected in Prox1ΔLEC/ΔLEC embryos (Fig. 1e, f, h, i).

Fig. 1: Lymphatics are required for embryonic heart growth.
figure1

a, Wild-type mouse cardiac lymphatic vasculature development as depicted by anti-LYVE1 whole-mount immunostaining. Yellow arrowheads indicate cardiac lymphatics at E14.5. b, c, Bright-field images of E17.5 control and Prox1ΔLEC/ΔLEC embryos and hearts. White arrow indicates oedema in Prox1ΔLEC/ΔLEC embryos. di, Whole-mount immunostaining shows that E17.5 Prox1ΔLEC/ΔLEC hearts lack LYVE1+ cardiac lymphatics and have normal major coronary arteries and veins, as indicated by α-SMA and endomucin (EMCN) staining. Arrowheads indicate developing lymphatics in control hearts. j, Quantification of organ weight relative to body length (BL) shows reduced heart size (HW, heart weight) and normal liver and kidney sizes (LW, liver weight; KW, kidney weight) in E17.5 Prox1ΔLEC/ΔLEC embryos (n = 13 controls and n = 10 Prox1ΔLEC/ΔLEC embryos; 3 different litters). Data are mean ± s.e.m. ***P = 3.19062 × 10−6 by unpaired two-tailed Student’s t-test. NS, not significant. Control embryos are cre and cre+;Prox1+/+ littermates treated with TAM. n = 3 embryos per genotype (a, di). Scale bars, 500 μm (a, ci), 2 mm (b).

Source Data

Decreased CM mass causes heart size reduction

Haematoxylin and eosin (H&E) staining confirmed that the overall size of the ventricles in Prox1ΔLEC/ΔLEC embryos is smaller; however, cardiac valves appear normal (Fig. 2a, arrows). Immunostaining of heart sections against α-actinin and F-actin show that, overall, cardiac muscle structure and arrangement are not disrupted in Prox1ΔLEC/ΔLEC hearts (Extended Data Fig. 1b). Flow cytometry analysis (FACS) indicated that the percentage of cardiomyocytes (CMs) is significantly reduced (approximately one-third reduction) (Extended Data Fig. 1c), a result suggesting that a decrease in CM mass underlies the reduction in heart size. Hoechst 33342 labelling showed no differences in CM ploidy in Prox1ΔLEC/ΔLEC hearts (Extended Data Fig. 1d). However, an increased percentage of multinucleated CMs was observed in these E17.5 mutant hearts after CM dissociation and overnight plating (Extended Data Fig. 1e, f), but no overall differences in CM size were detected (Extended Data Fig. 1e, g). Similarly, α-laminin staining showed that the overall CM size was not affected in the mutant hearts (Fig. 2b). Next, we evaluated possible alterations in CM proliferation and survival. Indeed, CM proliferation is greatly reduced in E17.5 Prox1ΔLEC/ΔLEC embryos, as indicated by EdU labelling (Fig. 2c, g, Extended Data Fig. 2a–e) and phospho-histone H3 (pH3), Ki67 and aurora kinase B (auroraB) immunostainings (Fig. 2d–g). This reduction in proliferation is seen in different regions of the E17.5 mutant heart (Extended Data Fig. 2f). In addition, CM apoptosis was significantly increased in Prox1ΔLEC/ΔLEC hearts (Fig. 2h). These alterations in CM proliferation and apoptosis were not seen in other cardiac cell types (blood endothelial cells, fibroblasts or macrophages) or other organs (nephron progenitors and hepatocytes) in these mutant embryos (Extended Data Fig. 2g).

Fig. 2: Lymphatics are required for CM proliferation and survival.
figure2

a, H&E staining shows no obvious defects in cardiac valves (arrows) or ventricular wall compaction in E17.5 Prox1ΔLEC/ΔLEC hearts (TAM injected at E13.5 and E14.5). n = 4 embryos per genotype. b, α-Laminin staining shows no differences in PROX1+ CM size between E17.5 controls and Prox1ΔLEC/ΔLEC hearts. Right, quantification of PROX1+ CM size (α-laminin+ area). Average cell size was measured from 5 fields per ventricle, 8–10 PROX1+ CMs per field, 3 embryos per genotype; n = 152 (control) and 155 (Prox1ΔLEC/ΔLEC). cf, Immunostaining with proliferation markers (EdU, pH3, Ki67 and auroraB) together with CM markers (cardiac troponin C (cTnC), PROX1, α-actinin and/or MEF2C). In all images, arrows indicate the double-positive CMs selected for counting. n = 4 embryos per genotype from 3 separate litters. g, Quantification of the immunostaining in cf shows reduced number of EdU+, Ki67+, auroraB+ and pH3+ CMs in E17.5 Prox1ΔLEC/ΔLEC hearts. n = 4 embryos per genotype from 3 separate litters. **P = 0.003 (EdU, Ki67 and auroraB), **P = 0.002 (pH3). h, Active caspase-3 (CASP3) immunostaining shows increased CM apoptosis in PROX1+ CMs in E17.5 Prox1ΔLEC/ΔLEC hearts. Arrows indicate apoptotic CMs. n = 4 embryos per genotype from 3 separate litters. ***P = 0.0003, unpaired two-tailed Student’s t-test. Control embryos are TAM-treated cre and cre+;Prox1+/+ littermates. Data are mean ± s.e.m. Scale bars, 1 mm (a), 25 μm (b, cf, h). Lower magnification images of ce and h are included in Supplementary Fig. 1.

Source Data

To support these findings, we performed similar analysis using another mouse model without lymphatics. Accordingly, we used Vegfr3kd/kd, a naturally occurring mouse strain with a point mutation in the kinase domain of VEGFR3 that affects Vegfr3 (also known as Flt4) signalling and, therefore, lymphatic development11. As seen in Extended Data Fig. 3a, b, E17.5 Vegfr3kd/kd embryos lacking cardiac-associated lymphatics also have smaller hearts. Similar to Prox1ΔLEC/ΔLEC embryos (Fig. 1j), no significant size differences were seen in E17.5 Vegfr3kd/kd livers or kidneys (Extended Data Fig. 3a). Also, similar to Prox1ΔLEC/ΔLEC embryos, CM proliferation was significantly reduced in E17.5 Vegfr3kd/kd hearts (Extended Data Fig. 3c–g), CM apoptosis was significantly increased (Extended Data Fig. 3h), and proliferation in other cardiac cell types or in nephron progenitors and hepatocytes was not affected (Extended Data Fig. 3i). Because E17.5 Prox1ΔLEC/ΔLEC embryos develop oedema, their reduced heart size could be secondary to haemodynamic defects as a consequence of their lack of lymphatics and therefore, of lymphatic flow. However, E17.5 Cad5(PAC)-creERT2;Prox1f/+ embryos (Prox1ΔLEC/+) also exhibited severe oedema and their cardiac lymphatics showed reduced branching, but their heart size and CM proliferation were normal (Extended Data Fig. 4a–e). Similarly, E14.5 Prox1ΔLEC/ΔLEC null embryos (a stage at which cardiac lymphatics will just start to grow into the heart) (Fig. 1a; TAM injection at E10.5 and E11.5) also lacked LECs and exhibited severe oedema, but their heart size and CM proliferation were normal (Extended Data Fig. 4f–h).

To investigate the molecular basis of these lymphatics-dependent defects, we performed RNA sequencing (RNA-seq) analysis of the ventricular portions of E17.5 control and Prox1ΔLEC/ΔLEC hearts. Gene set expression analysis revealed that genes and pathways related to cell cycle were greatly reduced; instead, the expression of genes and pathways involved in apoptosis was enriched (Extended Data Fig. 5a). These results were validated by quantitative PCR (qPCR), which showed that the expression of pro-apoptotic genes was significantly upregulated, but cell-cycle-related genes were significantly downregulated (Extended Data Fig. 5b).

LEC medium promotes CM proliferation

Signalling between blood endothelial cells and CMs is important during cardiac growth and repair12,13. To evaluate whether LECs produce lymphoangiocrine signals that promote CM proliferation and survival, we first cultured CMs derived from human induced pluripotent stem (iPS) cells with LEC-conditioned medium obtained from culturing commercially available human dermal LECs. We then examined AKT (also known as AKT1) and ERK (MAPK1) signalling, as phosphorylated AKT and ERK (p-AKT and p-ERK, respectively) are frequently used as readouts of proliferative signalling. Compared with DMEM-control medium, LEC-conditioned medium significantly increased p-AKT and p-ERK signalling in the cultured human iPS cell-derived CMs (Fig. 3a). Similar results were seen using primary mouse CMs isolated from wild-type E14.5–E17.5 hearts (Fig. 3b). Furthermore, treatment of mouse primary CMs with LEC-conditioned medium significantly increased cell proliferation, as indicated by Ki67 staining (Extended Data Fig. 5c), and protected CM from apoptosis when cultured under CoCl2-induced hypoxic conditions (Extended Data Fig. 5d). Together, these results indicate that LEC-conditioned medium promotes CM proliferation and survival in vitro, and that lymphoangiocrine factor(s) present in that conditioned medium have an important role during heart development in vivo.

Fig. 3: LEC-secreted RELN promotes CM proliferation and survival.
figure3

a, b, Quantitative western blot results show increased p-AKT and p-ERK in human iPS-cell-derived CMs (a) and mouse primary CMs (b) treated with LEC-conditioned medium. *P = 0.012 (p-AKT, a), *P = 0.015 (p-ERK, a), *P = 0.013 (p-AKT and p-ERK, b). n = 4 (a) and n = 3 (b). c, Bright-field images of E17.5 RelnΔLEC/ΔLEC and control embryos and hearts (TAM injected at E13.5 and E14.5). Quantification of organ weight (heart, liver and kidney) relative to body length indicates that hearts are smaller in RelnΔLEC/ΔLEC embryos. n = 22 (controls) and n = 11 (RelnΔLEC/ΔLEC) from 5 litters. *P = 0.016. Controls are TAM-treated cre embryos and cre+;Reln+/+littermates. dg, Double immunostaining using markers of proliferation (EdU, pH3, Ki67 and auroraB) and CM (cTnC, PROX1, α-actinin and/or MEF2C) shows reduced CM proliferation in E17.5 RelnΔLEC/ΔLEC hearts. Arrows indicate proliferating CMs. h, Quantification of the immunostaining in dg shows reduced number of EdU+, Ki67+, auroraB+ and pH3+ CMs in E17.5 RelnΔLEC/ΔLEC hearts. n = 4 embryos per genotype from three separate litters. *P = 0.02 (EdU), *P = 0.01 (Ki67), **P = 0.001 (pH3) and *P = 0.035 (auroraB). i, Active caspase-3 (CASP3) immunostaining shows increased CM apoptosis (arrows) in E17.5 RelnΔLEC/ΔLEC hearts. Right, quantification of the percentage of active CASP3+ CMs in E17.5 control and RelnΔLEC/ΔLEC hearts. n = 4 embryos per genotype from three separate litters. **P = 0.002, unpaired two-tailed Student’s t-test. Control embryos are TAM-treated cre embryos and cre+;Reln+/+ littermates. Data are mean ± s.e.m. Scale bars, 1 mm (c), 25 μm (dg, i). Lower magnification images for df and i are included in Supplementary Fig. 2. For western blot source data, see Supplementary Figs. 6, 7.

Source Data

RELN is required for heart growth

To identify such secreted factor(s), we performed mass spectrometry of the LEC-conditioned medium and identified 317 unique proteins. From that list, we initially focused on all secreted proteins by comparing changes in their expression levels in the RNA-seq dataset described above. Among those candidates, Reln was greatly reduced in Prox1ΔLEC/ΔLEC hearts (log2-transformed fold change of −0.6098 compared to control). qPCR analysis confirmed about an 80% reduction in Reln expression in Prox1ΔLEC/ΔLEC hearts (Extended Data Fig. 6a). We then validated by qPCR the gene expression levels of Reln, as well as of several other enriched proteins identified in the LECs secretome (Extended Data Fig. 6b). Quantification of RELN secretion in three separate LEC preparations by ELISA revealed similar concentrations of this protein in their supernatants (average A450 nm was 0.453 ± 0.065 (mean ± s.d.)) (Extended Data Fig. 6c). RELN is an extracellular matrix protein widely known for its roles during neuronal development and migration, and Reln mutant mice are ataxic14,15. RELN is also expressed in LECs and regulates the maturation of collecting lymphatic vessels16. In agreement with those results16, in the heart RELN is mainly expressed in LECs (Extended Data Fig. 6d), although some cardiac blood vessels also express low levels of RELN (Extended Data Fig. 6e). Accordingly, the observed qPCR reduction in Reln expression in Prox1ΔLEC/ΔLEC hearts is a consequence of their lack of lymphatics. RELN was almost undetected in E17.5 Prox1ΔLEC/ΔLEC hearts (Extended Data Fig. 6f).

Notably, the heart size of E17.5 Reln−/− embryos17 was also significantly reduced, but cardiac lymphatics appeared normal (Extended Data Fig. 6g–i). To further demonstrate that the smaller heart phenotype was a consequence of Reln loss in LECs, we deleted RELN from LECs (RelnΔLEC/ΔLEC) by crossing Reln floxed mice18 with Prox1-creERT2 mice19 (TAM injections at E13.5 and E14.5). Immunostaining confirmed efficient deletion of RELN in cardiac lymphatics at E17.5 (Extended Data Fig. 7a). Notably, E17.5 RelnΔLEC/ΔLEC embryos also developed smaller hearts (although no significant differences were seen in the size of other organs such as kidneys and livers) (Fig. 3c). In addition, CM proliferation was also reduced in RelnΔLEC/ΔLEC embryos as indicated by EdU, pH3, Ki67 and auroraB labelling (Fig. 3d–h), and CM apoptosis was increased as indicated by active caspase-3 staining (Fig. 3i). No changes in proliferation and apoptosis were detected in other cardiac cell types or in kidney and liver (Extended Data Fig. 7b). These results agree with those seen in Reln−/− embryos, indicating that LEC-derived RELN has a crucial role during heart development and growth by regulating CM proliferation and apoptosis. To validate this finding, we collected LEC-conditioned medium from LECs treated with Reln short interfering RNA (siRNA) and control siRNA. Analysis by qPCR showed that Reln expression is efficiently silenced in LECs treated with Reln siRNA (Extended Data Fig. 8a). Western analysis showed that the identified increase in p-AKT and p-ERK signalling induced by the LEC-conditioned medium was greatly reduced when using the Reln-deficient LEC-conditioned medium (Extended Data Fig. 8b).

RELN signalling requires integrin-β1

Previous studies about the role of RELN during neuronal development, neuronal migration and in tumour cells identified VLDLR20,21, ApoER220,21 and integrin-β122,23 as RELN receptors. After binding to those receptors, RELN stimulates intracellular signalling transduction through the phosphorylation of the intracellular protein DAB1 and the activation of the PI3K–AKT–GSK3β24 and mTOR25 signalling cascades. Integrin-β1 (encoded by Itgb1) has been shown to have important roles in heart development, as its deletion in embryonic CMs results in smaller hearts with reduced CM proliferation26. Therefore, we investigated whether LEC-derived RELN regulates CM proliferation and survival by regulating Itgb1 signalling. Western analysis confirmed that CMs treated with LEC-conditioned medium increased the activity of integrin-β1 and RELN downstream signals such as FAK, DAB1, AKT and ERK; by contrast, LEC-conditioned medium from Reln-deficient LECs was unable to induce Itgb1 signalling activity (Extended Data Fig. 8b). More importantly, blocking Itgb1 signalling in CMs by adding integrin-β1 blocking antibodies to the LEC-conditioned medium partially abolished the pro-survival effects of the intact LEC-conditioned medium (Extended Data Fig. 8b). Furthermore, LEC-conditioned medium from Reln-deficient LECs or medium containing integrin-β1-blocking antibodies also failed to promote CM proliferation or protect against CM apoptosis (Extended Data Fig. 8c, d). These data further support our proposal that LEC-secreted RELN regulates CM proliferation and survival mainly by activating the Itgb1 signalling pathway. Furthermore, we also observed an increase in Reln or Itgb1 signalling activity in mouse primary CMs after RELN stimulation (addition of supernatant from Reln-transfected 293T cells), and this signalling was greatly inhibited by the addition of integrin-β1-blocking antibodies (Extended Data Fig. 8e). Moreover, E17.5 Itgb1fl/+,Myh6-cre;Reln+/− (β1ΔCM/+;Reln+/−) double heterozygous embryos generated by crossing Itgb1fl/+,Myh6-cre (β1ΔCM/+) with Reln+/− mice, also developed smaller hearts without significant size differences in livers or kidneys (Extended Data Fig. 8f). Reln+/− and β1ΔCM/+ littermates exhibited no differences in heart size compared to wild-type mice (Extended Data Fig. 8f), and embryo size and cardiac lymphatics appear normal in all three genotypes resulting from those crosses (Extended Data Fig. 8g). Consistently, CM proliferation was also significantly reduced and apoptosis was increased in E17.5 β1ΔCM/+;Reln+/− embryos (Extended Data Fig. 9a, b). No changes in proliferation and apoptosis were detected in other cardiac cell types or in kidney and liver (Extended Data Fig. 9c). Together, these data support our proposal that LEC-secreted RELN regulates CM proliferation and survival through the Itgb1 signalling pathway.

Neonatal heart repair requires RELN

At E17.5, RELN is highly expressed in cardiac lymphatics nearby the epicardium, as well as in the base of the myocardium; however, its expression levels get steadily reduced from postnatal day (P) 2 to P14, such that at P14 it is barely detected (Extended Data Fig. 10a). This reduction in the levels of RELN is accompanied by a similar change in the levels of Reln mRNA (Extended Data Fig. 10b), suggesting that Reln expression levels are temporally regulated in cardiac lymphatics.

Because this reduction in RELN expression coincides with the loss of cardiac regenerative potential in mice27, we first examined the role of Reln in wild-type mouse neonatal cardiac regeneration. We performed neonatal myocardial infarction at P2 and the analysis of P7 pups showed LYVE1-expressing lymphatics in both the infarcted and the nearby non-infarcted cardiac tissue. RELN expression was re-activated in the infarcted hearts, with higher levels in the infarcted area and lower levels in the non-infarcted tissue (Extended Data Fig. 10c). A similar analysis in P7 Reln-null pups showed that similar to wild-type controls, LYVE1-expressing lymphatics were present in the infarcted and non-infarcted tissues, although in both cases RELN expression was not detected (Extended Data Fig. 10c). Compared with wild-type controls, although cardiac function was not affected in Reln−/− hearts at P7, it was reduced at P14 and P21, as determined by echocardiography (Fig. 4a). In line with this reduced cardiac function, Masson’s trichrome staining showed increased fibrosis in P21 Reln−/− hearts (Fig. 4b). Immunostaining revealed that neither lymphatic density nor LEC proliferation was affected in P21 Reln−/− hearts after injury (Extended Data Fig. 10d, e). Similar to the results observed in E17.5 Reln-null embryos, CM proliferation was reduced and CM apoptosis was increased in the infarcted area of P7 Reln−/− hearts (Fig. 4c, d, Extended Data Fig. 11a–e). Notably, no alterations in cardiac function or increased fibrosis were seen in Reln+/− mice (Fig. 4a, b). Immunostaining revealed that neither lymphatic density nor LEC proliferation was affected in Reln−/− hearts after injury (Extended Data Fig. 10d, e). These results demonstrate that re-expression of RELN in cardiac-associated lymphatics of the injured neonatal heart improves cardiac regeneration and function after myocardial infarction.

Fig. 4: RELN improves neonatal and adult cardiac function after myocardial infarction.
figure4

a, Echocardiography reveals relatively normal cardiac function at P7 and reduced at P14 and P21 in Reln−/− mice after myocardial infarction at P2. EF, ejection fraction. P7: n = 9 (WT), n = 9 (Reln+/−), n = 10 (Reln−/−); P14: n = 10 (WT), n = 8 (Reln+/−), n = 7 (Reln−/−); P21: n = 9 (WT), n = 13 (Reln+/−), n = 8 (Reln−/−). *P = 0.04 (P14) and *P = 0.012 (P21) by two-way analysis of variance (ANOVA) followed by Bonferroni test. b, Masson’s trichrome staining shows increased fibrosis in P21 Reln−/− hearts (myocardial infarction at P2). Right, quantification of the percentage of fibrotic area. n = 6 (WT), n = 4 (Reln+/−), n = 5 (Reln−/−). **P = 0.002, one-way ANOVA followed by Tukey’s test. c, CM proliferation is decreased in the border of the infarcted area of P7 Reln−/− hearts (n = 4 mice per genotype). *P = 0.026 (EdU), *P = 0.025 (Ki67), *P = 0.022 (pH3), *P = 0.023 (auroraB), unpaired two-tailed Student’s t-test. d, CM apoptosis increases significantly in the infarcted area of P7 Reln−/− hearts (n = 4 mice per genotype). *P = 0.032, unpaired two-tailed Student’s t-test. e, Sutured collagen patch onto the adult mouse heart after myocardial infarction. f, Residual collagen patch remains up to 42 days after myocardial infarction. g, Echocardiography reveals significantly improved cardiac function (percentage of ejection fraction) in adult mice with RELN patches starting at around 21 days after myocardial infarction and up to 42 days after myocardial infarction. n = 6 (sham), n = 6 (control patch) and n = 7 (RELN patch). *P = 0.04 (P21), **P = 0.001 (P35), *P = 0.01 (P42), two-way ANOVA followed by Bonferroni test. h, Masson’s trichrome staining shows reduced cardiac fibrotic area in RELN patch-treated mice 42 days after myocardial infarction. Arrowhead shows fibrotic area; arrows indicate residual collagen patch. Right, quantification of the percentage of fibrotic area. n = 4 (sham), n = 4 (control patch), n = 6 (RELN patch). **P = 0.003 by one-way ANOVA followed by Tukey’s test. i, No differences in CM proliferation between mouse hearts treated with control patch or RELN patch were observed in the infarcted areas 7 days after myocardial infarction (n = 4 hearts per group). P values determined by unpaired two-tailed Student’s t-test. j, CM apoptosis is reduced in the infarcted area of RELN patch-treated hearts (n = 4 mice per group). *P = 0.039, unpaired two-tailed Student’s t-test. Data are mean ± s.e.m. Scale bars, 500 μm (b, h). Representative images of c, d, i and j are in Extended Data Fig. 11. Functional parameters for the neonatal and adult myocardial infarction echocardiography are in Source Data.

Source Data

RELN improves adult myocardial infarction recovery

We next assessed whether delivery of RELN directly into the heart could improve cardiac repair in adult wild-type mice after myocardial infarction. We took advantage of well-established bioengineered collagen patches28,29 as a scaffold to deliver recombinant RELN protein into the heart. RELN-containing patches and control patches were surgically sutured onto approximately two-month-old injured hearts immediately after acute myocardial infarction (Fig. 4e, f). Cardiac function was evaluated weekly (1–6 weeks after myocardial infarction), and 21 days after myocardial infarction, the ejection fraction was significantly improved in mice with RELN patches (Fig. 4g). Consistent with this improved heart function, 42 days after myocardial infarction the size of the fibrotic scar in the infarcted area was notably reduced in RELN-patched mice (Fig. 4h). To evaluate whether this improved cardiac function and reduced fibrotic tissue was a consequence of increased CM proliferation and/or reduced CM cell death, we performed immunostaining 7 days after myocardial infarction—a stage at which increased CM proliferation is normally detected after injury. No differences in CM proliferation were observed in the infarcted area between mice with control or RELN patches, as indicated by EdU labelling and Ki67 or pH3 immunostaining (Fig. 4i, Extended Data Fig. 11f). Notably, CM apoptosis was greatly reduced in the infarcted area of RELN-patched mice (Fig. 4j, Extended Data Fig. 11g). These data indicate that after adult cardiac injury, RELN protects CMs from apoptosis, which correlates with a reduced scar and improved heart function.

Discussion

Using mouse embryos that lack LECs or LEC-produced RELN, we demonstrate that their hearts are smaller as a consequence of increased CM apoptosis and reduced CM proliferation. We showed that the percentage of CMs is significantly reduced in E17.5 Prox1ΔLEC/ΔLEC and RelnΔLEC/ΔLEC hearts, suggesting that communication between LECs and CMs is required for CM survival during cardiac development. We also found that LEC-conditioned medium increases CM survival and prevents CM apoptosis as a consequence of hypoxia; a result suggesting potent LEC lymphoangiocrine cardioprotective effects. We identified RELN as a factor performing such functional role, probably via the Itgb1 signalling pathway, both in vivo and in vitro. Finally, we provide additional insight into the proposed beneficial roles of lymphatics on cardiac repair by showing that it is at least partially mediated by RELN activity. We demonstrate the relevance of RELN in endogenous cardiac regenerative ability by showing that after myocardial infarction at P2, RELN expression in LECs is particularly reactivated in the myocardial infarction area of wild-type mice, and that Reln−/− mice do not fully regenerate. We found that RELN is required for CM proliferative activity at P7, although proliferation was not completely abolished in Reln−/− pups, indicating that other factors contribute to CM proliferation. Cardiomyocytes apoptosis was also increased in Reln−/− mice during an extended period after myocardial infarction (up to P21), which suggests that in addition to the reduced proliferation, loss of CM protection underlies the inability of Reln−/− postnatal hearts to fully regenerate.

We also demonstrate that exogenously applied RELN is useful for cardiac repair after myocardial infarction in adult mice. During cardiac growth and in neonatal cardiac regeneration, RELN promotes both CM proliferation and survival; however, the beneficial activity of RELN on cardiac function in adult mice seems to be mostly as a result of reduced CM cell death and a smaller scarred myocardial area, which are both features indicative of a cardioprotective effect.

Our results suggest that RELN regulation of integrin-mediated signalling is specifically crucial for CM proliferation and survival, but it is likely that alternative signals or receptors mask similar effects on other cardiac cell types such as fibroblasts and blood endothelial cells. Furthermore, it is also likely that RELN and/or other lymphoangiocrines have similar homeostatic roles in other organs.

In summary, our study highlights the importance of LECs and RELN during heart growth and repair, and provides some ideas about possible paths to improve cardiac regeneration and cardioprotection in mammals. Our results suggest that the use of RELN could be a valuable therapeutic approach to improve cardiac function in humans.

Methods

Mouse models

LEC-specific Prox1-deficient mice were generated by crossing Prox1f/f mice7 with Cad5(PAC)-creERT2 mice10. These mice are maintained in a mixed C57B6 and NMRI background. LEC-specific Reln-deficient mice were generated by crossing Relnf/f mice18 with Prox1-creERT2 mice19. These mice are in a mixed 129, FVB and C57B6 background. Reln+/− mice were provided by B. Brunne and are originally from the Jackson Laboratory and are maintained in a mixed BALB/C and C57B6 background. For induction of cre-mediated recombination in Prox1ΔLEC/ΔLEC and RelnΔLEC/ΔLEC embryos, two consecutive intraperitoneal TAM injections of 5 mg per 40 g were administered to pregnant dams. Itgb1f/f mice and Myh6-cre mice were obtained from the Jackson laboratory and are in a mixed C57B6 and NMRI background. These strains were bred to generate Myh6-cre;Itgb1f/+ mice that were crossed with Reln+/− mice to obtain Myh6-cre; Itgb1f/+;Reln+/− (β1ΔCM/+;Reln+/−) embryos. Heterozygous mice carrying the kinase-dead Flt4Chy allele (Vegfr3kd) (MRC Harwell) were previously described30 and are maintained in the NMRI background. Mice of both sexes from 12 weeks to 6 months old were used for breeding and experiments. Mice were not randomized into experimental groups, but were age- and sex-matched and littermates were used whenever possible. All the myocardial infarction surgeries and the echocardiography analyses were performed blinded. Experiments with embryos were not blinded as the mutant embryos showed very obvious phenotypes (such as oedema). All other experiments were not blinded as they required grouping by genotypes (flow cytometry) or were treated with different reagents (siRNA knockdown).

All animal husbandry was performed in accordance with protocols approved by Northwestern University and UT Southwestern Medical Center Institutional Animal Care and Use Committee, as well as Animal Experimentation Review Board of the Semmelweis University. Animal facilities are equipped with a 14 h:10 h or 12 h:12 h light cycle. Temperatures are maintained between 18 and 23 °C with 40–60% humidity.

Mouse embryonic CM isolation

CMs were isolated from E14.5–17.5 mouse embryos using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher). In brief, ventricles were isolated from embryonic hearts and minced and washed with cold HBSS and further digested according to the manufacture instructions. To examine the relative CM cell size, dissociated cells were cultured in DMEM containing 10% FBS overnight and then cells were fixed in 4% paraformaldehyde (PFA) for immunostaining. For any other experiments, primary cells were cultured in DMEM containing 10% FBS and cardiomyocyte growth supplements for 3–4 days before experiments.

Human iPS cell-derived CMs

Cardiac differentiation was performed using the CDM3 (chemically defined medium, three components) system as described with slight modifications31,32. Human iPS cells are split at 1:15 ratios and grown in B8 medium for 4 days reaching approximately 80% confluence. On day 0, B8 medium is changed to CDM331, consisting of RPMI 1640 (Corning, 10-040-CM), 500 μg ml−1 fatty acid-free bovine serum albumin (GenDEPOT), and 200 μg ml−1 l-ascorbic acid 2-phosphate (Wako), supplemented with 6 μM of CHIR99021 (LC Labs, C-6556). After 24 h (day 1), medium was changed to CDM3. On day 2, medium was changed to CDM3 supplemented with 2 μM of Wnt-C59 (Biorbyt, orb181132). Medium was then changed every other day for CDM3 starting on day 4. Contracting cells are noted from day 7. On day 16 of differentiation, CMs were dissociated using DPBS for 20 min at 37 °C followed by 1:200 Liberase TH (Roche) diluted in DPBS for 20 min at 37 °C, centrifuged at 300g for 5 min, and filtered through a 100-μm cell strainer (Falcon). The purity of the differentiated cells was determined by expression of CM cell marker TNNT2 using flow cytometry. Only cell lines that show over 85% were TNNT2+ were used for experiments.

LEC-conditioned medium

Human dermal LECs were purchased from Lonza and cultured with endothelial basal medium (EBM) complemented with supplement mix (Lonza). Authentication of the human dermal LECs was performed by immunostaining with a PROX1 antibody. Cells were negative for mycoplasma contamination. Passages 4 or 5 were cultured in 10-cm dishes until confluent, washed with cold PBS three times and then 8 ml of serum-free DMEM (without phenol red) with penicillin/streptomycin was added. Cells were then cultured overnight before collecting the conditioned medium that was filtered through a 0.22-μm pore membrane (Millipore). Control conditioned medium (DMEM) was prepared in the same way but without LECs.

siRNA knockdown

Human LECs were transfected as previously described33. In brief, P4 human LECs were transfected with scrambled or Reln siRNA (Santa Cruz) with Lipofectamine 2000 (Invitrogen), according to the manufacture’s instruction. After 48 h, cells were washed and replaced with DMEM and further cultured overnight to collect the conditioned medium. LECs were collected and qPCR was performed to check transfection efficiency.

LEC-conditioned medium treatment

To examine the effects of the LEC-conditioned media, mouse primary CM or human iPS cell-derived CMs were cultured in 12-well plates (about 80% confluence), and cells were treated with DMEM, conditioned medium, conditioned medium from scrambled siRNA-treated LECs (siCtrl-conditioned), conditioned medium from siReln-treated LECs (siReln-conditioned) or conditioned medium with integrin-β1 blocking antibodies (10 μg ml−1, BD Biosciences) o/n. Cells were either fixed in 4% PFA for immunofluorescent staining, or lysed in RIPA buffer for western blot analysis.

RELN-conditioned medium and treatment

HEK-293T cells (ATCC) were cultured in DMEM with 10% fetal bovine serum and transfected with the Reln cDNA construct pCrl, provided by G. D’Arcangelo, using Lipofectamine 2000 (Invitrogen). Control cells were mock-transfected in the same way without adding the vector. Twenty-four hours after transfection, the medium was changed to serum-free DMEM, and RELN-conditioned medium and mock conditioned medium (control) was collected two days after the medium change. The conditioned medium was filtered through a 0.22-μm pore membrane. To examine the effects of the RELN-conditioned medium, mouse primary CMs were starved overnight with DMEM and stimulated for 30 min with RELN-conditioned medium (supernatant from transfected cells) or control medium (supernatant from mock-transfected cells). To examine the RELN/integrin-β1 pathway, primary CMs were treated in the presence or absence of integrin-β1-blocking antibodies (10 μg ml−1, BD Biosciences) for 3 h before RELN-conditioned medium treatment. The HEK-293T cell line was not authenticated but tested negative for mycoplasma contamination.

Western blot analysis

To examine signalling changes in primary CMs or iPS cell-derived CMs, cells were lysed in RIPA buffer and subject to western blot analysis. The following primary antibodies were used: p-AKT (rabbit, Cell Signaling, 4060, 1:500), p-ERK (rabbit, Cell Signaling, 4370, 1:1,000), total AKT (rabbit, Cell Signaling, 4691, 1:500), total ERK (rabbit, Cell Signaling, 4695, 1:500), p-DAB1 (rabbit, Cell Signaling, 3327S, 1:100), p-FAK (rabbit, Cell Signaling, 3284, 1:200), integrin-β1 (mouse, BD, 610467, 1:100), GAPDH (rabbit, Santa Cruz, sc32233, 1:5,000). Blots were imaged using a ChemiDock imaging system (Bio-Rad) and bands were acquired using Quantity One 1-D software. Quantification of western blot was analysed using ImageJ 1.51. Included images are representative blots. All raw data used for the quantifications are included in the Supplementary Information.

Mass spectrometry analysis of LEC-conditioned medium

LEC-conditioned medium (50 ml) was collected from five 10-cm dishes of cultured LECs and filtered through a 0.22-μm pore membrane as mentioned above. LEC-conditioned medium was further concentrated into 500 μl using the Protein-Concentrate Kit (Millipore) according to the manufacturer’s instruction. Protein concentration was then measured by the BCA protein assay (Thermo Fisher). Experiments were repeated three times and three biological samples were submitted to Northwestern Proteomics Core for untargeted quantitative proteomics analyses by Label-free Quantitative Proteomics. In brief, samples were analysed using an UltiMate 3000 RSLCnano system (ThemoFisher Scientific) that is coupled with electrospray ionization (ESI) to a linear ion trap (LTQ) Orbitrap mass spectrometer (iLTQ-Orbitrap, ThermoFisher). The resulting raw mass spectra from all three replicates were analysed by the MaxQuant search engine (version 1.6.0.16) using UniprotKB human database with the allowance of up to two missed cleavages and precursor mass tolerance of 20 ppm. The secretome was acquired using software Scaffold 4 and annotated using Gene Ontology (GO), which assigns putative cellular compartmentalization, biological process and molecular functions.

ELISA

To validate the presence of RELN in the LEC-conditioned medium, three different batches of commercial LECs were cultured and their conditioned medium was collected as described. Sandwich ELISA was performed to examine the relative levels of RELN in the three different batches of LEC-conditioned medium. In brief, conditioned medium was pre-coated to Nunc MaxiSorp Flat-Bottom 96-well plates (Invitrogen) o/n and blocked with 5% milk in TBS-T. Plates were then incubated with RELN primary antibody (R&D, AF3820, 1:100) and followed by incubation with HRP-conjugated donkey anti-goat antibody (Jackson ImmunoResearch, 705-035-003, 1:1,000). Subsequently, plates were washed and the substrate solution (3,3,5,5-tetramethylbenzidine liquid substrate system for ELISA, Abcam) was added. The reaction was stopped by adding 2 N H2SO4, and plates were measured at 450 nm using the Opsys Mr microplate reader (Dynex Technologies). Relative RELN levels in different batches of conditioned medium were quantified by absorbance at 450 nm (A450 nm).

FACS analyses and sorting

For analysis of percentages of CMs in the heart, whole E17.5 ventricles were dissociated from control and Prox1ΔLEC/ΔLEC hearts using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher). Cells were fixed and permeabilized using a permeabilization kit for intracellular staining (eBioscience) following manufacturer’s instruction. Cells were then incubated with Cy3-conjugated mouse anti-cTnC antibody (Abcam, ab45931, 1:100) and Hoechst 33342 (Invitrogen, 1:1,000) at room temperature for 1 h. Cells were washed and percentage of cTnC+ CMs was determined after 20,000 total cell counts by flow cytometry. Percentage of polyploidy CMs was determined by Hoechst 33342 intensity. Flow data were collected using the flow software BD FACS Diva 8.0.3 and analysed by FlowJo v.10.

For analysis of the purity of differentiated human iPS cell-derived CMs, dissociated CMs were fixed with 4% PFA and permeabilized using 0.5% saponin. Cells were then incubated with 647-conjugated mouse anti-cardiac TNNT2 antibody (BD Biosciences, clone 13-11, 1:200) for 1 h. Cells were washed and the percentage of TNNT2+ CMs was determined after 10,000 total cell counts by flow cytometry.

Neonate myocardial infarction

Neonatal myocardial infarction was performed in P2 pups. In brief, P2 pups were anaesthetized under isoflurane anaesthesia (1–2%). Once pups did not respond to toe pinch, they were moved to a cold platform to undergo hypothermia anaesthesia. Each neonate undergoes acute myocardial infarction by ligation of the left anterior descending coronary artery. Thoracic wall incisions were sutured and the wound closed using skin adhesive. Pups were warmed on a warm pad. After confirmation of spontaneous movement pups received a dose of subcutaneous buprenorphine (0.05 mg kg−1). Once neonate recovered from hypothermia, they were moved back to its fostering mother’s cage.

Compressed collagen patches

Compressed acellular collagen patches were prepared as previously described. In brief, control collagen patches were prepared by adding 1.1 ml DMEM to 0.9 ml of sterile rat tail type I collagen solution in acetic acid (3.84 mg ml−1, Millipore) and neutralized with 0.1 M NaOH (50 μl). RELN collagen patches were prepared by adding 20 μg of recombinant human RELN protein (R&D) into the collagen mix. Then, 0.9 ml of the collagen solution was added into one well of 24-well plates and placed into a tissue culture incubator for 30 min at 37 °C for polymerization. Polymerized collagen gel was then compressed by application of a static compressive stress of approximately 1,400 Pa for 5 min as described28. Each collagen patch was then trimmed to three even pieces for application in vivo.

Myocardial infarction and insertion of collagen patches in adult mice

Nine-to-eleven-week-old NMRI female mice were anaesthetized using an isoflurane inhalational chamber, endotracheally intubated using a 22-gauge angiocatheter and connected to a small animal volume-control ventilator (NEMI Scientific). All mice underwent acute myocardial infarction by ligation of the left anterior descending coronary artery and ligation was considered successful when the left ventricle wall turned pale. Immediately after ligation, prepared collagen patches (with and without RELN) were sutured (at two points) onto the surface of the ischaemic myocardium (Fig. 4e). The patch size used was approximately one-third of the 15.6 mm-diameter collagen gel. Mice were kept on a heating pad until they recovered. After confirmation of spontaneous movement, mice received a dose of subcutaneous buprenorphine (0.05 mg kg−1) and then every 8–12 h for 48 h post-surgery. 

Echocardiography

Two-dimensional echocardiograms were measured on a 55 MHz probe using Vevo 3100 micro-ultrasound imaging system (VisualSonics), short axis views of the left ventricles were taken at the level of papillary muscles and used to calculate end-diastolic and -systolic dimensions using Vevo LAB 3.2.6 software (VisualSonics). All echocardiography measurements were performed in a blinded manner.

Histology, immunohistochemistry and immunofluorescent staining

For H&E staining, samples were embedded in paraffin and sectioned longitudinally at 6 μm thickness and staining was performed according to standard protocols.

For whole mount heart staining, isolated hearts were fixed in 4% PFA overnight and blocked. Antibodies were used as followed: LYVE1 (goat, R&D, AF2125, 1:200), EMCN (rat, Invitrogen, 14-5851-82, 1:500), RELN (Goat, R&D, AF3820, 1:50), PROX1 (Goat, R&D, AF2727, 1:100) and Cy3-conjugated α-SMA (mouse, Sigma, C6198, 1:300). Cy3-conjugated donkey anti-goat (Jackson ImmunoResearch, 705-165-147, 1:300) and Cy5-conjugated donkey anti-rat (Jackson ImmunoResearch, 712-175-150, 1:300) were used for immunofluorescent staining.

For cryosections, embryos or isolated hearts were fixed in 4% PFA overnight and dehydrated in 30% sucrose. Samples were embedded in OCT compound and frontal sectioned at 10-μm thickness to show four chambers. Primary antibodies were used as follows: α-actinin (Mouse, Sigma, A7811, 1:500), cTnC (mouse, Abcam, ab8295, 1:1,000), Ki67 (rabbit, Invitrogen, SP6, MA5-14520, 1:200), active CASP3+ (rabbit, BD Pharmingen, C92- 605, 559565, 1:200), LYVE1 (goat, R&D, AF2125, 1:200), RELN (goat, R&D, AF3820, 1:50), LYVE1 (rabbit, AngioBio, 11-034, 1:500), PROX1 (rabbit, AngioBio, 11002, 1:500), PROX1 (goat, R&D, AF2727, 1:100) and MEF2C (rabbit, LSBio, LSC356188, 1:1,000). Secondary antibodies were used as follows: Alexa 488-conjugated donkey anti-rabbit (Invitrogen, A21206, 1:300); Alexa 488-conjugated donkey anti-goat (Invitrogen, A11055, 1:300); Cy3-conjugated donkey anti-rabbit (Jackson ImmunoResearch, 711-165-152, 1:300); Alexa 488-conjugated donkey anti-mouse (Invitrogen, A21202, 1:300); Cy3-conjugated donkey anti-goat (Jackson ImmunoResearch, 705-165-147, 1:300) and Cy5-conjugated donkey anti-goat (Jackson ImmunoResearch, 705-495-147, 1:300).

For cell staining, cells were fixed in 4% PFA for 30 min on ice, blocked and incubated with primary antibody against α-actinin (Mouse, Sigma, A7811, 1:500), cTnC (Mouse, Abcam, ab8295, 1:1,000), Ki67 (Rabbit, Invitrogen, SP6, MA5-14520, 1:200), PROX1 (goat, R&D, AF2727, 1:100) and active CASP3+ (rabbit, BD Pharmingen, C92- 605, 559565, 1:200). Secondary antibodies were used as follows: Alexa 488-conjugated donkey anti-mouse (Invitrogen, A21202, 1:300) and Cy3-conjugated donkey anti-rabbit (Jackson ImmunoResearch, 711-165-152, 1:300). At least three heart samples per genotype were used for whole-mount staining and three sections per heart per staining for immunohistochemistry and immunofluorescent staining, respectively. Cell staining was repeated at least three times.

For Masson’s Trichrome staining, mouse hearts were obtained and fixed in 4% PFA and embedded. Paraffin sections were cut from apex to base into serial sections at 0.8-μm thickness. Masson’s trichrome staining was performed according to standard procedures (Sigma) and used for detection of fibrosis. Scar size was quantified using NIH ImageJ 1.51 software and the percentage of the fibrosis area was calculated relative to left ventricle area.

EdU administration

To examine the EdU incorporation in Prox1ΔLEC/ΔLEC, Vegfr3kd/kd, β1ΔCM/+;Reln+/− or Prox1ΔLEC/ΔLEC strains, 5-ethynyl-2′-deoxyuridine (EdU, 3 mg per mouse) was administrated into pregnant females by intraperitoneal injections. Two hours after injections, mice were euthanized and hearts, livers and kidneys were  collected and cryosectioned as described above. To examine EdU incorporation in control or RELN patches sutured mice after myocardial infarction, EdU (3 mg per mouse) was injected intraperitoneally for 3 days starting 4 days after myocardial infarction. Hearts were collected at day 7 and subjected to EdU immunohistochemistry using Click-iT EdU Alexa Fluor 488 Imaging Kit (Life Technologies) according to the manufacturer’s instruction.

qRT–PCR

Total RNAs was extracted using RNeasy Mini Kit (Qiagen). cDNA was generated (Clontech Laboratories) and 20 ng used for qRT–PCR using Power SYBR Green PCR Master Mix (Life Technologies) on a StepOnePlus Real-Time PCR system (Applied Biosystems). At least three individual samples per group were performed for each run of qPCR. Primer sequences used in this study are listed below.

For mouse qPCR: Bcl2l11: GAGATACGGATTGCACAGGA, ATTTGAGGGTGGTCTTCAGC; P21 GAAAGAAGCGGAAGATCCTCC, GGGCCTCAGGGATTGTTTGG; Pdcd4 GAAATTGGATTTCCGCATCT, TAACCGCTTCACTTCCATT; Stat1: AGGGGCCATCACATTCACAT, AGATACTTCAGGGGATTCTC; Trp53inp1: TCCTCAGCAGAGCACACTTC, TCCATTGGACAGGACTCAAA; Cdc6: AGGGTGACTTTGAGCCAAGA, ATGAAGATTCTGGGGGCTCT; E2f1: TGCAGAAACGGCGCATCTAT, CCGCTTACCAATCCCCACC; Pcna: TTGCACGTATATGCCGAGACC, GGTGAACAGGCTCA TTCA TCTCT; Mcm5: GGAGGCTATTGTGCGCATTG, CTGGTCCTCCTGGGTAGTGA; Ccne2: TCTGTGCATTCTAGCCATCG, ACAAAAGGCACCATCCAGTC; Reln: GGACTAAGAATGCTTATTTCC, GGAAGTAGAATTCATCCATCAG; Rlp32: GCCTCTGGTGAAGCCCAAG, TTGTTGCTCCCATAACCGATGT.

For human qPCR: RELN: CAATCTGAATGGCGAAACC, CTTTCGCTATAAATCGGAGAGAGA; GAPDH: TGACCACAGTCCATGCCATC, GACGGACACATTGGGGGTAG; MMRN1: TTGGATTGGAGGTGCTGTC, GCCTGGTTGGTGTGTATCA; THBS1: CACCAACCGCATTCCAGAG, TCAGGGATGCCAGAAGGAG; HSPG2: CTCCATCGTCATCTCCGTCT, GTCTGCCCTTCTGCCACTC; FN1: CCATCGCAAACCGCTGCCAT; AACACTTCTCAGCTATGGGCT T; FSTL1: CGATGGACACTGCAAAGAGA, CCAGCCATCTGGAATGATCT; LAMA4: GCGGCCGAGAAATGCA, AGTCGCAGGGCACACATTC; SERPINE1: ACAAGTTCAACTATACTGAGTTCACCACGCCC, TGAAACTGTCTGAACATGTCGGTCATTCCC.

All sequences are included forward and reversed and are annotated from 5′ to 3′.

RNA-seq

Total RNA was extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Extracted total RNAs were quantitated by NanoDrop and RNA integrity number value measured with an Agilent Bioanalyzer. In all RNA-seq samples, quality control was performed using the 2100 Bioanalyzer (Agilent). RNA library was prepared using the TruSeq mRNA-Seq Library Prep and sequenced using the HiSEQ Next-generation Sequencing System at the NUSeq Core.

Imaging acquisition and quantification

Confocal images in Fig. 1a, d–i, Extended Data Figs. 1a, 3b, 4b, 6i and 8g were acquired using a Nikon W1 Dual CAM Spinning Disk confocal microscope. All other confocal images were acquired using Zeiss LSM510 laser-scanning confocal microscope. All confocal images represent maximum projection images of z-stacks. For quantifications of CM proliferation and apoptosis, images were taken from three myocardium regions of frontal heart sections: myocardium nearby left ventricle, myocardium nearby right ventricle and septum. At least nine images were taken from each heart (at least three images per region) and at least three hearts from each genotype were quantified. Bright-field images were taken using a Leica stereomicroscope. Embryo body length was measured from head to tail (crown–rump) using Image J 1.51 with all the images under the same magnification. CM cell size, as well as fibrosis area were also measured by Image J 1.51 software with all the images under the same magnification.

Statistical analysis

No statistical analysis was used to predetermine sample size. Statistical analysis was performed using GraphPad Prism 7 and Microsoft Excel 2016. Differences between two groups were determined by two-tailed unpaired t-test, and differences between multiple groups were calculated using one-way ANOVA or two-way ANOVA. *P < 0.05 **P < 0.01 and ***P < 0.001 were considered statistically significant.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this paper.

Data availability

All data from the manuscript are available from the corresponding author on request. RNA-seq raw data have been deposited to the Gene Expression Omnibus (GEO) repository with accession number GSE158504Source data are provided with this paper.

References

  1. 1.

    Oliver, G., Kipnis, J., Randolph, G. J. & Harvey, N. L. The lymphatic vasculature in the 21st century: novel functional roles in homeostasis and disease. Cell 182, 270–296 (2020).

    CAS  Article  Google Scholar 

  2. 2.

    Klotz, L. et al. Cardiac lymphatics are heterogeneous in origin and respond to injury. Nature 522, 62–67 (2015).

    ADS  CAS  Article  Google Scholar 

  3. 3.

    Vuorio, T., Tirronen, A. & Ylä-Herttuala, S. Cardiac lymphatics - a new avenue for therapeutics? Trends Endocrinol. Metab. 28, 285–296 (2017).

    CAS  Article  Google Scholar 

  4. 4.

    Henri, O. et al. Selective stimulation of cardiac lymphangiogenesis reduces myocardial edema and fibrosis leading to improved cardiac function following myocardial infarction. Circulation 133, 1484–1497 (2016).

    CAS  Article  Google Scholar 

  5. 5.

    Vieira, J. M. et al. The cardiac lymphatic system stimulates resolution of inflammation following myocardial infarction. J. Clin. Invest. 128, 3402–3412 (2018).

    Article  Google Scholar 

  6. 6.

    Harrison, M. R. et al. Late developing cardiac lymphatic vasculature supports adult zebrafish heart function and regeneration. eLife 8, e42762 (2019).

    Article  Google Scholar 

  7. 7.

    Harvey, N. L. et al. Lymphatic vascular defects promoted by Prox1 haploinsufficiency cause adult-onset obesity. Nat. Genet. 37, 1072–1081 (2005).

    CAS  Article  Google Scholar 

  8. 8.

    Wigle, J. T. & Oliver, G. Prox1 function is required for the development of the murine lymphatic system. Cell 98, 769–778 (1999).

    CAS  Article  Google Scholar 

  9. 9.

    Johnson, N. C. et al. Lymphatic endothelial cell identity is reversible and its maintenance requires Prox1 activity. Genes Dev. 22, 3282–3291 (2008).

    CAS  Article  Google Scholar 

  10. 10.

    Sörensen, I., Adams, R. H. & Gossler, A. DLL1-mediated Notch activation regulates endothelial identity in mouse fetal arteries. Blood 113, 5680–5688 (2009).

    Article  Google Scholar 

  11. 11.

    Zhang, L. et al. VEGFR-3 ligand-binding and kinase activity are required for lymphangiogenesis but not for angiogenesis. Cell Res. 20, 1319–1331 (2010).

    ADS  CAS  Article  Google Scholar 

  12. 12.

    Hsieh, P. C. H., Davis, M. E., Lisowski, L. K. & Lee, R. T. Endothelial–cardiomyocyte interactions in cardiac development and repair. Annu. Rev. Physiol. 68, 68–51 (2006).

    Article  Google Scholar 

  13. 13.

    Brutsaert, D. L. & Cotran, R. S. Cardiac endothelial-myocardial signaling: its role in cardiac growth, contractile performance, and rhythmicity. Physiol. Rev. 83, 59–115 (2003).

    CAS  Article  Google Scholar 

  14. 14.

    Jossin, Y. Neuronal migration and the role of reelin during early development of the cerebral cortex. Mol. Neurobiol. 30, 225–251 (2004).

    CAS  Article  Google Scholar 

  15. 15.

    D’Arcangelo, G. Reelin in the years: controlling neuronal migration and maturation in the mammalian brain. Adv. Neurosci. (Hindawi) 2014, 1–19 (2014).

    Article  Google Scholar 

  16. 16.

    Lutter, S., Xie, S., Tatin, F. & Makinen, T. Smooth muscle-endothelial cell communication activates Reelin signaling and regulates lymphatic vessel formation. J. Cell Biol. 197, 837–849 (2012).

    CAS  Article  Google Scholar 

  17. 17.

    D’Arcangelo, G. et al. A protein related to extracellular matrix proteins deleted in the mouse mutant reeler. Nature 374, 719–723 (1995).

    ADS  Article  Google Scholar 

  18. 18.

    Lane-Donovan, C. et al. Reelin protects against amyloid β toxicity in vivo. Sci. Signal. 8, ra67–ra67 (2015).

    Article  Google Scholar 

  19. 19.

    Srinivasan, R. S. et al. Lineage tracing demonstrates the venous origin of the mammalian lymphatic vasculature. Genes Dev. 21, 2422–2432 (2007).

    CAS  Article  Google Scholar 

  20. 20.

    Trommsdorff, M. et al. Reeler/Disabled-like disruption of neuronal migration in knockout mice lacking the VLDL receptor and ApoE receptor 2. Cell 97, 689–701 (1999).

    CAS  Article  Google Scholar 

  21. 21.

    Hiesberger, T. et al. Direct binding of Reelin to VLDL receptor and ApoE receptor 2 induces tyrosine phosphorylation of disabled-1 and modulates tau phosphorylation. Neuron 24, 481–489 (1999).

    CAS  Article  Google Scholar 

  22. 22.

    Lin, L. et al. Reelin promotes the adhesion and drug resistance of multiple myeloma cells via integrin β1 signaling and STAT3. Oncotarget 7, 9844–9858 (2016).

    Article  Google Scholar 

  23. 23.

    Dulabon, L. et al. Reelin binds α3β1 integrin and inhibits neuronal migration. Neuron 27, 33–44 (2000).

    CAS  Article  Google Scholar 

  24. 24.

    Beffert, U. et al. Reelin-mediated signaling locally regulates protein kinase B/Akt and glycogen synthase kinase 3β. J. Biol. Chem. 277, 49958–49964 (2002).

    CAS  Article  Google Scholar 

  25. 25.

    Jossin, Y. & Goffinet, A. M. Reelin signals through phosphatidylinositol 3-kinase and Akt to control cortical development and through mTor to regulate dendritic growth. Mol. Cell. Biol. 27, 7113–7124 (2007).

    CAS  Article  Google Scholar 

  26. 26.

    Ieda, M. et al. Cardiac fibroblasts regulate myocardial proliferation through β1 integrin signaling. Dev. Cell 16, 233–244 (2009).

    CAS  Article  Google Scholar 

  27. 27.

    Porrello, E. R. et al. Transient regenerative potential of the neonatal mouse heart. Science 331, 1078–1080 (2011).

    ADS  CAS  Article  Google Scholar 

  28. 28.

    Wei, K. et al. Epicardial FSTL1 reconstitution regenerates the adult mammalian heart. Nature 525, 479–485 (2015).

    ADS  CAS  Article  Google Scholar 

  29. 29.

    Serpooshan, V. et al. The effect of bioengineered acellular collagen patch on cardiac remodeling and ventricular function post myocardial infarction. Biomaterials 34, 9048–9055 (2013).

    CAS  Article  Google Scholar 

  30. 30.

    Karkkainen, M. J. et al. A model for gene therapy of human hereditary lymphedema. Proc. Natl Acad. Sci. USA 98, 12677–12682 (2001).

    ADS  CAS  Article  Google Scholar 

  31. 31.

    Burridge, P. W. et al. Chemically defined generation of human cardiomyocytes. Nat. Methods 11, 855–860 (2014).

    CAS  Article  Google Scholar 

  32. 32.

    Burridge, P. W., Holmström, A. & Wu, J. C. Chemically defined culture and cardiomyocyte differentiation of human pluripotent stem cells. Curr. Prot. Human Genet. 87, 21.3.1–21.3.15 (2015).

    Google Scholar 

  33. 33.

    Liu, X. et al. Rasip1 controls lymphatic vessel lumen maintenance by regulating endothelial cell junctions. Development 145, dev165092 (2018).

    Article  Google Scholar 

Download references

Acknowledgements

This work was supported by NIH grant (RO1HL073402-16) to G.O., AHA grant (18CDA34110356) to X.L., 5T32HL134633 to W.M., FPU grant from the Spanish Ministry of Education, Culture and Sports and EMBO Short-Term Fellowship to E.D.C., Leducq TNE-17CVD and RD16/0011/0019 (ISCIII) from the Spanish Ministry of Science, Innovation, and Universities to M.T., NIH T32 GM008061 to C.L., HL63762, and NS093382 to J.H. We thank G. M. Rune and B. Brunne for the Reln+/− strain. RNA-seq work was supported by the Northwestern University NUSeq Core Facility. We thank the Robert H. Lurie Cancer Center Flow Cytometry facility supported by NCI CCSG P30 CA060553 for their invaluable assistance. Flow Cytometry Cell Sorting was performed on a BD FACSAria SORP system and BD FACSymphony S6 SORP system, purchased through the support of NIH 1S10OD011996-01 and 1S10OD026814-01. Imaging work was performed at the Northwestern University Center for Advanced Microscopy supported by NCI CCSG P30 CA060553 awarded to the Robert H Lurie Comprehensive Cancer Center. Spinning disk confocal microscopy was performed on an Andor XDI Revolution microscope, purchased through the support of NCRR 1S10 RR031680-01. Proteomics services were performed by the Northwestern Proteomics Core Facility supported by NCI CCSG P30 CA060553 awarded to the Robert H Lurie Comprehensive Cancer Center, instrumentation award (S10OD025194) from NIH Office of Director, and the National Resource for Translational and Developmental Proteomics supported by P41 GM108569. We thank the George M. O’Brien Kidney Research Core Center (NU GoKidney, supported by a P30 DK114857 award from NIDDK) for the use of the Echocardiography machine. The myocardial infarction surgeries were performed by the comprehensive Transplant Center Microsurgery Core, partially supported by NIH NIAID P01AI112522. We thank J. Jin and P. Liu for help with the ELISA reagents and data analysis, R. Ma for help with DNA polyploidy analysis, A. Shi for the MEF2C antibodies, M. Dellinger for the Prox1-creERT2 mice and H. Ardehali for the Myh6-cre mice. We specially thank B. Sosa-Pineda for advice and suggestions and P. Ruiz-Lozano for sharing her expertise in the preparation of the collagen patches.

Author information

Affiliations

Authors

Contributions

X.L. and G.O. designed the experiments and analysed the data. X.L. performed most of the experiments and data analysis. E.D.C. performed the neonate myocardial infarction and acquired data. T.T. and J.H. provided the Reln conditional mouse strain and generated some of the conditional crosses. X.G. helped with the generation, isolation and data analysis of Reln conditional embryos. C.L. and E.T. provided valuable advice with the neonate myocardial infarction and Echo data protocols. Z.J. and L.B. generated the Vegfr3kd/kd embryos and analysed that data. M.O.-B. and W.M. helped with the generation of mouse lines, histology and discussions. H.K. and P.B. generated the iPS cell-derived CMs. T.B. helped with the primary cell culture experiments and qPCR analysis. O.C. helped to obtain and generate some of the mutant strains. M.T. provided valuable experimental advice and critical reading of the manuscript. X.L. and G.O. wrote the manuscript.

Corresponding author

Correspondence to Guillermo Oliver.

Ethics declarations

Competing interests

J.H. is a shareholder of Reelin Therapeutics and a co-inventor on a pending US patent application filed by his institution (UT Southwestern; application number 15/763,047 and publication number 20180273637, title “Methods and Compositions for Treatment of Atherosclerosis”; Inventors: J.H., Y. Ding, X. Xian, L. Huang, C. Mineo, P. Shaul and L. Calvier). This patent application covers no aspects of the current manuscript. Findings regarding the potential applications and methods for using RELN to treat cardiac diseases are the subject of provisional patent application (US63/091,558) owned by Northwestern University and list X.L. and G.O. as inventors. All other authors declare no competing interests.

Additional information

Peer review information Nature thanks Kristy Red-Horse and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data figures and tables

Extended Data Fig. 1 E17.5 Prox1ΔLEC/ΔLEC hearts lack LECs and have a reduced number of CMs.

a, Whole-mount immunostaining with anti-PROX1 antibody shows that cardiac lymphatics are missing in E17.5 Prox1ΔLEC/ΔLEC hearts (TAM injected at E13.5 and E14.5). Squared areas are shown in larger magnification in the adjacent images. n = 3 embryos per group from two litters. b, Co-immunostaining of E17.5 control and Prox1ΔLEC/ΔLEC heart sections with anti-α-actinin and F-actin antibodies show that cardiac muscle is not affected in Prox1ΔLEC/ΔLEC embryos (TAM injected at E13.5 and E14.5). n = 3 per group. c, Flow cytometry analysis shows reduced CM numbers in E17.5 Prox1ΔLEC/ΔLEC hearts (TAM injected at E13.5 and E14.5). d, Hoechst 33342 labelling shows no significant differences in CMs ploidy between control and Prox1ΔLEC/ΔLEC hearts. n = 3 (control) and n = 4 (Prox1ΔLEC/ΔLEC) embryos from the same litter used in c and d. Data are mean ± s.e.m. **P = 0.001, unpaired two-tailed Student’s t-test. n.s., not significant. eg, The percentage of multinucleated CMs in E17.5 mutant hearts is increased (e, f), and no global differences in CM size were detected (e, g) after CM dissociation and overnight plating. n = 3 embryo per genotype from the same litter. White arrows indicate CMs and yellow arrows indicate a bi-nucleated CM (g). The average cell size was calculated from 25 cTnC+ CMs per culture (1 whole heart per culture; 3 cultures per genotype). n = 75 (control CMs) and n = 75 (Prox1ΔLEC/ΔLEC CMs). Data are mean ± s.e.m. *P = 0.023, unpaired two-tailed Student’s t-test. Scale bars, 500 μm (a), 25 μm (b, e). Flow cytometry gating strategy is included in Supplementary Fig. 10.

Source Data

Extended Data Fig. 2 CM proliferation is reduced in E17.5 Prox1ΔLEC/ΔLEC hearts.

a, EdU labelling shows an overall reduction in the number of EdU+ cells in sections of E17.5 Prox1ΔLEC/ΔLEC hearts. Dashed boxes indicate the corresponding areas of the heart that are shown at higher magnification in be. be, Immunostaining results show the presence of PROX1+LYVE1+ cardiac lymphatics (white arrows) in sections of control hearts (b, c), and lack of lymphatics in Prox1ΔLEC/ΔLEC hearts (d, e). Yellow arrows indicate LYVE1+ PROX1 macrophages. n = 3 embryos per genotype from three separate litters. f, CM proliferation is reduced in the myocardium of the left ventricle (LV) area, the right ventricle (RV) area and the septum. n = 4 embryos per genotype from three separate litters. At least three images per region and three separate regions per heart were quantified. Data are mean ± s.e.m. *P = 0.01, **P = 0.003, 0.006 and 0.02 (top); ***P = 0.0001, **P = 0.004, 0.002 and 0.005 (middle); **P = 0.001, 0.001, *P = 0.01 and **P = 0.002 (bottom), unpaired two-tailed Student’s t-test. g, Immunostaining with antibodies against vimentin (fibroblasts), PECAM1 (blood endothelial cells), CD68 (macrophages), SIX2 (nephron progenitors) or HNF4A (hepatocytes) together with EdU labelling (white arrows) shows no differences in proliferation in those cell types between E17.5 Prox1ΔLEC/ΔLEC and control hearts (TAM injected at E13.5 and E14.5). P values by unpaired two-tailed Student’s t-test. n = 3 embryos per genotype from three separate litters. Control are TAM-treated cre embryos and cre+;Prox1+/+ littermates. Data are mean ± s.e.m. Scale bars, 200 μm (a), 100 μm (be), 25 μm (g).

Source Data

Extended Data Fig. 3 Vegfr3kd/kd embryos lack cardiac lymphatics and have smaller hearts.

a, Bright-field images of whole E17.5 Vegfr3kd/kd and wild-type embryos and hearts. Quantification of organ weight (heart, liver and kidney) relative to body length indicates that the heart is smaller and the liver and kidney have comparable sizes between Vegfr3kd/kd and control embryos. n = 10 (WT) and n = 8 (Vegfr3kd/kd). Embryos are from three different litters. *P = 0.019. b, LYVE1 whole-mount immunostaining shows that ventral and dorsal sides of the heart lack lymphatics in Vegfr3kd/kd embryos. n = 3 per genotype. cf, Co-immunostaining using antibodies against cell proliferation markers (EdU, pH3, Ki67 and auroraB) and antibodies against CM markers (cTnC, PROX1, α-actinin and/or MEF2C) shows reduced CM proliferation in Vegfr3kd/kd hearts compared to wild-type hearts at E17.5. Arrows indicate representative proliferating CMs. g, Quantification shows significantly reduced percentage of EdU+ and Ki67+ CMs and significantly reduce number of pH3+ and auroraB+ CMs in Vegfr3kd/kd hearts compared to controls. n = 4 embryos per genotype from three separate litters. **P = 0.005 (EdU), **P = 0.001 (Ki67, pH3), *P = 0.02 (auroraB). h, Active CASP3+ immunostaining shows increased CM apoptosis (white arrows) in Vegfr3kd/kd hearts compared to wild-type hearts at E17.5. Right, quantitative data showing significantly increased percentage of active caspase-3+ CMs (PROX1+) in Vegfr3kd/kd hearts compared to wild-types. n = 4 embryos per genotype from three separate litters. *P = 0.032. i, Co-immunostaining with antibodies against vimentin, PECAM1, CD68, SIX2 and HNF4A, together with EdU labelling shows comparable proliferation of cardiac fibroblasts, blood endothelial cells and macrophages, and of nephron progenitors and hepatocytes between wild-type and Vegfr3kd/kd embryos at E17.5. White arrows indicate EdU+ proliferating cells. Right, quantification of the proliferation for each cell type. n = 3 embryos per genotype from three separate litters. Data are mean ± s.e.m. P values were determined by unpaired two-tailed Student’s t-test. Scale bars, 1 mm (a), 500 μm (b), 25 μm (cf, h), 25 μm (i). Lower magnification images for ce and h are included in Supplementary Fig. 4.

Source Data

Extended Data Fig. 4 Heart size and CM proliferation is normal in E17.5 Prox1ΔLEC/+ embryos and E14.5 Prox1ΔLEC/ΔLEC embryos.

a, Bright-field images of whole embryos and hearts show no difference in heart size in E17.5 Prox1ΔLEC/+ embryos (TAM injected at E13.5 and E14.5). White arrows indicate oedema in the Prox1ΔLEC/+ embryo. b, Whole-mount immunostaining shows that LYVE1+ cardiac lymphatics are present in both dorsal and ventral sides of Prox1ΔLEC/+ hearts. Lymphatics are less branched (arrows). c, Cardiac lymphatic density is significantly reduced on the ventral surface of the heart but not on the dorsal one in Prox1ΔLEC/+ embryos. This difference may be because cardiac lymphatics on the dorsal side and the ventral side originate from two different lineages during embryonic development. n = 3 embryos per genotype from three separate litters. *P = 0.027. d, Heart size is normal in E17.5 Prox1ΔLEC/+ embryos. n = 13 (controls) and n = 9 (Prox1ΔLEC/+) embryos from three separate litters. e, Quantification of the immunostaining analysis shows no significant differences in CM proliferation between E17.5 Prox1ΔLEC/+ hearts and controls, as indicated by the percentage of EdU+ and Ki67+ CMs and the number of pH3+ and auroraB+ CMs. n = 4 embryos per genotype from three separate litters. Controls are TAM-treated cre embryos and cre+;Prox1+/+ littermates. f, Bright field images of whole embryos and hearts show no difference in cardiac size between E14.5 wild-type and Prox1ΔLEC/ΔLEC embryos (TAM injected at E10.5 and E11.5). White arrows indicate severe oedema. n = 6 embryos per genotype from two separate litters. Control embryos are TAM-treated cre embryos and cre+;Prox1+/+ littermates. g, Whole-mount staining of skin shows efficient PROX1 deletion as indicated by the lack of PROX1+ or NRP2+ lymphatics at E14.5 in Prox1ΔLEC/ΔLEC embryos. n = 3 embryos per genotype from same litter. h, Co-immunostaining against cell proliferation markers (EdU, Ki67, pH3 and auroraB) together with CM markers (cTnC, PROX1, α-actinin and/or MEF2C). Quantification of those immunostainings shows no differences in CM proliferation between wild-type and Prox1ΔLEC/ΔLEC hearts at E14.5. Squares indicate proliferating CMs. n = 3 embryos per genotype from the same litter. Data are mean ± s.e.m. P values determined by unpaired two-tailed Student’s t-test. Scale bars, 1 mm (a, f), 500 μm (b), 25 μm (g, h).

Source Data

Extended Data Fig. 5 Pathways related to cell cycle are downregulated in E17.5 Prox1ΔLEC/ΔLEC embryos and LEC-conditioned medium promotes CM proliferation and survival in vitro.

a, Gene set expression analysis shows downregulation of cell cycle pathways and upregulation of cell death pathways in Prox1ΔLEC/ΔLEC hearts. n = 4 per genotype from the same litter. b, qPCR analysis confirmed the upregulation of pro-apoptotic genes (Bcl2l11, Pdcd4, Trp53inp1, Stat1 and P21 (also known as Cdkn1a)) and downregulation of cell cycle related genes (Cdc6, E2f1, Pcna, Mcm5 and Ccne2) in Prox1ΔLEC/ΔLEC hearts. n = 3 per genotype from the same litter. TAM was injected at E13.5 and E14.5. Control embryos are TAM-treated cre embryos and cre+;Prox1+/+ littermates. *P = 0.02 (Bcl2l11), **P = 0.001 (Pdcd4), 0.005 (Trp53inp1), *P = 0.01 (Stat1), 0.03 (P21), 0.04 (Cdc6), 0.02 (E2f1), 0.01 (Pcna), 0.02 (Mcm5) and 0.03 (Ccne2). c, Co-immunostaining against the proliferation marker Ki67 and the CM markers α-actinin and PROX1 shows that LEC-conditioned medium increases primary CM proliferation. Arrows indicate proliferating CMs. Percentage of CM proliferation was quantified by the number of Ki67+ PROX1+ CMs relative to total number of PROX1+ CMs. n = 3. **P = 0.001. d, Co-immunostaining against the apoptotic marker active CASP3+ and the CM markers α-actinin and PROX1 shows reduced primary CM apoptosis upon LEC-conditioned medium treatment under CoCl2-induced hypoxia. Arrows indicate apoptotic CMs. Percentage of apoptotic CMs was quantified by the number of active CASP3+ CMs relative to PROX1+ CMs. n = 3. **P = 0.003. Data are mean ± s.e.m. P values were determined by unpaired two-tailed Student’s t-test Scale bar, 25 μm (c, d).

Source Data

Extended Data Fig. 6 E17.5 Reln−/− embryos develop smaller hearts.

a, qPCR analysis shows reduced Reln expression in E17.5 Prox1ΔLEC/ΔLEC hearts (TAM injected at E13.5 and E14.5). n = 3 embryos per genotype from the same litter. Control embryos are TAM treated cre embryos and cre+;Prox1+/+littermates. *P = 0.014. b, qPCR analysis validates the expression of candidates from the LECs secretome (Serpine1, Fn1, Reln, Hspg2, Mmrn1, Lama4, Fstl1 and Thbs1). Experiments were repeated three times using different batches of LECs. Gene expression is normalized as a fold change relative to 100× Gapdh. c, RELN protein can be detected in three different batches of LEC-conditioned medium and the relative RELN level is quantified by ELISA according to the absorbance value at 450 nm (A450 nm). d, e, Immunostaining of sections of E17.5 wild-type hearts shows RELN is highly expressed in cardiac lymphatics of the epicardium and myocardium. Some blood vessels in the heart express low levels of RELN (e, arrows). n = 3 wild-type embryos. f, Immunostaining of E17.5 control and Prox1ΔLEC/ΔLEC heart sections with antibodies against RELN and LYVE1 shows that cardiac lymphatics and RELN are absent in Prox1ΔLEC/ΔLEC hearts (TAM injected at E13.5 and E14.5). n = 3 embryos per genotype from the same litter. Control embryos are TAM-treated littermate cre and cre+; Prox1+/+embryos. g, Representative bright-field images show smaller hearts in E17.5 Reln−/− embryos. h, Quantifications of organ weight (heart, liver and kidney) relative to body length indicate that hearts are smaller in E17.5 Reln−/− embryos compared to controls. n = 7 (WT) and n = 6 (Reln−/−) embryos from three separate litters. *P = 0.03. i, Whole-mount immunostaining shows that cardiac lymphatic development is normal in Reln−/− embryos. n = 3 embryos per genotype from two separate litters. Data are mean ± s.e.m. P values were determined by unpaired two-tailed Student’s t-test. Scale bars, 25 μm (df), 1 mm (g), 500 μm (i).

Source Data

Extended Data Fig. 7 RELN is efficiently deleted in RelnΔLEC/ΔLEC cardiac-associated lymphatics.

a, Immunostaining of E17.5 control and RelnΔLEC/ΔLEC heart sections with antibodies against RELN and LYVE1 confirms that RELN is deleted from cardiac lymphatics in RelnΔLEC/ΔLEC hearts (TAM injected at E13.5 and E14.5). n = 3 embryos per genotype from two separate litters. Control embryos are TAM-treated cre embryos and cre+;Reln+/+embryos. b, Co-immunostaining with antibodies against vimentin, PECAM1, CD68, SIX2 and HNF4Α, together with EdU labelling shows comparable proliferation of cardiac fibroblasts, blood endothelial cells and macrophages, and of nephron progenitors and hepatocytes between controls and E17.5 RelnΔLEC/ΔLEC hearts (TAM injected at E13.5 and E14.5). White arrows indicate EdU+ proliferating cells. Right, quantification of the proliferation for each cell type. n = 3 embryos per genotype from two separate litters. Control embryos are TAM-treated cre and cre+;Reln+/+ littermates. Data are mean ± s.e.m. P values determined by unpaired two-tailed Student’s t-test. Scale bar, 25 μm.

Source Data

Extended Data Fig. 8 Cardiac size is reduced in E17.5 β1ΔCM/+;Reln+/− embryos.

a, qPCR analysis shows efficient Reln knockdown in LECs after siRNA treatment. n = 3. Data are mean ± s.e.m. *P < 0.05, unpaired two-tailed Student’s t-test. b, Representative western blot of primary CMs cultured with DMEM, conditioned medium from CMs treated with short interfering RNA (siRNA) against Reln (siReln) or control siRNA (siCtrl), or with conditioned medium plus integrin-β1 blocking antibody overnight. The addition of the LEC-conditioned medium (siCtrl group) to primary CMs increased DAB1, FAK, AKT and ERK activities. These activities are reduced when cultured CMs are treated with RELN-deficient LEC-conditioned medium or with LEC-conditioned medium with integrin-β1 blocking antibody. Experiments were repeated three times. Data are mean ± s.e.m. *P < 0.05, **P < 0.01, ***P < 0.001, two-way ANOVA followed by Bonferroni test. c, Ki67 quantification of immunostained cultured cells (similar to Extended Data Fig. 5c) shows that addition of the LEC-conditioned medium (siCtrl group) to cultured primary CMs improves CM proliferation and this effect is partially abolished in CMs treated with Reln-deficient (siReln) LEC-conditioned medium or with LEC-conditioned medium containing integrin-β1 blocking antibody. Percentage of CM proliferation was quantified by the number of Ki67+ PROX1+ CMs relative to total numbers of PROX1+ CMs. n = 3. Data are mean ± s.e.m. **P < 0.01, two-way ANOVA followed by Bonferroni test. d, Quantification of cultured CMs immunostained with active CASP3+ shows that the addition of the LEC-conditioned medium (siCtrl group) to primary CMs protects them from apoptosis and this effect is partially abolished in CMs treated with Reln-deficient LEC-conditioned medium or with LEC-conditioned medium with integrin-β1 blocking antibodies. Percentage of apoptotic CMs was quantified by the number of active CASP3+ CMs relative to PROX1+ CMs. n = 3. Data are mean ± s.e.m. *P < 0.05, **P < 0.01, two-way ANOVA followed by Bonferroni test. e, Representative western blot of primary CMs after treatment with RELN-conditioned medium from RELN- transfected cells, or conditioned medium from mock-transfected cells (control) or RELN-conditioned medium with integrin-β1 blocking antibody (ab) shows that RELN treatment increases DAB1, FAK, AKT and ERK activities in primary CMs, and these activities are reduced by adding the integrin-β1 blocking antibody. n = 3. Data are mean ± s.e.m. *P < 0.05; **P < 0.01 by one-way ANOVA followed by Tukey’s test. f, Bright-field images show no difference in embryo size at E17.5 among control, Reln+/−, β1ΔCM/+ and β1ΔCM/+;Reln+/− embryos. Quantification of organ weight (heart, liver and kidney) relative to body length indicates that hearts are smaller in E17.5 β1ΔCM/+;Reln+/− embryos. n = 9 (control), n = 7 (Reln+/−), n = 6 (β1ΔCM/+) and n = 6 (β1ΔCM/+;Reln+/−) embryos from three separate litters. Data are mean ± s.e.m. *P = 0.015, one-way ANOVA followed by Tukey’s test. g, Whole-mount immunostaining using LYVE1 antibodies shows normal cardiac lymphatic development in control, β1ΔCM/+, β1ΔCM/+;Reln+/− and Reln+/− embryos. n = 3 embryos per genotype from three separate litters. Scale bars, 1 mm (f), 500 μm (g). For western blot source data, see Supplementary Figs. 8 and 9. Exact P values included in Source Data.

Source Data

Extended Data Fig. 9 RELN promotes CM proliferation and survival through Itgb1 signalling.

a, Co-immunostaining using cell proliferation markers (EdU, Ki67, pH3 and auroraB) together with CM markers (cTnC, PROX1, α-actinin and/or MEF2C) shows reduced CM proliferation in β1ΔCM/+;Reln+/− hearts at E17.5. Arrows indicate proliferating CMs. Quantification in the bottom panel shows reduced proliferation in E17.5 β1ΔCM/+;Reln+/− hearts, as indicated by the percentage of EdU+ and Ki67+ CMs and the number of pH3+ and auroraB+ CMs. n = 4 embryos per genotype from three separate litters. *P = 0.022 (EdU), 0.029 (Ki67), ***P = 0.0001 (pH3) and *P = 0.033 (auroraB). b, Active CASP3+immunostaining shows increased CM apoptosis in β1ΔCM/+;Reln+/− hearts at E17.5, as quantified by the percentage of active CASP3+ CMs relative to PROX1+ CMs. Arrows indicate apoptotic CMs. n = 4 embryos per genotype from three separate litters. Control embryos are cre embryos and cre+;β1+/+ littermates. *P = 0.01. c, Co-immunostaining with antibodies against vimentin, PECAM1, CD68, SIX2 and HNF4A, together with EdU labelling shows comparable proliferation of cardiac fibroblasts, blood endothelial cells and macrophages, and of nephron progenitors and hepatocytes between controls and E17.5 β1ΔCM/+;Reln+/− embryos. White arrows indicate EdU+ proliferating cells. Right, quantification of the proliferation analysis for each of cell type. n = 3 embryos per genotype from three separate litters. Control are cre embryos and cre+;β1+/+ littermates. Data are mean ± s.e.m. P values determined by unpaired two-tailed Student’s t-test. Scale bars, 25 μm. Lower magnification images for a and b are included in Supplementary Fig. 5.

Source Data

Extended Data Fig. 10 RELN expression is developmentally downregulated, but is upregulated in newly formed cardiac lymphatics after myocardial infarction.

a, Immunostaining with RELN, PROX1 and PECAM shows RELN is highly expressed in cardiac lymphatics in the epicardium and myocardium nearby the base of the heart at E17.5. RELN expression level is gradually downregulated during development from P2 to P14. n = 3 hearts per stage. Arrows indicate PROX1+ cardiac lymphatics. b, qPCR analysis using sorted cardiac lymphatics shows Reln levels are drastically downregulated in cardiac LECs during development. n = 3. Reln relative level from each experiment is presented as fold changes relative to E17.5. Data are mean ± s.e.m. **P = 0.009 (P2 versus E17.5), 0.004 (P7 versus E17.5), 0.001 (P14 versus E17.5) by one-way ANOVA followed by Tukey’s test. c, Immunostaining shows RELN expression is highly upregulated in the newly formed cardiac lymphatics in wild-type P7 pups (myocardial infarction was performed at P2). Notably, the pre-existing cardiac lymphatics in the non-infarcted area express low levels of RELN. Reln−/− hearts completely lack RELN expression in both, newly formed cardiac lymphatics and pre-existing lymphatics. Arrows indicate cardiac lymphatics. n = 3 hearts per group. d, Immunostaining against the pan-endothelial marker PECAM1 and the lymphatic marker LYVE1 shows normal lymphangiogenesis in wild-type and Reln−/− hearts 21 days after myocardial infarction (myocardial infarction performed at P2). n = 3 hearts per group. Data are mean ± s.e.m. P values determined by unpaired two-tailed Student’s t-test. e, EdU labelling shows no differences in LECs proliferation in wild-type and Reln−/− hearts 21 days after myocardial infarction (myocardial infarction performed at P2). n = 3 hearts per group. Data are mean ± s.e.m. P values determined by unpaired two-tailed Student’s t-test. Arrow indicates EdU+ LECs. Scale bars, 100 μm (d), 25 μm (a, c, e).

Source Data

Extended Data Fig. 11 RELN improves cardioprotection in neonates and adult mice after myocardial infarction.

ad, Co-immunostaining using cell proliferation markers (EdU, Ki67, pH3 and auroraB) together with the CM markers PROX1, α-actinin or MEF2C shows decreased CM proliferation in the border of the infarcted area of Reln−/− hearts at P7. Arrows indicate proliferating CMs.  n = 4 mice per group. e, Immunostaining using active CASP3+ shows increased CM apoptosis in the infarcted area of Reln−/− hearts at P7. Arrows indicate apoptotic CMs in the section. n = 4 mice per group. f, Immunostaining against the cell proliferation markers EdU, Ki67 and pH3 together with the CM markers MEF2C or cTnC shows no differences in CM proliferation in the infarcted areas between control patch or RELN patch treated hearts 7 days after myocardial infarction. Arrows indicate proliferating CMs. n = 4 hearts per group. g, Immunostaining using active caspase-3 shows reduced CM apoptosis in the infarcted area of RELN patch-treated hearts. Arrows indicate apoptotic CMs. n = 4 mice per group. Arrows indicate apoptotic CMs. Scale bars, 25 μm. Lower magnification for ac, e and g are included in Supplementary Fig. 3.

Supplementary information

Supplementary Figures 1-10

This file contains Supplementary Figures 1-5 showing lower magnification images for CM proliferation and apoptosis; Supplementary Figures 6-9 showing source data for Western blots; and Supplementary Figure 10 showing gating strategy for flow cytometry.

Reporting Summary

Source data

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Liu, X., De la Cruz, E., Gu, X. et al. Lymphoangiocrine signals promote cardiac growth and repair. Nature 588, 705–711 (2020). https://doi.org/10.1038/s41586-020-2998-x

Download citation

Further reading

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing